Name: polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies
Uploaded: 2012-05-22T12:00:00
Duration: 9 min
Description: Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Met dank aan Kris Reddi aan de UCLA voor het opzetten van reagentia en gieten gels en Erin Sanders aan de UCLA voor inspiratie, begeleiding en ondersteuning en corrigeren van het manuscript. Ik wil ook dank Giancarlo Costaguta en Gregory S. Payne voor het leveren van de gist genomische DNA en primers aan de GAL3 gen te amplificeren. Ik wil ook Bhairav ​​Shah bedanken voor het nemen van foto&#39;s van de laboratoriumapparatuur en reagentia die worden gebruikt om figuren 2 te maken - 4. De financiering voor dit project werd verzorgd door HHMI (HHMI Grant nr. 52006944).

<ol>
	<li>Albert, J., Fenyo, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+sensitive,+and+specific+detection+of+human+immunodeficiency+virus+type+1+in+clinical+specimens+by+polymerase+chain+reaction+with+nested+primers.">Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.</a> J. Clin. Microbiol. 28, 1560-1564 (1990).</li><li>Baskaran, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uniform+amplification+of+a+mixture+of+deoxyribonucleic+acids+with+varying+GC+content.">Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content.</a> Genome Res. 6, 633-638 (1996).</li><li>Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+buffer+optimization+with+uniform+temperature+regimen+to+facilitate+automation.">PCR buffer optimization with uniform temperature regimen to facilitate automation.</a> PCR Methods Appl. 2, 234-240 (1993).</li><li>Borer, P. N., Dengler, B., Tinoco, I., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stability+of+ribonucleic+acid+double-stranded+helices.">Stability of ribonucleic acid double-stranded helices.</a> J. Mol. Biol. 86, 843-853 (1974).</li><li>Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+DNA+duplex+stability+from+the+base+sequence.">Predicting DNA duplex stability from the base sequence.</a> Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).</li><li>Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+pre-PCR+mis-priming+and+primer+dimerization+improves+low-copy-number+amplifications.">Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.</a> Nucleic Acids Res. 20, 1717-1723 (1992).</li><li>Coleman, W. B., Tsongalis, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Diagnostics for the clinical laboration. , (2005).</li><li>D'Aquila, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+sensitivity+and+specificity+of+PCR+by+pre-amplification+heating.">Maximizing sensitivity and specificity of PCR by pre-amplification heating.</a> Nucleic Acids Res. 19, 3749 (1991).</li><li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods Appl. 3, S30-S37 (1993).</li><li>Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term='Touchdown'+PCR+to+circumvent+spurious+priming+during+gene+amplification.">'Touchdown' PCR to circumvent spurious priming during gene amplification.</a> Nucleic Acids Res. 19, 4008 (1991).</li><li>Erlich, H. A., Gelfand, D., Sninsky, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+the+polymerase+chain+reaction.">Recent advances in the polymerase chain reaction.</a> Science. 252, 1643-1651 (1991).</li><li>Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-amplification+of+GC-rich+regions:+'slowdown+PCR.">PCR-amplification of GC-rich regions: 'slowdown PCR.</a> Nat. Protoc. 3, 1312-1317 (2008).</li><li>Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+amplification+with+PCR+of+a+refractory+segment+of+genomic+DNA.">Specific amplification with PCR of a refractory segment of genomic DNA.</a> Nucleic Acids Res. 16, 11844 (1988).</li><li>Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+improves+the+PCR+amplification+of+GC-rich+DNA+sequences.">Betaine improves the PCR amplification of GC-rich DNA sequences.</a> Nucleic Acids Res. 25, 3957-3958 (1997).</li><li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PCR Protocols: A guide to methods and applications. , (1990).</li><li>King, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Molecular Biology. 630, (2010).</li><li>Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+polynucleotides.+XCVI.+Repair+replications+of+short+synthetic+DNA's+as+catalyzed+by+DNA+polymerases.">Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases.</a> J. Mol. Biol. 56, 341-361 (1971).</li><li>Korbie, D. J., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Touchdown+PCR+for+increased+specificity+and+sensitivity+in+PCR+amplification.">Touchdown PCR for increased specificity and sensitivity in PCR amplification.</a> Nat. Protoc. 3, 1452-1456 (2008).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+DNA+by+PCR:+standard+procedures+and+optimization.">Enzymatic amplification of DNA by PCR: standard procedures and optimization.</a> Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction.">The polymerase chain reaction.</a> Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).</li><li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein.">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li><li>Kwok, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+human+immunodeficiency+virus+sequences+by+using+in+vitro+enzymatic+amplification+and+oligomer+cleavage+detection.">Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.</a> J. Virol. 61, 1690-1694 (1987).</li><li>McConlogue, L., Brow, M. A., Innis, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-independent+DNA+amplification+by+PCR+using+7-deaza-2'-deoxyguanosine.">Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine.</a> Nucleic Acids Res. 16, 9869 (1988).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+unusual+origin+of+the+polymerase+chain+reaction.">The unusual origin of the polymerase chain reaction.</a> Sci. Am. 262, 56-65 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Target+amplification+for+DNA+analysis+by+the+polymerase+chain+reaction.">Target amplification for DNA analysis by the polymerase chain reaction.</a> Ann. Biol. Clin. (Paris). 48, 579-582 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction+in+an+anemic+mode:+how+to+avoid+cold+oligodeoxyribonuclear+fusion).">The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion).</a> PCR Methods Appl. 1, 1-4 (1991).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Paabo, S., Gifford, J. A., Wilson, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+sequences+from+a+7000-year+old+brain.">Mitochondrial DNA sequences from a 7000-year old brain.</a> Nucleic Acids Res. 16, 9775-9787 (1988).</li><li>Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+can+eliminate+the+base+pair+composition+dependence+of+DNA+melting.">Betaine can eliminate the base pair composition dependence of DNA melting.</a> Biochemistry. 32, 137-144 (1993).</li><li>Roux, K. H., Hecker, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+optimization+using+touchdown+and+stepdown+PCR.">One-step optimization using touchdown and stepdown PCR.</a> Methods Mol. Biol. 67, 39-45 (1997).</li><li>Rychlik, W., Spencer, W. J., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239, 487-491 (1988).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+beta-globin+genomic+sequences+and+restriction+site+analysis+for+diagnosis+of+sickle+cell+anemia.">Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.</a> Science. 230, 1350-1354 (1985).</li><li>Sambrook, J. A. R., David, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning A Laboratory Manual. 2, (2001).</li><li>Sarkar, G., Kapelner, S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formamide+can+dramatically+improve+the+specificity+of+PCR.">Formamide can dramatically improve the specificity of PCR.</a> Nucleic Acids Res. 18, 7465 (1990).</li><li>Smit, V. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAS+codon+12+mutations+occur+very+frequently+in+pancreatic+adenocarcinomas.">KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas.</a> Nucleic Acids Res. 16, 7773-7782 (1988).</li><li>Wilson, I. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+and+facilitation+of+nucleic+acid+amplification.">Inhibition and facilitation of nucleic acid amplification.</a> Appl. Environ. Microbiol. 63, 3741-3751 (1997).</li><li>Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Enzymology. 218, (1993).</li></ol>

Ik heb niets te onthullen.

PCR is uitgegroeid tot een onmisbaar instrument in de biologische wetenschap arsenaal. PCR is veranderd tijdens wetenschap waardoor biologen stroom leveren dan genomen en hybride genen maken met nieuwe functies, die specifieke en nauwkeurig klinische testen inzicht te krijgen in het genoom en diversiteit en eenvoudig klonen genen voor verdere biochemische analyse. PCR-applicatie wordt alleen beperkt door de fantasie van de wetenschapper die de macht uitoefent. Er zijn vele boeken en papieren die nieuwe gespecialiseerde toepassingen van PCR te beschrijven, en nog veel meer zullen worden ontwikkeld in de komende generatie van de biologische wetenschap. Ongeacht de verwachte benaderingen is het basiskader gebleven. PCR, in de grootheid, een in vitro toepassing van grote hoeveelheden specifieke DNA-segment genereren. Het ontwerpen van een PCR-experiment vereist denken en geduld. De resultaten weergegeven in figuur 3 illustreren een van de belangrijkste lallenges bij het ontwerpen van een optimalisatie strategie voor de PCR. Dat wil zeggen, als een parameter van PCR wordt veranderd, kan beïnvloeden andere. Als bijvoorbeeld de eerste PCR werd uitgevoerd bij de suboptimale hybridisatietemperatuur (58 ° C) met een optimale Mg2 +-concentratie van 2,0 mM, dan zal het resultaat zou een uitstrijk zoals in figuur 3c. Een poging om het uitstrijkje te lossen zou kunnen zijn het opzetten van PCR-condities met reacties met 2,0 mM MgCl2 en het aanpassen van de annealing temperatuur tot 61 ° C. Echter, zoals in figuur 3a, is dit niet leveren een product. Bijgevolg is het raadzaam om reagentia titratie, dan het toevoegen van een concentratie aan een reactie bij het oplossen valse resultaten. Ook de meest aanpassingen nodig zijn voor het optimaliseren van een PCR experiment zijn de Mg2 +-concentratie te veranderen en het gloeien temperaturen corrigeren. Echter, als deze veranderingen niet minimaliseren of intrekking van afwijkende resultaten, titratie van additiVES en / of het veranderen van de fietsen staat protocollen, zoals beschreven in de tabellen 2-6 mei verlichten het probleem. Als al het andere faalt, herontwerp van de primers en probeer het, probeer het opnieuw.

<table border="1"><tbody><tr><td> Naam van het serum </td><td> Vennootschap </td><td> Catalogusnummer </td><td> Reacties </td></tr><tr><td> Taq Polymeras </td><td> Sigma </td><td> D4545-25UN </td><td></td></tr><tr><td> dNTPs </td><td> Qiagen </td><td> 201225 </td><td></td></tr><tr><td> 0,2 ml Thin Wall Tubes PCR-buisjes </td><td> Bio Rad </td><td> 223-9469 </td><td></td></tr><tr><td> 0,2 ml Thin Wall Tube caps </td><td> Bio Rad </td><td> 223-9472 </td><td></td></tr><tr><td> TE buffer: </td><td></td><td></td><td></td></tr><tr><td> EDTA dinatriumzoutdihydraat </td><td> Sigma </td><td> E5134 </td><td></td></tr><tr><td> Trizma-HCl </td><td> Sigma </td><td> T-3253 </td><td></td></tr><tr><td> Aangepast Faag Primer </td><td> Invitrogen </td><td colspan="2"> 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG </td></tr><tr><td> Aangepast Faag Primer </td><td> Invitrogen </td><td colspan="2"> 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT </td></tr><tr><td> Aangepast Gist Primer </td><td> Integrated DNA Technologies </td><td colspan="2"> Sacl-Gal3 (-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG </td></tr><tr><td> Aangepast Gist Primer </td><td> Integrated DNA Technologies </td><td colspan="2"> Gal3 (1848)-Sacl CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG </td></tr><tr><td> Thermal Cycler </td><td> Bio Rad </td><td> 170-9703 </td><td> Mijn Renner </td></tr><tr><td> Agarose </td><td> ISC BioExpress </td><td> E-3120-500 </td><td></td></tr><tr><td> Gelelektroforese </td><td> Hoeffer Scientific Instruments </td><td> Model HE33 </td><td></td></tr><tr><td> 1 kb DNA ladder </td><td> New England BioLabs </td><td> N3232S </td><td></td></tr><tr><td> Bio Rad Power Pack </td><td> Bio Rad </td><td> 164-5050 </td><td> POWERPAC Basic </td></tr><tr><td> Gel Doc-systeem </td><td> Fotodyne Incorporated </td><td colspan="2"> FOTO / Analist Investigator FX Workstation </td></tr></tbody></table>

polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies

In de biologische wetenschappen zijn er technologische ontwikkelingen die de discipline katapulteren in de gouden tijden van ontdekking. Zo werd bijvoorbeeld op het gebied van microbiologie getransformeerd met de komst van de microscoop Anton van Leeuwenhoek&#39;s, waardoor wetenschappers prokaryoten visualiseren voor de eerste keer. De ontwikkeling van de polymerase chain reaction (PCR) is een van die innovaties die de loop van de moleculaire wetenschap met de impact ervan verspreid over talloze subdisciplines in de biologie veranderd. De theoretische proces werd geschetst door Keppe en collega&#39;s in 1971, maar het was nog eens 14 jaar tot de volledige PCR-procedure werd beschreven en experimenteel toegepast door Kary Mullis terwijl Cetus Corporation in 1985. Automatisering en verfijning van deze techniek voortgang geboekt bij de invoering van een thermisch stabiele DNA polymerase van Thermus aquaticus bacterie derhalve de naam Taq DNA polymerase. PCR is een powerful versterking techniek die een ruim aanbod van een specifiek segment van DNA (dat wil zeggen, een amplicon) van slechts een kleine hoeveelheid van het uitgangsmateriaal (dat wil zeggen, DNA-sjabloon of doelsequentie) kunnen genereren. Terwijl eenvoudig en over het algemeen zonder problemen, er zijn valkuilen die de reactie het produceren van valse resultaten bemoeilijken. Wanneer PCR mislukt, kan dit leiden tot veel niet-specifieke DNA-producten van verschillende grootte die worden weergegeven als een ladder of een uitstrijkje van bands op agarose gels. Soms is er geen producten vormen het geheel. Een ander probleem treedt op als mutaties onbedoeld geïntroduceerd in de amplicons, resulterend in een heterogene populatie van PCR-producten. PCR fouten kunnen worden frustrerend, tenzij geduld en voorzichtig het oplossen van problemen worden gebruikt om uit te zoeken en het probleem (s) op te lossen. Dit protocol beschrijft de grondbeginselen van de PCR, is een methode die zal resulteren in een versterking van de meeste doelsequenties, en presenteert strategieën voor het optimaliseren van een reactie. Door het volgen van deze PCR-gids, students moet in staat zijn om: <ul><li> Stel reacties en thermische cycli voorwaarden voor een conventionele PCR-experiment </li><li> Begrijpen de functie van verschillende reactiecomponenten en de totale effect op PCR experiment </li><li> Ontwerp en optimaliseren PCR experiment voor DNA-template </li><li> Problemen met niet PCR experimenten </li></ul>

Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

PCR heeft zich ontpopt als een veelgebruikte techniek in veel moleculair-biologische laboratoria. Mits hier is een kort overzicht van enkele conventionele PCR-protocollen. Omdat elk reactie is een uniek experiment optimale voorwaarden te genereren product variëren. Begrijpen van de variabelen in een reactie, zal ook problemen efficiency, waardoor de kans op het gewenste resultaat.

Polymerase Chain Reaction: Basis Protocol Plus Problemen oplossen en Optimalisatie Strategieën

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of ...

Research

JoVE Journal

Biology

Optimization of the Ugi Reaction Using Parallel Synthesis and Automated Liquid Handling

Optimalisatie van de Ugi reactie met behulp van parallelle synthese en geautomatiseerde Liquid Handling

The optimization of a Ugi reaction involving the mixing of furfurylamine, benzaldehyde, boc-glycine and t-butylisocyanide is described.  Triplicate runs ...

Elevated Plus Maze for Mice

Verhoogd Plus Maze voor muizen

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given ...

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

Niet-invasieve In Vivo Small Animal MRI en MRS: Basic experimentele procedures

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the ...

Multiplexed Fluorometric ImmunoAssay Testing Methodology and Troubleshooting

Multiplexed fluorometrische Immunoassay Methodiek en problemen oplossen

To ensure the quality of animal models used in biomedical research we have developed a number of diagnostic testing strategies and methods to determine if ...

Basic Caenorhabditis elegans Methods: Synchronization and Observation

Basic Caenorhabditis elegans Methods: Synchronization and Observation

Basis-<em&gt; Caenorhabditis elegans</em&gt; Methoden: Synchronisatie-en-

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has ...

A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies

A Guide to Modern Kwantitatieve TL Western Blotting met Troubleshooting Strategies

The late 1970s saw the first publicly reported use of the western blot, a technique for assessing the presence and relative abundance of specific proteins ...

Subcloning Plus Insertion (SPI) - A Novel Recombineering Method for the Rapid Construction of Gene Targeting Vectors

Subcloning Plus Insertion SPI - A Novel Recombineering Method for the Rapid Construction of Gene Targeting Vectors

Subkloning Plus Insertion (SPI) - A Novel recombineering Methode voor de snelle bouw van gene targeting vectoren

Gene targeting refers to the precise modification of a genetic locus using homologous recombination. The generation of novel cell lines and transgenic ...

A Rapid Automated Protocol for Muscle Fiber Population Analysis in Rat Muscle Cross Sections Using Myosin Heavy Chain Immunohistochemistry

Een Rapid Automated Protocol voor Muscle Fiber Population Analysis in Rat Muscle Dwarsdoorsneden Met behulp van zware keten van myosine Immunohistochemie

Quantification of muscle fiber populations provides a deeper insight into the effects of disease, trauma, and various other influences on skeletal muscle ...

Procedure and Key Optimization Strategies for an Automated Capillary Electrophoretic-based Immunoassay Method

Procedure en belangrijkste optimalisatie strategieën voor een geautomatiseerde capillaire elektroforetische gebaseerde Immunoassay-methode

New technologies that utilize capillary-based immunoassays promise faster and more quantitative protein assessment compared to traditional immunoassays. ...

Optimization of Crystal Growth for Neutron Macromolecular Crystallography

Optimalisatie van kristalgroei voor neutronenmacromoleculaire kristallografie

The use of neutron macromolecular crystallography (NMX) is expanding rapidly with most structures determined in the last decade thanks to new NMX ...