Name: polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies
Uploaded: 2012-05-22T12:00:00
Duration: 9 min
Description: Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

תודה מיוחדת קריס Reddi ב-UCLA להגדרת ריאגנטים לשפוך ג&#39;ל וכדי ארין סנדרס באוניברסיטת קליפורניה השראה, הדרכה, תמיכה והגהה את כתב היד. אני רוצה גם תודה ג&#39;אנקרלו Costaguta וגרגורי ס פיין לאספקת הגנומי שמרים דנ&quot;א primers כדי להגביר את הגן GAL3. אני רוצה גם להודות שאה Bhairav ​​לצילום תמונות של ציוד מעבדה חומרים כימיים המשמשים לייצור דמויות 2 - 4. המימון לפרויקט זה סופק על ידי HHMI (HHMI גרנט מס &#39;52006944).

<ol>
	<li>Albert, J., Fenyo, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+sensitive,+and+specific+detection+of+human+immunodeficiency+virus+type+1+in+clinical+specimens+by+polymerase+chain+reaction+with+nested+primers.">Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.</a> J. Clin. Microbiol. 28, 1560-1564 (1990).</li><li>Baskaran, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uniform+amplification+of+a+mixture+of+deoxyribonucleic+acids+with+varying+GC+content.">Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content.</a> Genome Res. 6, 633-638 (1996).</li><li>Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+buffer+optimization+with+uniform+temperature+regimen+to+facilitate+automation.">PCR buffer optimization with uniform temperature regimen to facilitate automation.</a> PCR Methods Appl. 2, 234-240 (1993).</li><li>Borer, P. N., Dengler, B., Tinoco, I., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stability+of+ribonucleic+acid+double-stranded+helices.">Stability of ribonucleic acid double-stranded helices.</a> J. Mol. Biol. 86, 843-853 (1974).</li><li>Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+DNA+duplex+stability+from+the+base+sequence.">Predicting DNA duplex stability from the base sequence.</a> Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).</li><li>Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+pre-PCR+mis-priming+and+primer+dimerization+improves+low-copy-number+amplifications.">Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.</a> Nucleic Acids Res. 20, 1717-1723 (1992).</li><li>Coleman, W. B., Tsongalis, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Diagnostics for the clinical laboration. , (2005).</li><li>D'Aquila, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+sensitivity+and+specificity+of+PCR+by+pre-amplification+heating.">Maximizing sensitivity and specificity of PCR by pre-amplification heating.</a> Nucleic Acids Res. 19, 3749 (1991).</li><li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods Appl. 3, S30-S37 (1993).</li><li>Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term='Touchdown'+PCR+to+circumvent+spurious+priming+during+gene+amplification.">'Touchdown' PCR to circumvent spurious priming during gene amplification.</a> Nucleic Acids Res. 19, 4008 (1991).</li><li>Erlich, H. A., Gelfand, D., Sninsky, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+the+polymerase+chain+reaction.">Recent advances in the polymerase chain reaction.</a> Science. 252, 1643-1651 (1991).</li><li>Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-amplification+of+GC-rich+regions:+'slowdown+PCR.">PCR-amplification of GC-rich regions: 'slowdown PCR.</a> Nat. Protoc. 3, 1312-1317 (2008).</li><li>Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+amplification+with+PCR+of+a+refractory+segment+of+genomic+DNA.">Specific amplification with PCR of a refractory segment of genomic DNA.</a> Nucleic Acids Res. 16, 11844 (1988).</li><li>Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+improves+the+PCR+amplification+of+GC-rich+DNA+sequences.">Betaine improves the PCR amplification of GC-rich DNA sequences.</a> Nucleic Acids Res. 25, 3957-3958 (1997).</li><li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PCR Protocols: A guide to methods and applications. , (1990).</li><li>King, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Molecular Biology. 630, (2010).</li><li>Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+polynucleotides.+XCVI.+Repair+replications+of+short+synthetic+DNA's+as+catalyzed+by+DNA+polymerases.">Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases.</a> J. Mol. Biol. 56, 341-361 (1971).</li><li>Korbie, D. J., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Touchdown+PCR+for+increased+specificity+and+sensitivity+in+PCR+amplification.">Touchdown PCR for increased specificity and sensitivity in PCR amplification.</a> Nat. Protoc. 3, 1452-1456 (2008).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+DNA+by+PCR:+standard+procedures+and+optimization.">Enzymatic amplification of DNA by PCR: standard procedures and optimization.</a> Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction.">The polymerase chain reaction.</a> Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).</li><li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein.">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li><li>Kwok, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+human+immunodeficiency+virus+sequences+by+using+in+vitro+enzymatic+amplification+and+oligomer+cleavage+detection.">Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.</a> J. Virol. 61, 1690-1694 (1987).</li><li>McConlogue, L., Brow, M. A., Innis, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-independent+DNA+amplification+by+PCR+using+7-deaza-2'-deoxyguanosine.">Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine.</a> Nucleic Acids Res. 16, 9869 (1988).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+unusual+origin+of+the+polymerase+chain+reaction.">The unusual origin of the polymerase chain reaction.</a> Sci. Am. 262, 56-65 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Target+amplification+for+DNA+analysis+by+the+polymerase+chain+reaction.">Target amplification for DNA analysis by the polymerase chain reaction.</a> Ann. Biol. Clin. (Paris). 48, 579-582 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction+in+an+anemic+mode:+how+to+avoid+cold+oligodeoxyribonuclear+fusion).">The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion).</a> PCR Methods Appl. 1, 1-4 (1991).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Paabo, S., Gifford, J. A., Wilson, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+sequences+from+a+7000-year+old+brain.">Mitochondrial DNA sequences from a 7000-year old brain.</a> Nucleic Acids Res. 16, 9775-9787 (1988).</li><li>Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+can+eliminate+the+base+pair+composition+dependence+of+DNA+melting.">Betaine can eliminate the base pair composition dependence of DNA melting.</a> Biochemistry. 32, 137-144 (1993).</li><li>Roux, K. H., Hecker, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+optimization+using+touchdown+and+stepdown+PCR.">One-step optimization using touchdown and stepdown PCR.</a> Methods Mol. Biol. 67, 39-45 (1997).</li><li>Rychlik, W., Spencer, W. J., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239, 487-491 (1988).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+beta-globin+genomic+sequences+and+restriction+site+analysis+for+diagnosis+of+sickle+cell+anemia.">Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.</a> Science. 230, 1350-1354 (1985).</li><li>Sambrook, J. A. R., David, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning A Laboratory Manual. 2, (2001).</li><li>Sarkar, G., Kapelner, S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formamide+can+dramatically+improve+the+specificity+of+PCR.">Formamide can dramatically improve the specificity of PCR.</a> Nucleic Acids Res. 18, 7465 (1990).</li><li>Smit, V. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAS+codon+12+mutations+occur+very+frequently+in+pancreatic+adenocarcinomas.">KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas.</a> Nucleic Acids Res. 16, 7773-7782 (1988).</li><li>Wilson, I. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+and+facilitation+of+nucleic+acid+amplification.">Inhibition and facilitation of nucleic acid amplification.</a> Appl. Environ. Microbiol. 63, 3741-3751 (1997).</li><li>Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Enzymology. 218, (1993).</li></ol>

אין לי מה לחשוף.

PCR הפך לכלי הכרחית בארסנל מדע הביולוגיה. PCR שינתה את מהלך המדע המאפשר ביולוגים להניב כוח על הגנום, ולהפוך גנים היברידית עם פונקציות חדשות, המאפשר ניסויים קליניים ספציפי ומדויק, צובר תובנות לתוך הגנום לבין גיוון, כמו גם שיבוט גנים פשוט לניתוח ביוכימי נוסף. יישום ה-PCR מוגבל רק על ידי הדמיון של המדען אשר מפעיל את כוחו. יש הרבה ספרים וניירות מיוחדים המתארים את השימושים החדשים של ה-PCR, ועוד רבים יפותח על הדור הבא של מדע הביולוגיה. עם זאת, ללא קשר הגישות הצפויות, את המסגרת הבסיסית נשארה זהה. PCR, בתוך כל הפאר שלה, הוא יישום במבחנה כדי לייצר כמויות גדולות של קטע מסוים של דנ&quot;א. תכנון הניסוי PCR דורש מחשבה וסבלנות. התוצאות המוצגות באיור 3 מדגימים אחד פרק מרכזיallenges בעת תכנון אסטרטגיית אופטימיזציה של ה-PCR. כלומר, כאשר פרמטר אחד של PCR משתנה, זה יכול להשפיע אחרת. לדוגמה, אם ה-PCR הראשוני בוצע בטמפרטורה תת אופטימלית חישול (58 ° C) עם Mg 2 + ריכוז אופטימלי של mM 2.0, אז התוצאה היתה לייצר כתם כפי שניתן לראות באיור 3 ג. ניסיון לפתור את משטח עשוי לכלול הגדרת תנאי ה-PCR עם תגובות המכילות 2.0 mM MgCl 2 והתאמת הטמפרטורה חישול 61 ° C. עם זאת, כפי שניתן לראות באיור 3 א, זו לא תניב כל מוצר. כתוצאה מכך, רצוי לכיל ריאגנטים, במקום להוסיף 1 ריכוז לתגובה אחת, כאשר פתרון בעיות תוצאות מזויפות. כמו כן, את ההתאמות הנפוצות ביותר הדרושות לייעול ניסוי ה-PCR הם לשנות את ריכוז 2 מ&quot;ג + ולתקן הטמפרטורות חישול. עם זאת, אם שינויים אלה אינם לצמצם או לבטל תוצאות חריגים, טיטרציה של additiVes ו / או לשנות את מצבו אופניים פרוטוקולים כמתואר טבלאות 2-6 עשוי להקל על הבעיה. אם כל השאר נכשל, לעצב מחדש את primers ונסה, ונסה שוב.

<table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> שם מגיב </td><td> חברה </td><td> מספר קטלוגי </td><td> תגובות </td></tr><tr><td> Taq Polymeras </td><td> סיגמא </td><td> D4545-25UN </td><td></td></tr><tr><td> dNTPs </td><td> Qiagen </td><td> 201225 </td><td></td></tr><tr><td> 0.2 מ&quot;ל דק וול צינורות צינורות PCR </td><td> ביו רד </td><td> 223-9469 </td><td></td></tr><tr><td> 0.2 מ&quot;ל דקים קיר כמוסות תחתית </td><td> ביו רד </td><td> 223-9472 </td><td></td></tr><tr><td> TE חוצץ: </td><td></td><td></td><td></td></tr><tr><td> EDTA הרכב: dihydrate מלח </td><td> סיגמא </td><td> E5134 </td><td></td></tr><tr><td> Trizma-HCl </td><td> סיגמא </td><td> T-3253 </td><td></td></tr><tr><td> הפאג מותאם אישית פריימר </td><td> Invitrogen </td><td colspan="2"> 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG </td></tr><tr><td> הפאג מותאם אישית פריימר </td><td> Invitrogen </td><td colspan="2"> 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT </td></tr><tr><td> שמרים מותאם אישית פריימר </td><td> Integrated DNA Technologies </td><td colspan="2"> SacI-Gal3 (-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG </td></tr><tr><td> שמרים מותאם אישית פריימר </td><td> Integrated DNA Technologies </td><td colspan="2"> Gal3 (1848), SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG </td></tr><tr><td> תרמית Cycler </td><td> ביו רד </td><td> 170-9703 </td><td> שלי Cycler </td></tr><tr><td> Agarose </td><td> ISC BioExpress </td><td> E-3120-500 </td><td></td></tr><tr><td> ג&#39;ל אלקטרופורזה </td><td> Hoeffer מכשירים מדעיים </td><td> דגם HE33 </td><td></td></tr><tr><td> 1 קילו סולם DNA </td><td> ניו אינגלנד Biolabs </td><td> N3232S </td><td></td></tr><tr><td> ביו רד Power Pack </td><td> ביו רד </td><td> 164-5050 </td><td> PowerPac בסיסי </td></tr><tr><td> ג&#39;ל דוק מערכת </td><td> Fotodyne Incorporated </td><td colspan="2"> Foto / אנליסט חוקר תחנת עבודה FX </td></tr></tbody></table>

polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies

במדעים הביולוגיים היו ההתקדמות הטכנולוגית, כי מעוט משמעת לתוך גיל הזהב של גילוי. לדוגמה, בתחום המיקרוביולוגיה הפך עם כניסתו של המיקרוסקופ אנטון ואן לוונהוק, שאיפשרה למדענים לחזות פרוקריוטים בפעם הראשונה. התפתחות התגובה פולימראז שרשרת (PCR) הוא אחד מאותם חידושים ששינו את מהלך המדע מולקולרית עם השפעתה פורש subdisciplines אינספור בביולוגיה. תהליך תיאורטי קווי המתאר של Keppe ועמיתים לעבודה בשנת 1971, עם זאת, זה היה עוד 14 שנים עד הליך שלם PCR תואר ויישם באופן ניסיוני על ידי Kary מוליס תוך Cetus החברה בשנת 1985. אוטומציה ושכלול של טכניקה זו התקדם עם הקדמה של פולימראז ה-DNA תרמית יציבה מ aquaticus החיידק Thermus, וכתוצאה מכך פולימראז שם Taq DNA. PCR הוא poweהגברה rful טכניקה שיכולה ליצור היצע נרחב של קטע מסוים של דנ&quot;א (כלומר, amplicon) מתוך כמות קטנה בלבד של חומר המוצא (כלומר, תבנית ה-DNA או רצף המטרה). אמנם פשוט, ובדרך כלל ללא בעיות, יש מלכודות שיסבכו את התגובה לייצר תוצאות מזויפות. כאשר ה-PCR נכשל זה יכול להוביל שאינם ספציפיים מוצרים רבים דנ&quot;א בגדלים שונים המופיעים כסולם או כתם של להקות על ג&#39;ל agarose. לפעמים מוצרי שום צורה כלל. בעיה נוספת מתרחשת כאשר הפוטנציאל מוטציות פוגש בטעות ב amplicons, וכתוצאה מכך לאוכלוסייה הטרוגנית של מוצרי ה-PCR. כשלים PCR יכול להיות מתסכל, אלא אם כן סבלנות פתרון בעיות זהיר מועסקים לברר ולפתור את הבעיה (S). פרוטוקול זה מתאר את העקרונות הבסיסיים של ה-PCR, מספק מתודולוגיה יביא הגברה של רצפי היעד ביותר, מציג אסטרטגיות למיטוב התגובה. על ידי ביצוע מדריך זה PCR, רח&#39;udents צריכים להיות מסוגלים: <ul style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הגדר את התגובות ותנאי רכיבה תרמית לניסוי ה-PCR קונבנציונאלי </li><li style=";text-align:right;direction:rtl"> להבין את תפקידם של מרכיבי התגובה שונים ואת השפעתם הכוללת על ניסוי ה-PCR </li><li style=";text-align:right;direction:rtl"> עיצוב לייעל הניסוי PCR עבור כל תבנית ה-DNA </li><li style=";text-align:right;direction:rtl"> פתרון ה-PCR ניסויים כושלים </li></ul>

Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

PCR התפתחה טכניקה נפוצה הרבה מעבדות ביולוגיה מולקולרית. בתנאי הנה מדריך מהיר קונבנציונאלי פרוטוקולים מספר ה-PCR. כי כל תגובה היא ניסוי ייחודי, תנאים אופטימליים הנדרשים כדי לייצר מוצר להשתנות. הבנת המשתנים התגובה יהיה מאוד לשפר את יעילות לפתרון בעיות, ובכך להגדיל את הסיכוי להשיג את התוצאה הרצויה.

תגובת שרשרת פולימרז: פרוטוקול בסיסי פלוס אסטרטגיות לפתרון בעיות ואופטימיזציה

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of ...

Research

JoVE Journal

Biology

Optimization of the Ugi Reaction Using Parallel Synthesis and Automated Liquid Handling

אופטימיזציה של התגובה אוגי באמצעות סינתזה במקביל וטיפול נוזלי אוטומטי

The optimization of a Ugi reaction involving the mixing of furfurylamine, benzaldehyde, boc-glycine and t-butylisocyanide is described.  Triplicate runs ...

Elevated Plus Maze for Mice

מבוך פלוס גבוהות עבור עכברים

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given ...

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

פולשנית In vivo קטנים בעלי חיים MRI ו MRS: הפרוצדורות בסיסי

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the ...

Multiplexed Fluorometric ImmunoAssay Testing Methodology and Troubleshooting

מתודולוגיה multiplexed Fluorometric immunoassay בדיקה ופתרון בעיות

To ensure the quality of animal models used in biomedical research we have developed a number of diagnostic testing strategies and methods to determine if ...

Basic Caenorhabditis elegans Methods: Synchronization and Observation

Basic Caenorhabditis elegans Methods: Synchronization and Observation

בסיסי<em&gt; Caenorhabditis elegans</em&gt; שיטות: סנכרון תצפית

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has ...

A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies

מדריך למודרני כמותי פלורסנט המערבי סופג עם אסטרטגיות לפתרון בעיות

The late 1970s saw the first publicly reported use of the western blot, a technique for assessing the presence and relative abundance of specific proteins ...

Subcloning Plus Insertion (SPI) - A Novel Recombineering Method for the Rapid Construction of Gene Targeting Vectors

Subcloning Plus Insertion SPI - A Novel Recombineering Method for the Rapid Construction of Gene Targeting Vectors

Subcloning Plus ההכנסה (SPI) - Recombineering שיטה חדשה לבנייה המהירה של וקטורי גן המיקוד

Gene targeting refers to the precise modification of a genetic locus using homologous recombination. The generation of novel cell lines and transgenic ...

A Rapid Automated Protocol for Muscle Fiber Population Analysis in Rat Muscle Cross Sections Using Myosin Heavy Chain Immunohistochemistry

פרוטוקול אוטומאטי ומהיר עבור שריר סיבי ניתוח אוכלוסיית חתכי שריר עכברוש באמצעות שרשרת השרירן כבד אימונוהיסטוכימיה

Quantification of muscle fiber populations provides a deeper insight into the effects of disease, trauma, and various other influences on skeletal muscle ...

Procedure and Key Optimization Strategies for an Automated Capillary Electrophoretic-based Immunoassay Method

הליך ואסטרטגיות אופטימיזציה מפתח שיטה אוטומטית נימי מתכלה מבוסס על Electrophoretic

New technologies that utilize capillary-based immunoassays promise faster and more quantitative protein assessment compared to traditional immunoassays. ...

Optimization of Crystal Growth for Neutron Macromolecular Crystallography

אופטימיזציה של צמיחת קריסטל עבור קריסטלוגרפיה מקרומולקולרית נויטרון

The use of neutron macromolecular crystallography (NMX) is expanding rapidly with most structures determined in the last decade thanks to new NMX ...