Name: mapping bacterial functional networks and pathways in escherichia coli using synthetic genetic arrays
Uploaded: 2012-11-12T12:00:00
Description: Watch this Scientific Journal Video about Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays at JoVE.com

وأيد هذا العمل من جانب صناديق من كندا الجينوم، ومعهد أونتاريو علم الجينوم، والمعاهد الكندية لأبحاث الصحة لمنح JG وAG AE هي المستفيدة من منحة الدراسات العليا فانييه كندا.

1. بناء سلالات HFR المانحة كافالي المسخ بواسطة Recombineering 15 و 16 يتم وصف الخطوات لبناء البقع المانحة eSGA أدناه. لفترة وجيزة، ونحن نستخدم λ المستهدفة - الأحمر توسط إعادة التركيب مثلي 16 من تضخيم الحمض النووي كاسيت اختيا...

<ol>
	<li>Bandyopadhyay, S., Kelley, R., Krogan, N. J., Ideker, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+maps+of+protein+complexes+from+quantitative+genetic+interaction+data.">Functional maps of protein complexes from quantitative genetic interaction data.</a> PLoS Comput. Biol. 4, e1000065 (2008).</li><li>Costanzo, M., Baryshnikova, A., Myers, C. L., Andrews, B., Boone, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Charting+the+genetic+interaction+map+of+a+cell.">Charting the genetic interaction map of a cell.</a> Curr. Opin. Biotechnol. 22, 66-74 (2011).</li><li>Costanzo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genetic+landscape+of+a+cell.">The genetic landscape of a cell.</a> Science. 327, 425-4231 (2010).</li><li>Fiedler, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+organization+of+the+S.+cerevisiae+phosphorylation+network.">Functional organization of the S. cerevisiae phosphorylation network.</a> Cell. 136, 952-963 (2009).</li><li>Roguev, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservation+and+rewiring+of+functional+modules+revealed+by+an+epistasis+map+in+fission+yeast.">Conservation and rewiring of functional modules revealed by an epistasis map in fission yeast.</a> Science. 322, 405-4010 (2008).</li><li>Schuldiner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+function+and+organization+of+the+yeast+early+secretory+pathway+through+an+epistatic+miniarray+profile.">Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile.</a> Cell. 123, 507-519 (2005).</li><li>Wilmes, G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+interaction+map+of+RNA-processing+factors+reveals+links+between+Sem1/Dss1-containing+complexes+and+mRNA+export+and+splicing.">A genetic interaction map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and mRNA export and splicing.</a> Mol. Cell. 32, 735-746 (2008).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systems-level+approaches+for+identifying+and+analyzing+genetic+interaction+networks+in+Escherichia+coli+and+extensions+to+other+prokaryotes.">Systems-level approaches for identifying and analyzing genetic interaction networks in Escherichia coli and extensions to other prokaryotes.</a> Mol. Biosyst. 12, 1439-1455 (2009).</li><li>Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=coli+synthetic+genetic+array+analysis.">coli synthetic genetic array analysis.</a> Nat. Methods. 5, 789-7895 (2008).</li><li>Typas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+peptidoglycan+synthesis+by+outer-membrane+proteins.">Regulation of peptidoglycan synthesis by outer-membrane proteins.</a> Cell. 143, 1097-10109 (2010).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, 2006-200008 (2006).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+interaction+maps+in+Escherichia+coli+reveal+functional+crosstalk+among+cell+envelope+biogenesis+pathways.">Genetic interaction maps in Escherichia coli reveal functional crosstalk among cell envelope biogenesis pathways.</a> PLoS Genet. 7, e1002377 (2011).</li><li>Nichols, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phenotypic+landscape+of+a+bacterial+cell.">Phenotypic landscape of a bacterial cell.</a> Cell. 144, 143-156 (2011).</li><li>Babu, M., Gagarinova, A., Greenblatt, J., Emili, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-based+synthetic+genetic+screens+to+map+bacterial+pathways+and+functional+networks+in+Escherichia+coli.">Array-based synthetic genetic screens to map bacterial pathways and functional networks in Escherichia coli.</a> Methods Mol Biol. 765, 125-153 (2011).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-665 (2000).</li><li>Yu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+recombination+system+for+chromosome+engineering+in+Escherichia+coli.">An efficient recombination system for chromosome engineering in Escherichia coli.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).</li><li>Typas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=quantitative+analyses+of+genetic+interactions+in.">quantitative analyses of genetic interactions in.</a> E. coli. Nat. Methods. 5, 781-787 (2008).</li><li>Zeghouf, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+Peptide+Affinity+(SPA)+system+for+the+identification+of+mammalian+and+bacterial+protein+complexes.">Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes.</a> J. Proteome Res. 3, 463-468 (2004).</li><li>Davierwala, A. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> , 1147-1152 (2005).</li><li>Breslow, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+strategy+enabling+high-resolution+functional+analysis+of+the+yeast+genome.">A comprehensive strategy enabling high-resolution functional analysis of the yeast genome.</a> Nat. Methods. 5, 711-718 (2008).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+peptide+affinity+purification+system+for+the+systematic+isolation+and+identification+of+protein+complexes+from+Escherichia+coli.">Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli.</a> Methods Mol. Biol. 564, 373-400 (2009).</li><li>Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+network+containing+conserved+and+essential+protein+complexes+in+Escherichia+coli.">Interaction network containing conserved and essential protein complexes in Escherichia coli.</a> Nature. 433, 531-537 (2005).</li><li>Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+functional+atlas+of+Escherichia+coli+encompassing+previously+uncharacterized+proteins.">Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins.</a> PLoS Biol. 7, (2009).</li><li>Anderson, R. P., Roth, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+genetic+duplications+in+phage+and+bacteria.">Tandem genetic duplications in phage and bacteria.</a> Annu. Rev. Microbiol. 31, 473-505 (1977).</li><li>Boone, C., Bussey, H., Andrews, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+genetic+interactions+and+networks+with+yeast.">Exploring genetic interactions and networks with yeast.</a> Nat. Rev. Genet. 8, 437-449 (2007).</li><li>Collins, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+dissection+of+protein+complexes+involved+in+yeast+chromosome+biology+using+a+genetic+interaction+map.">Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map.</a> Nature. 446, 806-8010 (2007).</li><li>Le Meur, N., Gentleman, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+synthetic+lethality.">Modeling synthetic lethality.</a> Genome Biol. 9, R135 (2008).</li><li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+mapping+of+the+yeast+genetic+interaction+network.">Global mapping of the yeast genetic interaction network.</a> Science. 303, 808-813 (2004).</li><li>Wong, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combining+biological+networks+to+predict+genetic+interactions.">Combining biological networks to predict genetic interactions.</a> Proc. Natl. Acad. Sci. U.S.A. 101, 15682-15687 (2004).</li><li>van Opijnen, T., Bodi, K. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn-seq:+high-throughput+parallel+sequencing+for+fitness+and+genetic+interaction+studies+in+microorganisms.">Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms.</a> Nat. Methods. 6, 767-772 (2009).</li><li>Gagarinova, A., Emili, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+genetic+manipulation+methods+for+exploring+bacterial+molecular+biology.">Genome-scale genetic manipulation methods for exploring bacterial molecular biology.</a> Mol. Biosyst. 8, 1626-1638 (2012).</li><li>Dewey, C. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Positional+orthology:+putting+genomic+evolutionary+relationships+into+context.">Positional orthology: putting genomic evolutionary relationships into context.</a> Brief Bioinform. 12, 401-412 (2011).</li><li>St Onge, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+pathway+analysis+using+high-resolution+fitness+profiling+of+combinatorial+gene+deletions.">Systematic pathway analysis using high-resolution fitness profiling of combinatorial gene deletions.</a> Nat. Genet. 39, 199-206 (2007).</li></ol>

وقد أوجزنا بروتوكول تدريجي لاستخدام الروبوتية eSGA الفحص الجيني للتحقيق في وظائف البكتيرية على مستوى المسار من خلال استجواب GI. ويمكن استخدام هذا النهج لدراسة الجينات الفردية وكذلك في النظم البيولوجية بأكمله E. القولونية. تنفيذ الخطوات بعناية التجريبية المذكورة ?...

<table border="1" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>I. Antibiotics</td>
			<td>2</td>
			<td>36471 
			Remove</td>
		</tr>
		<tr>
			<td>Chloramphenicol</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#CLR201</td>
			<td>&nbsp;</td>
			<td>3</td>
			<td>36472 
			Remove</td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>#KAN201</td>
			<td>&nbsp;</td>
			<td>4</td>
			<td>36480 
			Remove</td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td># AMP201</td>
			<td>&nbsp;</td>
			<td>5</td>
			<td>36473 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>2. Luria-Bertani medium</td>
			<td>6</td>
			<td>36474 
			Remove</td>
		</tr>
		<tr>
			<td>LB powder</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#LBL405</td>
			<td>&nbsp;</td>
			<td>7</td>
			<td>36478 
			Remove</td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#AGR003</td>
			<td>&nbsp;</td>
			<td>8</td>
			<td>36481 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>3. Bacterial Strains and Plasmids</td>
			<td>9</td>
			<td>36475 
			Remove</td>
		</tr>
		<tr>
			<td>Hfr Cavalli strain &lambda;red system (JL238)</td>
			<td>&nbsp;</td>
			<td>Babu et al.14.</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>10</td>
			<td>36476 
			Remove</td>
		</tr>
		<tr>
			<td>pKD3</td>
			<td>&nbsp;</td>
			<td>E. coli Genetic Stock Centre, Yale</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>11</td>
			<td>36477 
			Remove</td>
		</tr>
		<tr>
			<td>Keio E. coli F- recipient collection</td>
			<td>&nbsp;</td>
			<td>National BioResource Project (NBRP) of Japan11</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>12</td>
			<td>36479 
			Remove</td>
		</tr>
		<tr>
			<td>Hypomorphic E. coli F- SPA-tag strains</td>
			<td>&nbsp;</td>
			<td>Open biosystems; Babu et al.14</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>13</td>
			<td>36491 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>4. Primers</td>
			<td>14</td>
			<td>36486 
			Remove</td>
		</tr>
		<tr>
			<td>pKD3-based desalted constant primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>F1: 5'-GGCTGACATGGGAATTAGC-3' 
			R1: 5'-AGATTGCAGCATTACACGTCTT-3'</td>
			<td>15</td>
			<td>36482 
			Remove</td>
		</tr>
		<tr>
			<td>Desalted custom primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>Cm-R: 5'-TTATACGCAAGGCGACAAGG-3' 
			Cm-F: 5'- GATCTTCCGTCACAGGTAGG-3'</td>
			<td>16</td>
			<td>36483 
			Remove</td>
		</tr>
		<tr>
			<td>Desalted custom primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions 
			F2 constant region: 
			5'-CATATGAATATCCTCCTTA-3' 
			R2 constant region: 
			5'-TGTGTAGGCTGGAGCTGCTTC-3'S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions 
			S1 constant region: 
			5'AGCTGGAGGATCCATGGAAAAGAGAAG -3' 
			S2 constant region: 
			5'- GGCCCCATATGAATATCCTCCTTAGTT -3' 
			 
			KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential 
			gene SPA-tag insertion site</td>
			<td>17</td>
			<td>36484 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>5. PCR and Electrophoresis Reagents</td>
			<td>18</td>
			<td>36485 
			Remove</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>19</td>
			<td>36487 
			Remove</td>
		</tr>
		<tr>
			<td>10X PCR buffer</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>20</td>
			<td>36488 
			Remove</td>
		</tr>
		<tr>
			<td>10 mM dNTPs</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>21</td>
			<td>36489 
			Remove</td>
		</tr>
		<tr>
			<td>25 mM MgCl2</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>22</td>
			<td>36490 
			Remove</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># AGA002</td>
			<td>&nbsp;</td>
			<td>23</td>
			<td>36492 
			Remove</td>
		</tr>
		<tr>
			<td>Loading dye</td>
			<td>&nbsp;</td>
			<td>NEB</td>
			<td>#B7021S</td>
			<td>&nbsp;</td>
			<td>24</td>
			<td>36493 
			Remove</td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># ETB444</td>
			<td>&nbsp;</td>
			<td>25</td>
			<td>36497 
			Remove</td>
		</tr>
		<tr>
			<td>10X TBE buffer</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># ETB444.10</td>
			<td>&nbsp;</td>
			<td>26</td>
			<td>36494 
			Remove</td>
		</tr>
		<tr>
			<td>Tris Base</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># TRS001</td>
			<td>&nbsp;</td>
			<td>27</td>
			<td>36495 
			Remove</td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td># T1503-1KG</td>
			<td>&nbsp;</td>
			<td>28</td>
			<td>36496 
			Remove</td>
		</tr>
		<tr>
			<td>0.5 M EDTA (pH 8.0)</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td># B6768-500G</td>
			<td>&nbsp;</td>
			<td>29</td>
			<td>36498 
			Remove</td>
		</tr>
		<tr>
			<td>DNA ladder</td>
			<td>&nbsp;</td>
			<td>NEB</td>
			<td>#N3232L</td>
			<td>&nbsp;</td>
			<td>30</td>
			<td>36499 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>6. DNA isolation and Clean-up Kits</td>
			<td>31</td>
			<td>36500 
			Remove</td>
		</tr>
		<tr>
			<td>Genomic DNA isolation and purification kit</td>
			<td>&nbsp;</td>
			<td>Promega</td>
			<td>#A1120</td>
			<td>&nbsp;</td>
			<td>32</td>
			<td>36501 
			Remove</td>
		</tr>
		<tr>
			<td>Plasmid Midi kit</td>
			<td>&nbsp;</td>
			<td>Qiagen</td>
			<td># 12143</td>
			<td>&nbsp;</td>
			<td>33</td>
			<td>36502 
			Remove</td>
		</tr>
		<tr>
			<td>QIAquick PCR purification kit</td>
			<td>&nbsp;</td>
			<td>Qiagen</td>
			<td>#28104</td>
			<td>&nbsp;</td>
			<td>34</td>
			<td>36512 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>7. Equipment for PCR, Transformation and Replica-pinning</td>
			<td>35</td>
			<td>36503 
			Remove</td>
		</tr>
		<tr>
			<td>Thermal cycler</td>
			<td>&nbsp;</td>
			<td>BioRad, iCycler</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>36</td>
			<td>36504 
			Remove</td>
		</tr>
		<tr>
			<td>Agarose gel electrophoresis</td>
			<td>&nbsp;</td>
			<td>BioRad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>37</td>
			<td>36505 
			Remove</td>
		</tr>
		<tr>
			<td>Electroporator</td>
			<td>&nbsp;</td>
			<td>Bio-Rad GenePulser II</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>38</td>
			<td>36506 
			Remove</td>
		</tr>
		<tr>
			<td>0.2 cm electroporation cuvette</td>
			<td>&nbsp;</td>
			<td>Bio-Rad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>39</td>
			<td>36507 
			Remove</td>
		</tr>
		<tr>
			<td>42 &deg;C water bath shaker</td>
			<td>&nbsp;</td>
			<td>Innova 3100</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>40</td>
			<td>36508 
			Remove</td>
		</tr>
		<tr>
			<td>Beckman Coulter TJ-25 centrifuge</td>
			<td>&nbsp;</td>
			<td>Beckman Coulter</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>41</td>
			<td>36519 
			Remove</td>
		</tr>
		<tr>
			<td>32 &deg;C shaker</td>
			<td>&nbsp;</td>
			<td>New Brunswick Scientific, USA</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>42</td>
			<td>36509 
			Remove</td>
		</tr>
		<tr>
			<td>32 &deg;C plate incubator</td>
			<td>&nbsp;</td>
			<td>Fisher Scientific</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>43</td>
			<td>36510 
			Remove</td>
		</tr>
		<tr>
			<td>RoToR-HDA benchtop robot</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>44</td>
			<td>36511 
			Remove</td>
		</tr>
		<tr>
			<td>96, 384 and 1,536 pin density pads</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>45</td>
			<td>36513 
			Remove</td>
		</tr>
		<tr>
			<td>96 or 384 long pins</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>46</td>
			<td>36514 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>8. Imaging Equipments</td>
			<td>47</td>
			<td>36515 
			Remove</td>
		</tr>
		<tr>
			<td>Camera stand</td>
			<td>&nbsp;</td>
			<td>Kaiser</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>48</td>
			<td>36516 
			Remove</td>
		</tr>
		<tr>
			<td>Digital camera, 10 megapixel</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>49</td>
			<td>36517 
			Remove</td>
		</tr>
		<tr>
			<td>Light boxes, Testrite 16" x 24" units</td>
			<td>&nbsp;</td>
			<td>Testrite</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>50</td>
			<td>36527 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>9. Pads or Plates Recycling </td>
			<td>51</td>
			<td>36518 
			Remove</td>
		</tr>
		<tr>
			<td>10% bleach</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>52</td>
			<td>36520 
			Remove</td>
		</tr>
		<tr>
			<td>70% ethanol</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>53</td>
			<td>36521 
			Remove</td>
		</tr>
		<tr>
			<td>Sterile distilled water</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>54</td>
			<td>36522 
			Remove</td>
		</tr>
		<tr>
			<td>Flow hood</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>55</td>
			<td>36523 
			Remove</td>
		</tr>
		<tr>
			<td>Ultraviolet lamp</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>56</td>
			<td>36524 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>10. Labware</td>
			<td>57</td>
			<td>36525 
			Remove</td>
		</tr>
		<tr>
			<td>50 ml polypropylene tubes</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>58</td>
			<td>36526 
			Remove</td>
		</tr>
		<tr>
			<td>1.5 ml micro-centrifuge tubes</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>59</td>
			<td>36528 
			Remove</td>
		</tr>
		<tr>
			<td>250 ml conical flaks</td>
			<td>&nbsp;</td>
			<td>VWR</td>
			<td># 29140-045</td>
			<td>&nbsp;</td>
			<td>60</td>
			<td>36529 
			Remove</td>
		</tr>
		<tr>
			<td>15 ml sterile culture tubes</td>
			<td>&nbsp;</td>
			<td>Thermo Scientific</td>
			<td># 366052</td>
			<td>&nbsp;</td>
			<td>61</td>
			<td>36530 
			Remove</td>
		</tr>
		<tr>
			<td>Cryogenic vials</td>
			<td>&nbsp;</td>
			<td>VWR</td>
			<td># 479-3221</td>
			<td>&nbsp;</td>
			<td>62</td>
			<td>36531 
			Remove</td>
		</tr>
		<tr>
			<td>Rectangular Plates</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>63</td>
			<td>36532 
			Remove</td>
		</tr>
		<tr>
			<td>96-well and 384-well microtitre plates</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>Nunc</td>
			<td>&nbsp;</td>
			<td>64</td>
			<td>36533 
			Remove</td>
		</tr>
		<tr>
			<td>Plate roller for sealing multi-well</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td>#R1275</td>
			<td>&nbsp;</td>
			<td>65</td>
			<td>36535 
			Remove</td>
		</tr>
		<tr>
			<td>plates</td>
			<td>&nbsp;</td>
			<td>ABgene</td>
			<td># AB-0580</td>
			<td>&nbsp;</td>
			<td>66</td>
			<td>36534 
			Remove</td>
		</tr>
		<tr>
			<td>Adhesive plate seals</td>
			<td>&nbsp;</td>
			<td>Fisher Scientific</td>
			<td># 13-990-14</td>
			<td>&nbsp;</td>
			<td>67</td>
			<td>36537 
			Remove</td>
		</tr>
		<tr>
			<td>-80 &deg;C freezer</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>68</td>
			<td>36536 
			Remove</td>
		</tr>
	</tbody>
</table>

mapping bacterial functional networks and pathways in escherichia coli using synthetic genetic arrays

Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.

GIs reveal functional relationships between genes. Similarly, since genes in the same pathway display similar GI patterns and the GI profile similarity represents the congruency of phenotypes, we can group functionally related genes into pathways by clustering their GI profiles. Integrating GI and GI correlation networks with physical interaction information or other association data, such as genomic context (GC) relationships can also reveal the organization of higher-order functional modules that define core bio...

Watch this Scientific Journal Video about Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays at JoVE.com

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

ويمكن استخدام منهجية واسعة النطاق الاصطناعية الوراثية شاشات التفاعل (الجينات الجين أو قشوة) لاستكشاف التكرار الجيني وعبر مسار الحديث. ووصف eSGA هنا، نحن تصف عالية الإنتاجية الكمية الاصطناعية الفحص الجيني مجموعة التكنولوجيا، التي قمنا بتطويرها لتوضيح العلاقات واستكشاف روكبي شبكات التفاعل الوراثية في<em&gt; كولاي</em&gt;.

رسم خرائط الشبكات الوظيفية البكتيرية والممرات في<em&gt; كولاي</em&gt; استخدام المصفوفات الوراثية الاصطناعية

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

Research

JoVE Journal

Biology

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Light/dark Transition Test for Mice

الضوء / الظلام لاختبار الانتقال الفئران

Although all of the mouse genome sequences have been determined, we do not yet know the functions of most of these genes. Gene-targeting techniques, ...

How to Culture, Record and Stimulate Neuronal Networks on Micro-electrode Arrays (MEAs)

How to Culture, Record and Stimulate Neuronal Networks on Micro-electrode Arrays MEAs

كيفية تسجيل والثقافة والحث على الشبكات العصبية الصغيرة مسرى صالحة (الاتفاقات)

For the last century, many neuroscientists around the world have dedicated their lives to understanding how neuronal networks work and why they stop ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

بروتوكولات اختيار الطفرات وظيفية لتطور المخرج من البروتينات في E. القولونية</em

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

ارتفاع المناولة فحص النشاط Endoglucanase الفطرية في القولونية</em

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted ...

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

تحديد بروتين في مجمعات<em&gt; كولاي</em&gt; استخدام المتعاقبة تنقية تقارب الببتيد في تركيبة مع جنبا إلى جنب الطيف الكتلي

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the ...

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

بروتوكول السريع لإعداد Electrocompetent<em&gt; كولاي</em&gt; و<em&gt; ضمة الكوليرا</em

Electroporation has become a widely used method for rapidly and efficiently introducing foreign DNA into a wide range of cells. Electrotransformation has ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

بروتوكولات لتنفيذ و<em&gt; كولاي</em&gt; وبناء خلية الحرة TX-TL نظام التعبير عن علم الأحياء الاصطناعية

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

الكشف عن لايف<em&gt; كولاي</em&gt; O157: H7 من قبل خلايا PMA-QPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

الأخضر الفلورسنت القائم على البروتين التعبير فحص غشاء البروتينات في<em&gt; الإشريكية القولونية</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

فوائد متعددة الأوجه من البروتين المشارك في التعبير<em&gt; الإشريكية القولونية</em

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in ...