Name: engineering and evolution of synthetic adeno-associated virus (aav) gene therapy vectors via dna family shuffling
Uploaded: 2012-04-02T12:00:00
Description: Watch this Scientific Journal Video about Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling at JoVE.com

저자들은 기꺼이 그 하이 델베르크 대학에서 우수 CellNetworks의 클러스터에서뿐만 아니라 애인과 하인즈 Schaller (CHS) 재단이 뛰어난 자신의 실험실 지원, 팀 구성원 및 작품을 인정합니다. 유전자 가족 걸어갔다 3 년 전 우리의 첫 출간 이후 매우 활동적인 분야가되므로 작업으로 인해 공간상의 제약으로 여기서 따온 수없는 관련 서적의 모든 저자에게 사과했다 통해 우리는 그 분자 AAV 진화에 감사드립니다.

1. AAV Capsid의 유전자를 인코딩 플라스미드 세트의 작성 <ol><li> 이후 DNA를 걸어갔다위한 다양한 AAV capsid (캡) 유전자의 충분한 양의 일상적인 준비를 용이하게하기 위해 초기에는 일반적인 플라스미드 백본으로 이러한 유전자를 subclone. 그것은 중첩된 PCR 및 클로닝을위한 프라이머 바인딩 사이트 (그림 2)처럼 나중에 사용하기 위해&gt; 20 세포핵의 동일한 측면 시퀀스를 포함하?...

<ol>
	<li>Grimm, D., Kay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+virus+evolution+to+vector+revolution:+use+of+naturally+occurring+serotypes+of+adeno-associated+virus+(AAV)+as+novel+vectors+for+human+gene+therapy.">From virus evolution to vector revolution: use of naturally occurring serotypes of adeno-associated virus (AAV) as novel vectors for human gene therapy.</a> Curr. Gene Ther. 3, 281-304 (2003).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+methods+for+gene+transfer+vectors+based+on+adeno-associated+virus+serotypes.">Production methods for gene transfer vectors based on adeno-associated virus serotypes.</a> Methods. 28, 146-157 (2002).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+gene+therapy+vector+evolution+via+multispecies+interbreeding+and+retargeting+of+adeno-associated+viruses.">In vitro and in vivo gene therapy vector evolution via multispecies interbreeding and retargeting of adeno-associated viruses.</a> J. Virol. 82, 5887-5911 (2008).</li><li>Muller, O. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+peptide+libraries+displayed+on+adeno-associated+virus+to+select+for+targeted+gene+therapy+vectors.">Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors.</a> Nat. Biotechnol. 21, 1040-1046 (2003).</li><li>Perabo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+viral+vectors+with+modified+tropism:+the+adeno-associated+virus+display.">In vitro selection of viral vectors with modified tropism: the adeno-associated virus display.</a> Mol. Ther. 8, 151-157 (2003).</li><li>Zolotukhin, S., Potter, M., Hauswirth, W. W., Guy, J., Muzyczka, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+"humanized"+green+fluorescent+protein+cDNA+adapted+for+high-level+expression+in+mammalian+cells.">A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells.</a> J. Virol. 70, 4646-4654 (1996).</li><li>Wobus, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+against+the+adeno-associated+virus+type+2+(AAV-2)+capsid:+epitope+mapping+and+identification+of+capsid+domains+involved+in+AAV-2-cell+interaction+and+neutralization+of+AAV-2+infection.">Monoclonal antibodies against the adeno-associated virus type 2 (AAV-2) capsid: epitope mapping and identification of capsid domains involved in AAV-2-cell interaction and neutralization of AAV-2 infection.</a> J. Virol. 74, 9281-9293 (2000).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fatality+in+mice+due+to+oversaturation+of+cellular+microRNA/short+hairpin+RNA+pathways.">Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways.</a> Nature. 441, 537-541 (2006).</li><li>Nakai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unrestricted+hepatocyte+transduction+with+adeno-associated+virus+serotype+8+vectors+in+mice.">Unrestricted hepatocyte transduction with adeno-associated virus serotype 8 vectors in mice.</a> J. Virol. 79, 214-224 (2005).</li><li>Koerber, J. T., Jang, J. H., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+shuffling+of+adeno-associated+virus+yields+functionally+diverse+viral+progeny.">DNA shuffling of adeno-associated virus yields functionally diverse viral progeny.</a> Mol. Ther. 16, 1703-1709 (2008).</li><li>Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+and+selection+of+shuffled+AAV+genomes:+a+new+strategy+for+producing+targeted+biological+nanoparticles.">Engineering and selection of shuffled AAV genomes: a new strategy for producing targeted biological nanoparticles.</a> Mol. Ther. 16, 1252-1260 (2008).</li><li>Ward, P., Walsh, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+AAV+Cap+sequences+alter+gene+transduction.">Chimeric AAV Cap sequences alter gene transduction.</a> Virology. 386, 237-248 (2009).</li><li>Yang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+myocardium+tropic+adeno-associated+virus+(AAV)+evolved+by+DNA+shuffling+and+in+vivo+selection.">A myocardium tropic adeno-associated virus (AAV) evolved by DNA shuffling and in vivo selection.</a> Proc. Natl. Acad. Sci. U.S.A. 106, 3946-3951 (2009).</li><li>Perabo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+engineering+of+a+gene+therapy+vector:+directed+evolution+of+adeno-associated+virus.">Combinatorial engineering of a gene therapy vector: directed evolution of adeno-associated virus.</a> J. Gene. Med. 8, 155-162 (2006).</li><li>Maheshri, N., Koerber, J. T., Kaspar, B. K., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+adeno-associated+virus+yields+enhanced+gene+delivery+vectors.">Directed evolution of adeno-associated virus yields enhanced gene delivery vectors.</a> Nat. Biotechnol. 24, 198-204 (2006).</li><li>Wu, Z., Asokan, A., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus+serotypes:+vector+toolkit+for+human+gene+therapy.">Adeno-associated virus serotypes: vector toolkit for human gene therapy.</a> Mol. Ther. 14, 316-327 (2006).</li><li>Kwon, I., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designer+gene+delivery+vectors:+molecular+engineering+and+evolution+of+adeno-associated+viral+vectors+for+enhanced+gene+transfer.">Designer gene delivery vectors: molecular engineering and evolution of adeno-associated viral vectors for enhanced gene transfer.</a> Pharm. Res. 25, 489-499 (2008).</li><li>Perabo, L., Huber, A., Marsch, S., Hallek, M., Buning, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Artificial+evolution+with+adeno-associated+viral+libraries.">Artificial evolution with adeno-associated viral libraries.</a> Comb. Chem. High. Throughput. Screen. 11, 118-126 (2008).</li><li>McCarty, D. M., Monahan, P. E., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-complementary+recombinant+adeno-associated+virus+(scAAV)+vectors+promote+efficient+transduction+independently+of+DNA+synthesis.">Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis.</a> Gene Ther. 8, 1248-1254 (2001).</li></ol>

여기서는 유전자 가족 걸어갔다 통해 그리고 세포 또는 동물의 진화에 필수적인 실험 단계와 AAV capsid 엔지니어링에 대한 지침을 마련했습니다. 본질적으로 이러한 프로토콜은 우리가 처음 2008 3 AAV 필드 내에 신고 절차의 표준 버전입니다. 다른 사람이 연구 후속의 한바탕 소동은 다양한 수법의 예를 들면, 10-13를보고했지만, 우리의 현재 버전 업 - 스케일링 및 기타 요구에 ...

<table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td></tr><tr><td> DNase I </td><td> Invitrogen </td><td> 18068-015 </td></tr><tr><td> Polyethylenimine (PEI) </td><td> 시그마 - 올드 리치 </td><td> 408,727 </td></tr><tr><td> 제한 효소 </td><td> 코 </td><td> 여러 </td></tr><tr><td> T4의 DNA Ligase </td><td> 코 </td><td> M0202T </td></tr><tr><td> 젤 추출 키트 </td><td> Qiagen </td><td> 28,704 </td></tr><tr><td> Phusion II의 효소 키트 </td><td> Finnzymes (코) </td><td> F-540S </td></tr><tr><td> HotStar 고음질의 효소 키트 </td><td> Qiagen </td><td> 202,602 </td></tr><tr><td> DMSO </td><td> Finnzymes (코) </td><td> F-540S (키트의 일부) </td></tr><tr><td> EDTA (에틸렌 다이아 민 테트라 초산) (25 ㎜) </td><td> Invitrogen </td><td> 18068-015 (키트의 일부) </td></tr><tr><td> 트리스 </td><td> 로스 </td><td> 4855.2 </td></tr><tr><td> Ampicilin 나트륨 염 </td><td> 로스 </td><td> K029.2 </td></tr><tr><td> dNTPs (10 밀리미터, 100 μl) </td><td> Invitrogen </td><td> 18427013 </td></tr><tr><td> Iodixanol (OptiPrep) </td><td> 축 - 방패 </td><td> 1,114,739 </td></tr><tr><td> Phenolred </td><td> 머크 </td><td> 107,241 </td></tr><tr><td> 플라스미드 메가 간이 키트 </td><td> Qiagen </td><td> 12,181 </td></tr><tr><td> Ultracentrifuge </td><td> Beckman - 보습 바로 앞에 달린 풀베는 날 </td><td> Optima L90K </td></tr><tr><td> 빠른 인감 원심 분리기 튜브 </td><td> Beckman - 보습 바로 앞에 달린 풀베는 날 </td><td> 342,414 </td></tr><tr><td> Electroporation 단위 </td><td> 바이오 방사선 </td><td> GenePulserXcell </td></tr><tr><td> 열전달 자전거 타는 사람 </td><td> Eppendorf </td><td> Vapo 보호 </td></tr><tr><td> 가열 블록 </td><td> BIOER </td><td> 메가바이트-102 </td></tr><tr><td> 형광 현미경 </td><td> 올림포스 산 </td><td> IX81 </td></tr><tr><td> FACS 분석기 </td><td> Beckman - 보습 바로 앞에 달린 풀베는 날 </td><td> Cytomics FC500 MLP </td></tr><tr><td> MegaX DH10B T1R 세포 </td><td> Invitrogen </td><td> C640003 </td></tr><tr><td> Benzonase </td><td> 머크 </td><td> 101,695 </td></tr><tr><td> 아데노 바이러스-5 </td><td> ATCC </td><td> VR-5 </td></tr><tr><td> 플라스미드 pBlueScript II KS (+) </td><td> Stratagene </td><td> 212,207 </td></tr><tr><td> cap5F (굵게 표시된 노란색, cap5 특정 시퀀스에서 PAC 제가 사이트) : GACTCTTAATTAACAGGT ATGTCTTTTGTTGATCACCCTCC </td><td> IDTDNA </td><td> 사용자 정의 프라이머 </td></tr><tr><td> cap5R (녹색, 굵게 cap5 특정 시퀀스에서 ASC 제가 사이트) : GTGAGGGCGCGCC TTAAAGGGGTCGGGTAAGGTATC </td><td> IDTDNA </td><td> 사용자 정의 프라이머 </td></tr></tbody></table>

engineering and evolution of synthetic adeno-associated virus (aav) gene therapy vectors via dna family shuffling

Adeno - 관련 바이러스 (AAV) 벡터 인해 유익한 특성 1의 독특한 조합으로 치료 인간의 유전자 전달을위한 가장 강력하고 유망한 차량의 일부를 나타냅니다. 이들은 기본 wildtype 바이러스와 높은 titer, 고순도 및 임상 수준의 재조합 벡터 2의 생산을위한 고도의 방법론의 apathogenicity을 포함합니다. 다른 바이러스여 AAV 시스템의 더욱 특별한 장점은 자연스럽게 모두 쉽게 일반적인 프로토콜 1,2을 사용하여 벡터로 설계하실 수 있습니다 아직 필수 속성에 차이가 serotypes을 발생 풍부한의 가용성이다. 또한, 우리 자신을 포함한 그룹의 숫자가 최근 중 여러 입력 serotypes의 자산, 또는 어떤 분리 하나의 속성을 강화를 결합하여 합성 벡터의 생성을위한 템플릿으로 이러한 자연적인 바이러스를 사용하는 전략을 고안했습니다. 각각의 기술은 이러한 목표에게 AR를 달성하기전자 하나의 DNA 가족 걸어갔다 3 부분 homologies (일반적으로 대부분의 AAV의 serotypes을위한&gt; 80 %), 또는 4,5 펩타이드 디스플레이, 보통 일곱 아미노산, 즉 삽입로를 기반으로 자신을 다시 조립 뒤에는 다양한 AAV capsid 유전자의 예 조각화 원하는 세포 유형에 펩타이드가 이상적으로 mediates을 다시 타겟팅 바이러스 capsid의 노출 루프. 최대 성공을위한 두 가지 방법은 프로토콜 백만 번째를 둘러싸고 뚜렷한 capsid 변종의 라이브러리를 양보하도록 상향 조정됩니다 의하여 높은 처리량 방식으로 적용됩니다. 각 클론 그 후 수많은 부모 바이러스의 고유한 조합 (유전자 걸어갔다 접근 방식)으로 구성하거나 동일한 바이러스 백본 (펩타이드 디스플레이 방식) 내에서 독특한 펩타이드를 포함합니다. 이후 마지막 단계는 대부분 또는 선택 과정에 이상적으로 모든 요구 사항을 충족 개별 capsids에 대해 풍부하게하기 위해서는 대상 세포에 이러한 라이브러리의 선택을 반복합니다. 선호 빗 후기같은 반 AAV 항체와 반응 모든 capsids의 인스턴스 제거에 대한 부정적인 선택과 관심이 특정 세포 종류,,에 성장 등 아이 네스 긍정적인 압력. 이 조합은 선택을 이겨낸 합성 capsids은 아마 모든 자연적으로 발생하는 AAV 고립에서 발견되지 않았 방식으로 주어진 어플 리케이션의 요구와 일치하는 확률이 높아집니다. 여기서는 이론적으로 두 개의 기술을 실험적으로 많은 도전과 같은 DNA의 가족 걸어갔다 방법에 초점을 맞춥니다. 우리는 설명하고 보여주 단행 AAV 라이브러리 생성 및 선택 (그림 1)에 대한 모든 필수 단계를, 다음 하나는 이에 분자 AAV의 진화와 함께 성공하기 위해 알아야 할 것이 프로토콜의 함정과 중요한 측면을 논의합니다.

Watch this Scientific Journal Video about Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling at JoVE.com

Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling

우리는 molecularly 유전자 가족 걸어갔다 통해 합성 Adeno-관련 바이러스 (AAV) 유전자 치료 벡터를 엔지니어이며 진화하는 기본적인 기법을 보여줍니다. 더욱이, 우리는 선택과 문화 혹은 생쥐의 표적 세포에 대한 향상된 특성을 가진 각각의 키메라 capsids의 분석을위한 일반 지침 및 대표 예제를 제공합니다.

유전자 가족 걸어갔다 통해 공학 및 합성 Adeno-관련 바이러스의 진화 (AAV) 유전자 치료 벡터

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique ...

Research

JoVE Journal

Immunology and Infection

Engineering and Evolution of Synthetic Adeno-Associated Virus (AAV) Gene Therapy Vectors via DNA Family Shuffling

Generation of Recombinant Influenza Virus from Plasmid DNA

플라스미드 DNA의 재조합 독감 바이러스의 생성

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

연구

면역학 및 감염병학

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

Multivirus 특정 T 세포 생성 Allogeneic 조혈 줄기 세포 이식 후 바이러스 감염을 예방 / 치료

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

히드록 시아파 타이트 크로마 토그래피를 사용하여 환경 바이러스성 커뮤니티에서 단일 좌초 DNA, 더블 좌초된 DNA와 RNA의 분리

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Production and Titering of Recombinant Adeno-associated Viral Vectors

재조합 Adeno - 관련 바이러스성 벡터의 생산 및 Titering

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Expanding Cytotoxic T Lymphocytes from Umbilical Cord Blood that Target Cytomegalovirus, Epstein-Barr Virus, and Adenovirus

탯줄 혈액에서 세포 독성 T 림프구 확장이 대상 사이토 메갈로 바이러스, 엡스타인 - 바 바이러스, 그리고 아데노 바이러스

Virus infections after stem cell transplantation are among the most common causes of death, especially after cord blood (CB) transplantation (CBT) where ...

A Tetracycline-regulated Cell Line Produces High-titer Lentiviral Vectors that Specifically Target Dendritic Cells

항생 물질 규제 세포주 특히 수지상 세포를 대상으로 높은 titer의 렌티 바이러스 벡터를 생성

Lentiviral  vectors (LVs) are a powerful means of delivering genetic material to many types  of cells. Because of safety concerns associated with these ...

Cell-based Flow Cytometry Assay to Measure Cytotoxic Activity

Cytolytic activity of CD8+ T cells is rarely evaluated. We describe here a new cell-based assay to measure the capacity of antigen-specific CD8+ T cells ...

Propagation of Homalodisca coagulata virus-01 via Homalodisca vitripennis Cell Culture

Propagation of Homalodisca coagulata virus-01 via Homalodisca vitripennis Cell Culture

의 전파<em&gt; Homalodisca의 coagulata 바이러스-01</em&gt;를 통해<em&gt; Homalodisca vitripennis</em&gt; 세포 배양

The glassy-winged sharpshooter (Homalodisca vitripennis) is a highly vagile and polyphagous insect found throughout the southwestern United States. These ...

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors

간단하고 효율적인 접근 방법은 돌연변이 백시 니아 바이러스 벡터를 구축하기

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

유전자 또는 약물 치료에 사용하기 위해 HIV-1 생산을 표적 RNA를의 효능 및 독성 평가

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...