Name: polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies
Uploaded: 2012-05-22T12:00:00
Duration: 9 min
Description: Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

시약을 설정 및 젤류를 따르고하고 UCLA의 에린 샌더스에 영감,지도 및 지원을하고 원고를 교정을위한 UCLA의 크리스 Reddi에 대한 특별 감사합니다. 나는 또한 GAL3 유전자를 증폭하기 위해 효모 게놈의 DNA와 primers를 공급을위한 감사 Giancarlo Costaguta과 그레고리 S. 페인에게 싶습니다. 4 - 나는 또한 실험실 장비 및 숫자 2를 만들기 위해 사용되는 시약의 사진을내어 Bhairav​​의 샤 감사드립니다. 이 프로젝트에 대한 자금 지원은 HHMI (HHMI 그랜트 번호 52006944)에 의해 제공되었다.

<ol>
	<li>Albert, J., Fenyo, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+sensitive,+and+specific+detection+of+human+immunodeficiency+virus+type+1+in+clinical+specimens+by+polymerase+chain+reaction+with+nested+primers.">Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.</a> J. Clin. Microbiol. 28, 1560-1564 (1990).</li><li>Baskaran, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uniform+amplification+of+a+mixture+of+deoxyribonucleic+acids+with+varying+GC+content.">Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content.</a> Genome Res. 6, 633-638 (1996).</li><li>Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+buffer+optimization+with+uniform+temperature+regimen+to+facilitate+automation.">PCR buffer optimization with uniform temperature regimen to facilitate automation.</a> PCR Methods Appl. 2, 234-240 (1993).</li><li>Borer, P. N., Dengler, B., Tinoco, I., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stability+of+ribonucleic+acid+double-stranded+helices.">Stability of ribonucleic acid double-stranded helices.</a> J. Mol. Biol. 86, 843-853 (1974).</li><li>Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+DNA+duplex+stability+from+the+base+sequence.">Predicting DNA duplex stability from the base sequence.</a> Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).</li><li>Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+pre-PCR+mis-priming+and+primer+dimerization+improves+low-copy-number+amplifications.">Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.</a> Nucleic Acids Res. 20, 1717-1723 (1992).</li><li>Coleman, W. B., Tsongalis, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Diagnostics for the clinical laboration. , (2005).</li><li>D'Aquila, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+sensitivity+and+specificity+of+PCR+by+pre-amplification+heating.">Maximizing sensitivity and specificity of PCR by pre-amplification heating.</a> Nucleic Acids Res. 19, 3749 (1991).</li><li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods Appl. 3, S30-S37 (1993).</li><li>Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term='Touchdown'+PCR+to+circumvent+spurious+priming+during+gene+amplification.">'Touchdown' PCR to circumvent spurious priming during gene amplification.</a> Nucleic Acids Res. 19, 4008 (1991).</li><li>Erlich, H. A., Gelfand, D., Sninsky, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+the+polymerase+chain+reaction.">Recent advances in the polymerase chain reaction.</a> Science. 252, 1643-1651 (1991).</li><li>Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-amplification+of+GC-rich+regions:+'slowdown+PCR.">PCR-amplification of GC-rich regions: 'slowdown PCR.</a> Nat. Protoc. 3, 1312-1317 (2008).</li><li>Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+amplification+with+PCR+of+a+refractory+segment+of+genomic+DNA.">Specific amplification with PCR of a refractory segment of genomic DNA.</a> Nucleic Acids Res. 16, 11844 (1988).</li><li>Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+improves+the+PCR+amplification+of+GC-rich+DNA+sequences.">Betaine improves the PCR amplification of GC-rich DNA sequences.</a> Nucleic Acids Res. 25, 3957-3958 (1997).</li><li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PCR Protocols: A guide to methods and applications. , (1990).</li><li>King, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Molecular Biology. 630, (2010).</li><li>Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+polynucleotides.+XCVI.+Repair+replications+of+short+synthetic+DNA's+as+catalyzed+by+DNA+polymerases.">Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases.</a> J. Mol. Biol. 56, 341-361 (1971).</li><li>Korbie, D. J., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Touchdown+PCR+for+increased+specificity+and+sensitivity+in+PCR+amplification.">Touchdown PCR for increased specificity and sensitivity in PCR amplification.</a> Nat. Protoc. 3, 1452-1456 (2008).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+DNA+by+PCR:+standard+procedures+and+optimization.">Enzymatic amplification of DNA by PCR: standard procedures and optimization.</a> Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction.">The polymerase chain reaction.</a> Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).</li><li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein.">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li><li>Kwok, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+human+immunodeficiency+virus+sequences+by+using+in+vitro+enzymatic+amplification+and+oligomer+cleavage+detection.">Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.</a> J. Virol. 61, 1690-1694 (1987).</li><li>McConlogue, L., Brow, M. A., Innis, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-independent+DNA+amplification+by+PCR+using+7-deaza-2'-deoxyguanosine.">Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine.</a> Nucleic Acids Res. 16, 9869 (1988).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+unusual+origin+of+the+polymerase+chain+reaction.">The unusual origin of the polymerase chain reaction.</a> Sci. Am. 262, 56-65 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Target+amplification+for+DNA+analysis+by+the+polymerase+chain+reaction.">Target amplification for DNA analysis by the polymerase chain reaction.</a> Ann. Biol. Clin. (Paris). 48, 579-582 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction+in+an+anemic+mode:+how+to+avoid+cold+oligodeoxyribonuclear+fusion).">The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion).</a> PCR Methods Appl. 1, 1-4 (1991).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Paabo, S., Gifford, J. A., Wilson, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+sequences+from+a+7000-year+old+brain.">Mitochondrial DNA sequences from a 7000-year old brain.</a> Nucleic Acids Res. 16, 9775-9787 (1988).</li><li>Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+can+eliminate+the+base+pair+composition+dependence+of+DNA+melting.">Betaine can eliminate the base pair composition dependence of DNA melting.</a> Biochemistry. 32, 137-144 (1993).</li><li>Roux, K. H., Hecker, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+optimization+using+touchdown+and+stepdown+PCR.">One-step optimization using touchdown and stepdown PCR.</a> Methods Mol. Biol. 67, 39-45 (1997).</li><li>Rychlik, W., Spencer, W. J., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239, 487-491 (1988).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+beta-globin+genomic+sequences+and+restriction+site+analysis+for+diagnosis+of+sickle+cell+anemia.">Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.</a> Science. 230, 1350-1354 (1985).</li><li>Sambrook, J. A. R., David, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning A Laboratory Manual. 2, (2001).</li><li>Sarkar, G., Kapelner, S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formamide+can+dramatically+improve+the+specificity+of+PCR.">Formamide can dramatically improve the specificity of PCR.</a> Nucleic Acids Res. 18, 7465 (1990).</li><li>Smit, V. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAS+codon+12+mutations+occur+very+frequently+in+pancreatic+adenocarcinomas.">KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas.</a> Nucleic Acids Res. 16, 7773-7782 (1988).</li><li>Wilson, I. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+and+facilitation+of+nucleic+acid+amplification.">Inhibition and facilitation of nucleic acid amplification.</a> Appl. Environ. Microbiol. 63, 3741-3751 (1997).</li><li>Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Enzymology. 218, (1993).</li></ol>

나는 공개 할게 없다.

PCR은 생물 학적 과학 병기의 indispensible 도구가되었습니다. PCR은 genomes과 다양성뿐만 아니라, 더욱 생화 학적 분석을 위해 간단하게 복제 유전자에 대한 통찰력을 얻고, 구체적이고 정확한 임상 테스트를 수 있도록 생물학 자들이 genomes을 통해 권력을 양보하고, 새로운 기능과 하이브리드 유전자를 만들 수 있도록 과학의 진로를 변경했다. PCR 응용 프로그램은 자사의 강력한 힘을 가졌 과학자의 상상력에 의해 제한됩니다. 이 PCR의 새로운 특수 용도를 설명하는 많은 서적과 논문이 있으며, 많은는 생물 학적 과학의 차세대 걸쳐 개발됩니다. 그러나 관계없이 예상 접근법, 기본 프레임 워크는 동일 남아있다. PCR은 모든 과대에 DNA가 특정 세그먼트의 대량 생성의 체외 응용 프로그램입니다. PCR 실험을 설계하는 것은 사상과 인내가 필요합니다. 그림 3에 표시된 결과는 주요 채널 중 하나를 예시PCR을위한 최적화 전략을 디자인할 때 allenges. PCR 중 하나가 매개 변수가 변경되면 그것은, 그것은 또 다른 영향을 미칠 수 있습니다. 초기 PCR은 최적의 MG이 2.0 mm의 + 농도와 하위 최적 어닐링 온도 (58 ° C)에서 실시되었다 경우 예를 들어, 다음, 결과는 그림 3C에서 볼로 얼룩을 생산합니다. 얼룩을 해결하기위한 시도가 2.0 밀리미터 MgCl 2를 포함하는 반응과 PCR 조건을 설정하고 61 ° C.로 어닐링 온도를 조정 관련 됐을지도 몰라요 그러나, 같은 그림 3A에서 본,이 모든 제품을 얻을 수없는 것이다. 따라서, 그것은 오히려 가짜 결과를 해결할 때, 단일 반응을 한 농도를 추가하는 것보다, 시약을 적정하다 것이 좋습니다. 또한, PCR 실험을 최적화하는 데 필요한 가장 일반적인 조정 MG 2 + 농도를 변경하고 어닐링 온도를 수정하는 것입니다. 그러나 이러한 변화는 최소화하거나 탈선 결과를 폐기하다, additi의 적정하지 않을 경우ves 및 / 또는 같은 표 2-6에 설명된 사이클링 조건 프로토콜을 변경하는 문제를 줄일 수 있습니다. 다른 모든 실패하면 primers를 다시 디자인하고 시도 다시 시도하십시오.

<table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td><td> 댓글 </td></tr><tr><td> DNA 형성 촉매 Polymeras </td><td> 시그마 </td><td> D4545-25UN </td><td></td></tr><tr><td> dNTPs </td><td> Qiagen </td><td> 201,225 </td><td></td></tr><tr><td> 0.2 ML 얇은 벽 튜브 PCR 튜브 </td><td> 바이오는 힘이에요 </td><td> 223-9469 </td><td></td></tr><tr><td> 0.2 ML 얇은 벽 튜브 모자 </td><td> 바이오는 힘이에요 </td><td> 223-9472 </td><td></td></tr><tr><td> TE 버퍼 : </td><td></td><td></td><td></td></tr><tr><td> EDTA (에틸렌 다이아 민 테트라 초산) 나트륨 소금의 이수화물 </td><td> 시그마 </td><td> E5134 </td><td></td></tr><tr><td> Trizma-HCL </td><td> 시그마 </td><td> T-3253 </td><td></td></tr><tr><td> 사용자 정의 파지의 프라이머 </td><td> Invitrogen </td><td colspan="2"> 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG </td></tr><tr><td> 사용자 정의 파지의 프라이머 </td><td> Invitrogen </td><td colspan="2"> 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT </td></tr><tr><td> 사용자 정의 효모 프라이머 </td><td> 통합의 DNA 기술 </td><td colspan="2"> SacI-Gal3 (-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG </td></tr><tr><td> 사용자 정의 효모 프라이머 </td><td> 통합의 DNA 기술 </td><td colspan="2"> Gal3 (1848) - SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG에게 </td></tr><tr><td> 열전달 자전거 타는 사람 </td><td> 바이오는 힘이에요 </td><td> 170-9703 </td><td> 내 자전거 타는 사람 </td></tr><tr><td> 아가로 오스 </td><td> ISC BioExpress </td><td> 전자 3120-500 </td><td></td></tr><tr><td> 겔 전기 영동 </td><td> Hoeffer 과학 계측기 </td><td> 모델 HE33 </td><td></td></tr><tr><td> 1킬로바이트의 DNA 사다리 </td><td> 뉴잉글랜드 BioLabs </td><td> N3232S </td><td></td></tr><tr><td> 바이오 방사선 파워 팩 </td><td> 바이오는 힘이에요 </td><td> 164-5050 </td><td> PowerPac 기본 </td></tr><tr><td> 젤 닥 시스템 </td><td> Fotodyne 법인 </td><td colspan="2"> FOTO / 분석 탐정 FX 워크 스테이션 </td></tr></tbody></table>

polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies

생명 공학 발견의 황금 시대로 징계를 쇠뇌 기술 진보가 있었다. 예를 들어, 미생물학 분야는 과학자들이 처음으로 prokaryotes을 시각화 수 안톤 반 리웬허크와의 현미경의 출현으로 변모되었다. 중합 효소 사슬 반응 (PCR)의 개발 미치는 영향은 생물학에서 수많은 subdisciplines를 스팬과 분자 과학의 진로를 변경 이들 혁신 중 하나입니다. 이론 과정은 1971 년에 Keppe와 동료에 의해 제시된되었다; 전체 PCR 절차 주면 주식 회사에서 1985 년 동안 Kary Mullis에 의해 설명하고 실험적으로 적용되기 전까지는하지만, 그건 다른 14년했습니다. 이 기법의 자동화 및 개선은 세균의 Thermus aquaticus의, 따라서 이름이 DNA 형성 촉매 장치의 DNA 중합 효소의 열 안정성의 DNA 중합 효소의 도입과 함께 진행. PCR은 포웨입니다시작하는 재료만을 소량 (즉, DNA를 템플릿이나 대상 시퀀스)의 DNA (즉, amplicon)의 특정 세그먼트의 충분한 공급을 생성할 수 rful 증폭 기술. 간단하고 일반적으로 문제가없는 반면, 가짜 결과를 생산하는 반응을 복잡하게 함정이 있습니다. PCR이 실패했을 때 그것은 아가로 오스의 젤에 대한 밴드의 사다리 또는 얼룩으로 나타 다양한 규모의 다수가 아닌 특정 DNA의 제품으로 이어질 수 있습니다. 가끔 제품이 전혀 나오지. 변이가 실수로 PCR 제품의 이질적인 인구 결과, amplicons에 소개되면 또 다른 잠재적인 문제가 발생합니다. 인내와 신중 문제 해결이 정리 및 문제 (들)을 해결하기 위해 고용하지 않는 경우 PCR 실패는 절망적이 될 수 있습니다. 이 프로토콜은 PCR의 기본 원리를 설명 대부분의 대상 시퀀스의 증폭집니다 방법론을 제공하고 반응을 최적화하기위한 전략을 제시합니다. 이 PCR 가이드, 일에 따라udents는 할 수 있어야합니다 : <ul><li> 종래의 PCR 실험에 대한 반응 및 열 사이클링 조건을 설정 </li><li> 다양한 반응 구성 요소의 기능과 PCR 실험에 미치는 전반적인 영향을 이해 </li><li> 어떤 DNA를 템플릿에 대한 PCR 실험을 설계하고 최적화 </li><li> 실패 PCR 실험 문제 해결 </li></ul>

Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

PCR은 많은 분자 생물학 연구소의 일반적인 기법으로 부상하고있다. 여러 기존의 PCR 프로토콜에 대한 안내서가 여기에 제공됩니다. 각 반응은 독특한 실험, 제품이 다양 생성하는 데 필요한 최적의 조건이기 때문에. 반응의 변수를 이해하는 것은 크게함으로써 원하는 결과를 얻을 수있는 기회를 증가 문제 해결 효율성을 향상시킬 것입니다.

중합 효소 사슬 반응 : 기본 프로토콜 플러스 문제 해결 및 최적화 전략

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of ...

Research

JoVE Journal

Biology

Optimization of the Ugi Reaction Using Parallel Synthesis and Automated Liquid Handling

병렬 합성 및 자동 액체 처리를 사용하여 Ugi 반응의 최적화

The optimization of a Ugi reaction involving the mixing of furfurylamine, benzaldehyde, boc-glycine and t-butylisocyanide is described.  Triplicate runs ...

연구

생물학

Elevated Plus Maze for Mice

마우스에 대한 고가 플러스 메이즈

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given ...

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

비침 투 VIVO에서 스몰 애니멀 MRI 및 MRS : 기본 실험 절차

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the ...

Multiplexed Fluorometric ImmunoAssay Testing Methodology and Troubleshooting

멀티 플렉스 Fluorometric 면역 분석법 테스트 방법론 및 문제 해결

To ensure the quality of animal models used in biomedical research we have developed a number of diagnostic testing strategies and methods to determine if ...

Basic Caenorhabditis elegans Methods: Synchronization and Observation

Basic Caenorhabditis elegans Methods: Synchronization and Observation

기본<em&gt; Caenorhabditis elegans</em&gt; 방법 : 동기화 및 전망

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has ...

A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies

문제 해결 전략 현대 양적 형광 웨스턴 블로 팅에 가이드

The late 1970s saw the first publicly reported use of the western blot, a technique for assessing the presence and relative abundance of specific proteins ...

Subcloning Plus Insertion (SPI) - A Novel Recombineering Method for the Rapid Construction of Gene Targeting Vectors

Subcloning Plus Insertion SPI - A Novel Recombineering Method for the Rapid Construction of Gene Targeting Vectors

서브 클로닝 플러스 삽입 (SPI) - 유전자 타겟팅 벡터의 신속한 건설 소설 Recombineering 방법

Gene targeting refers to the precise modification of a genetic locus using homologous recombination. The generation of novel cell lines and transgenic ...

A Rapid Automated Protocol for Muscle Fiber Population Analysis in Rat Muscle Cross Sections Using Myosin Heavy Chain Immunohistochemistry

마이 오신 중쇄 면역를 사용하여 쥐의 근육 크로스 섹션에서 근육 섬유 인구 분석을위한 신속한 자동화 프로토콜

Quantification of muscle fiber populations provides a deeper insight into the effects of disease, trauma, and various other influences on skeletal muscle ...

Procedure and Key Optimization Strategies for an Automated Capillary Electrophoretic-based Immunoassay Method

절차 및 자동화 된 모 세관 전기 이동 기반 Immunoassay 방법에 대 한 중요 한 최적화 전략

New technologies that utilize capillary-based immunoassays promise faster and more quantitative protein assessment compared to traditional immunoassays. ...

Optimization of Crystal Growth for Neutron Macromolecular Crystallography

중성자 대분자 결정학을 위한 결정 성장의 최적화

The use of neutron macromolecular crystallography (NMX) is expanding rapidly with most structures determined in the last decade thanks to new NMX ...