Name: mapping bacterial functional networks and pathways in escherichia coli using synthetic genetic arrays
Uploaded: 2012-11-12T12:00:00
Description: Watch this Scientific Journal Video about Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays at JoVE.com

Ce travail a été soutenu par des fonds de Génome Canada, l&#39;Ontario Genomics Institute, et les Instituts de recherche en santé subventions à JG et AE AG est récipiendaire de bourses d&#39;études supérieures du Canada Vanier.

1. Construction de souches Hfr donatrices Cavalli Mutant par Recombineering 15, 16 Les étapes de la construction des taches donateurs ESGA sont décrits ci-dessous. En bref, nous utilisons λ ciblée - Rouge médiation recombinaison homologue 16 de cassette d&#39;ADN amplifié marqueur de sélection des fragments générés par PCR pour créer non essentiels mutants de délétion de gènes (section 1.1) ou de gènes essentiels hypomorphes souches mutante...

<ol>
	<li>Bandyopadhyay, S., Kelley, R., Krogan, N. J., Ideker, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+maps+of+protein+complexes+from+quantitative+genetic+interaction+data.">Functional maps of protein complexes from quantitative genetic interaction data.</a> PLoS Comput. Biol. 4, e1000065 (2008).</li><li>Costanzo, M., Baryshnikova, A., Myers, C. L., Andrews, B., Boone, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Charting+the+genetic+interaction+map+of+a+cell.">Charting the genetic interaction map of a cell.</a> Curr. Opin. Biotechnol. 22, 66-74 (2011).</li><li>Costanzo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genetic+landscape+of+a+cell.">The genetic landscape of a cell.</a> Science. 327, 425-4231 (2010).</li><li>Fiedler, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+organization+of+the+S.+cerevisiae+phosphorylation+network.">Functional organization of the S. cerevisiae phosphorylation network.</a> Cell. 136, 952-963 (2009).</li><li>Roguev, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservation+and+rewiring+of+functional+modules+revealed+by+an+epistasis+map+in+fission+yeast.">Conservation and rewiring of functional modules revealed by an epistasis map in fission yeast.</a> Science. 322, 405-4010 (2008).</li><li>Schuldiner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+function+and+organization+of+the+yeast+early+secretory+pathway+through+an+epistatic+miniarray+profile.">Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile.</a> Cell. 123, 507-519 (2005).</li><li>Wilmes, G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+interaction+map+of+RNA-processing+factors+reveals+links+between+Sem1/Dss1-containing+complexes+and+mRNA+export+and+splicing.">A genetic interaction map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and mRNA export and splicing.</a> Mol. Cell. 32, 735-746 (2008).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systems-level+approaches+for+identifying+and+analyzing+genetic+interaction+networks+in+Escherichia+coli+and+extensions+to+other+prokaryotes.">Systems-level approaches for identifying and analyzing genetic interaction networks in Escherichia coli and extensions to other prokaryotes.</a> Mol. Biosyst. 12, 1439-1455 (2009).</li><li>Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=coli+synthetic+genetic+array+analysis.">coli synthetic genetic array analysis.</a> Nat. Methods. 5, 789-7895 (2008).</li><li>Typas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+peptidoglycan+synthesis+by+outer-membrane+proteins.">Regulation of peptidoglycan synthesis by outer-membrane proteins.</a> Cell. 143, 1097-10109 (2010).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, 2006-200008 (2006).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+interaction+maps+in+Escherichia+coli+reveal+functional+crosstalk+among+cell+envelope+biogenesis+pathways.">Genetic interaction maps in Escherichia coli reveal functional crosstalk among cell envelope biogenesis pathways.</a> PLoS Genet. 7, e1002377 (2011).</li><li>Nichols, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phenotypic+landscape+of+a+bacterial+cell.">Phenotypic landscape of a bacterial cell.</a> Cell. 144, 143-156 (2011).</li><li>Babu, M., Gagarinova, A., Greenblatt, J., Emili, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-based+synthetic+genetic+screens+to+map+bacterial+pathways+and+functional+networks+in+Escherichia+coli.">Array-based synthetic genetic screens to map bacterial pathways and functional networks in Escherichia coli.</a> Methods Mol Biol. 765, 125-153 (2011).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-665 (2000).</li><li>Yu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+recombination+system+for+chromosome+engineering+in+Escherichia+coli.">An efficient recombination system for chromosome engineering in Escherichia coli.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).</li><li>Typas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=quantitative+analyses+of+genetic+interactions+in.">quantitative analyses of genetic interactions in.</a> E. coli. Nat. Methods. 5, 781-787 (2008).</li><li>Zeghouf, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+Peptide+Affinity+(SPA)+system+for+the+identification+of+mammalian+and+bacterial+protein+complexes.">Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes.</a> J. Proteome Res. 3, 463-468 (2004).</li><li>Davierwala, A. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> , 1147-1152 (2005).</li><li>Breslow, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+strategy+enabling+high-resolution+functional+analysis+of+the+yeast+genome.">A comprehensive strategy enabling high-resolution functional analysis of the yeast genome.</a> Nat. Methods. 5, 711-718 (2008).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+peptide+affinity+purification+system+for+the+systematic+isolation+and+identification+of+protein+complexes+from+Escherichia+coli.">Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli.</a> Methods Mol. Biol. 564, 373-400 (2009).</li><li>Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+network+containing+conserved+and+essential+protein+complexes+in+Escherichia+coli.">Interaction network containing conserved and essential protein complexes in Escherichia coli.</a> Nature. 433, 531-537 (2005).</li><li>Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+functional+atlas+of+Escherichia+coli+encompassing+previously+uncharacterized+proteins.">Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins.</a> PLoS Biol. 7, (2009).</li><li>Anderson, R. P., Roth, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+genetic+duplications+in+phage+and+bacteria.">Tandem genetic duplications in phage and bacteria.</a> Annu. Rev. Microbiol. 31, 473-505 (1977).</li><li>Boone, C., Bussey, H., Andrews, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+genetic+interactions+and+networks+with+yeast.">Exploring genetic interactions and networks with yeast.</a> Nat. Rev. Genet. 8, 437-449 (2007).</li><li>Collins, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+dissection+of+protein+complexes+involved+in+yeast+chromosome+biology+using+a+genetic+interaction+map.">Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map.</a> Nature. 446, 806-8010 (2007).</li><li>Le Meur, N., Gentleman, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+synthetic+lethality.">Modeling synthetic lethality.</a> Genome Biol. 9, R135 (2008).</li><li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+mapping+of+the+yeast+genetic+interaction+network.">Global mapping of the yeast genetic interaction network.</a> Science. 303, 808-813 (2004).</li><li>Wong, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combining+biological+networks+to+predict+genetic+interactions.">Combining biological networks to predict genetic interactions.</a> Proc. Natl. Acad. Sci. U.S.A. 101, 15682-15687 (2004).</li><li>van Opijnen, T., Bodi, K. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn-seq:+high-throughput+parallel+sequencing+for+fitness+and+genetic+interaction+studies+in+microorganisms.">Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms.</a> Nat. Methods. 6, 767-772 (2009).</li><li>Gagarinova, A., Emili, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+genetic+manipulation+methods+for+exploring+bacterial+molecular+biology.">Genome-scale genetic manipulation methods for exploring bacterial molecular biology.</a> Mol. Biosyst. 8, 1626-1638 (2012).</li><li>Dewey, C. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Positional+orthology:+putting+genomic+evolutionary+relationships+into+context.">Positional orthology: putting genomic evolutionary relationships into context.</a> Brief Bioinform. 12, 401-412 (2011).</li><li>St Onge, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+pathway+analysis+using+high-resolution+fitness+profiling+of+combinatorial+gene+deletions.">Systematic pathway analysis using high-resolution fitness profiling of combinatorial gene deletions.</a> Nat. Genet. 39, 199-206 (2007).</li></ol>

Nous avons établi un protocole étape par étape pour l&#39;utilisation de robotique de dépistage ESGA pour enquêter sur les fonctions des gènes bactériens à un niveau voie en interrogeant GI. Cette approche peut être utilisée pour étudier les gènes individuels ainsi que les systèmes biologiques entières dans E. coli. Attentivement l&#39;exécution des étapes expérimentales décrites ci-dessus, y compris tous les contrôles appropriés, et rigoureusement l&#39;analyse et la validation des données...

<table border="1" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>I. Antibiotics</td>
			<td>2</td>
			<td>36471 
			Remove</td>
		</tr>
		<tr>
			<td>Chloramphenicol</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#CLR201</td>
			<td>&nbsp;</td>
			<td>3</td>
			<td>36472 
			Remove</td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>#KAN201</td>
			<td>&nbsp;</td>
			<td>4</td>
			<td>36480 
			Remove</td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td># AMP201</td>
			<td>&nbsp;</td>
			<td>5</td>
			<td>36473 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>2. Luria-Bertani medium</td>
			<td>6</td>
			<td>36474 
			Remove</td>
		</tr>
		<tr>
			<td>LB powder</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#LBL405</td>
			<td>&nbsp;</td>
			<td>7</td>
			<td>36478 
			Remove</td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#AGR003</td>
			<td>&nbsp;</td>
			<td>8</td>
			<td>36481 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>3. Bacterial Strains and Plasmids</td>
			<td>9</td>
			<td>36475 
			Remove</td>
		</tr>
		<tr>
			<td>Hfr Cavalli strain &lambda;red system (JL238)</td>
			<td>&nbsp;</td>
			<td>Babu et al.14.</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>10</td>
			<td>36476 
			Remove</td>
		</tr>
		<tr>
			<td>pKD3</td>
			<td>&nbsp;</td>
			<td>E. coli Genetic Stock Centre, Yale</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>11</td>
			<td>36477 
			Remove</td>
		</tr>
		<tr>
			<td>Keio E. coli F- recipient collection</td>
			<td>&nbsp;</td>
			<td>National BioResource Project (NBRP) of Japan11</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>12</td>
			<td>36479 
			Remove</td>
		</tr>
		<tr>
			<td>Hypomorphic E. coli F- SPA-tag strains</td>
			<td>&nbsp;</td>
			<td>Open biosystems; Babu et al.14</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>13</td>
			<td>36491 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>4. Primers</td>
			<td>14</td>
			<td>36486 
			Remove</td>
		</tr>
		<tr>
			<td>pKD3-based desalted constant primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>F1: 5'-GGCTGACATGGGAATTAGC-3' 
			R1: 5'-AGATTGCAGCATTACACGTCTT-3'</td>
			<td>15</td>
			<td>36482 
			Remove</td>
		</tr>
		<tr>
			<td>Desalted custom primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>Cm-R: 5'-TTATACGCAAGGCGACAAGG-3' 
			Cm-F: 5'- GATCTTCCGTCACAGGTAGG-3'</td>
			<td>16</td>
			<td>36483 
			Remove</td>
		</tr>
		<tr>
			<td>Desalted custom primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions 
			F2 constant region: 
			5'-CATATGAATATCCTCCTTA-3' 
			R2 constant region: 
			5'-TGTGTAGGCTGGAGCTGCTTC-3'S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions 
			S1 constant region: 
			5'AGCTGGAGGATCCATGGAAAAGAGAAG -3' 
			S2 constant region: 
			5'- GGCCCCATATGAATATCCTCCTTAGTT -3' 
			 
			KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential 
			gene SPA-tag insertion site</td>
			<td>17</td>
			<td>36484 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>5. PCR and Electrophoresis Reagents</td>
			<td>18</td>
			<td>36485 
			Remove</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>19</td>
			<td>36487 
			Remove</td>
		</tr>
		<tr>
			<td>10X PCR buffer</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>20</td>
			<td>36488 
			Remove</td>
		</tr>
		<tr>
			<td>10 mM dNTPs</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>21</td>
			<td>36489 
			Remove</td>
		</tr>
		<tr>
			<td>25 mM MgCl2</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>22</td>
			<td>36490 
			Remove</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># AGA002</td>
			<td>&nbsp;</td>
			<td>23</td>
			<td>36492 
			Remove</td>
		</tr>
		<tr>
			<td>Loading dye</td>
			<td>&nbsp;</td>
			<td>NEB</td>
			<td>#B7021S</td>
			<td>&nbsp;</td>
			<td>24</td>
			<td>36493 
			Remove</td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># ETB444</td>
			<td>&nbsp;</td>
			<td>25</td>
			<td>36497 
			Remove</td>
		</tr>
		<tr>
			<td>10X TBE buffer</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># ETB444.10</td>
			<td>&nbsp;</td>
			<td>26</td>
			<td>36494 
			Remove</td>
		</tr>
		<tr>
			<td>Tris Base</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># TRS001</td>
			<td>&nbsp;</td>
			<td>27</td>
			<td>36495 
			Remove</td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td># T1503-1KG</td>
			<td>&nbsp;</td>
			<td>28</td>
			<td>36496 
			Remove</td>
		</tr>
		<tr>
			<td>0.5 M EDTA (pH 8.0)</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td># B6768-500G</td>
			<td>&nbsp;</td>
			<td>29</td>
			<td>36498 
			Remove</td>
		</tr>
		<tr>
			<td>DNA ladder</td>
			<td>&nbsp;</td>
			<td>NEB</td>
			<td>#N3232L</td>
			<td>&nbsp;</td>
			<td>30</td>
			<td>36499 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>6. DNA isolation and Clean-up Kits</td>
			<td>31</td>
			<td>36500 
			Remove</td>
		</tr>
		<tr>
			<td>Genomic DNA isolation and purification kit</td>
			<td>&nbsp;</td>
			<td>Promega</td>
			<td>#A1120</td>
			<td>&nbsp;</td>
			<td>32</td>
			<td>36501 
			Remove</td>
		</tr>
		<tr>
			<td>Plasmid Midi kit</td>
			<td>&nbsp;</td>
			<td>Qiagen</td>
			<td># 12143</td>
			<td>&nbsp;</td>
			<td>33</td>
			<td>36502 
			Remove</td>
		</tr>
		<tr>
			<td>QIAquick PCR purification kit</td>
			<td>&nbsp;</td>
			<td>Qiagen</td>
			<td>#28104</td>
			<td>&nbsp;</td>
			<td>34</td>
			<td>36512 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>7. Equipment for PCR, Transformation and Replica-pinning</td>
			<td>35</td>
			<td>36503 
			Remove</td>
		</tr>
		<tr>
			<td>Thermal cycler</td>
			<td>&nbsp;</td>
			<td>BioRad, iCycler</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>36</td>
			<td>36504 
			Remove</td>
		</tr>
		<tr>
			<td>Agarose gel electrophoresis</td>
			<td>&nbsp;</td>
			<td>BioRad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>37</td>
			<td>36505 
			Remove</td>
		</tr>
		<tr>
			<td>Electroporator</td>
			<td>&nbsp;</td>
			<td>Bio-Rad GenePulser II</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>38</td>
			<td>36506 
			Remove</td>
		</tr>
		<tr>
			<td>0.2 cm electroporation cuvette</td>
			<td>&nbsp;</td>
			<td>Bio-Rad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>39</td>
			<td>36507 
			Remove</td>
		</tr>
		<tr>
			<td>42 &deg;C water bath shaker</td>
			<td>&nbsp;</td>
			<td>Innova 3100</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>40</td>
			<td>36508 
			Remove</td>
		</tr>
		<tr>
			<td>Beckman Coulter TJ-25 centrifuge</td>
			<td>&nbsp;</td>
			<td>Beckman Coulter</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>41</td>
			<td>36519 
			Remove</td>
		</tr>
		<tr>
			<td>32 &deg;C shaker</td>
			<td>&nbsp;</td>
			<td>New Brunswick Scientific, USA</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>42</td>
			<td>36509 
			Remove</td>
		</tr>
		<tr>
			<td>32 &deg;C plate incubator</td>
			<td>&nbsp;</td>
			<td>Fisher Scientific</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>43</td>
			<td>36510 
			Remove</td>
		</tr>
		<tr>
			<td>RoToR-HDA benchtop robot</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>44</td>
			<td>36511 
			Remove</td>
		</tr>
		<tr>
			<td>96, 384 and 1,536 pin density pads</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>45</td>
			<td>36513 
			Remove</td>
		</tr>
		<tr>
			<td>96 or 384 long pins</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>46</td>
			<td>36514 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>8. Imaging Equipments</td>
			<td>47</td>
			<td>36515 
			Remove</td>
		</tr>
		<tr>
			<td>Camera stand</td>
			<td>&nbsp;</td>
			<td>Kaiser</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>48</td>
			<td>36516 
			Remove</td>
		</tr>
		<tr>
			<td>Digital camera, 10 megapixel</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>49</td>
			<td>36517 
			Remove</td>
		</tr>
		<tr>
			<td>Light boxes, Testrite 16" x 24" units</td>
			<td>&nbsp;</td>
			<td>Testrite</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>50</td>
			<td>36527 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>9. Pads or Plates Recycling </td>
			<td>51</td>
			<td>36518 
			Remove</td>
		</tr>
		<tr>
			<td>10% bleach</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>52</td>
			<td>36520 
			Remove</td>
		</tr>
		<tr>
			<td>70% ethanol</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>53</td>
			<td>36521 
			Remove</td>
		</tr>
		<tr>
			<td>Sterile distilled water</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>54</td>
			<td>36522 
			Remove</td>
		</tr>
		<tr>
			<td>Flow hood</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>55</td>
			<td>36523 
			Remove</td>
		</tr>
		<tr>
			<td>Ultraviolet lamp</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>56</td>
			<td>36524 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>10. Labware</td>
			<td>57</td>
			<td>36525 
			Remove</td>
		</tr>
		<tr>
			<td>50 ml polypropylene tubes</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>58</td>
			<td>36526 
			Remove</td>
		</tr>
		<tr>
			<td>1.5 ml micro-centrifuge tubes</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>59</td>
			<td>36528 
			Remove</td>
		</tr>
		<tr>
			<td>250 ml conical flaks</td>
			<td>&nbsp;</td>
			<td>VWR</td>
			<td># 29140-045</td>
			<td>&nbsp;</td>
			<td>60</td>
			<td>36529 
			Remove</td>
		</tr>
		<tr>
			<td>15 ml sterile culture tubes</td>
			<td>&nbsp;</td>
			<td>Thermo Scientific</td>
			<td># 366052</td>
			<td>&nbsp;</td>
			<td>61</td>
			<td>36530 
			Remove</td>
		</tr>
		<tr>
			<td>Cryogenic vials</td>
			<td>&nbsp;</td>
			<td>VWR</td>
			<td># 479-3221</td>
			<td>&nbsp;</td>
			<td>62</td>
			<td>36531 
			Remove</td>
		</tr>
		<tr>
			<td>Rectangular Plates</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>63</td>
			<td>36532 
			Remove</td>
		</tr>
		<tr>
			<td>96-well and 384-well microtitre plates</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>Nunc</td>
			<td>&nbsp;</td>
			<td>64</td>
			<td>36533 
			Remove</td>
		</tr>
		<tr>
			<td>Plate roller for sealing multi-well</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td>#R1275</td>
			<td>&nbsp;</td>
			<td>65</td>
			<td>36535 
			Remove</td>
		</tr>
		<tr>
			<td>plates</td>
			<td>&nbsp;</td>
			<td>ABgene</td>
			<td># AB-0580</td>
			<td>&nbsp;</td>
			<td>66</td>
			<td>36534 
			Remove</td>
		</tr>
		<tr>
			<td>Adhesive plate seals</td>
			<td>&nbsp;</td>
			<td>Fisher Scientific</td>
			<td># 13-990-14</td>
			<td>&nbsp;</td>
			<td>67</td>
			<td>36537 
			Remove</td>
		</tr>
		<tr>
			<td>-80 &deg;C freezer</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>68</td>
			<td>36536 
			Remove</td>
		</tr>
	</tbody>
</table>

mapping bacterial functional networks and pathways in escherichia coli using synthetic genetic arrays

Phénotypes sont déterminés par une série complexe de physique (par exemple protéine-protéine) et fonctionnelle (p. ex gène-gène ou génétique) des interactions (GI) 1. Alors que les interactions physiques peuvent indiquer quelles protéines bactériennes sont associées sous forme de complexes, ils ne révèlent pas nécessairement la voie au niveau relationships1 fonctionnels. Écrans GI, dans lequel la croissance des doubles mutants porteurs de deux gènes délétés ou inactivés est mesurée et comparée aux simples mutants correspondants, peut éclairer les dépendances entre les loci épistatiques et donc de fournir un moyen pour interroger et découvrir de nouveaux liens fonctionnels 2. Cartes à grande échelle GI ont été rapportés pour les organismes eucaryotes comme les levures 3-7, mais les informations restent rares IG pour les procaryotes 8, ce qui entrave l&#39;annotation fonctionnelle des génomes bactériens. À cette fin, nous et d&#39;autres avons développé à haut débit quantitatives bactériennes méthodes de dépistage GI 9, 10 </sup&gt;. Nous présentons ici les principales étapes requises pour effectuer quantitative E. coli synthétique procédure de dépistage génétique Array (ESGA) sur une échelle du génome 9, en utilisant la conjugaison bactérienne naturelle et la recombinaison homologue pour générer et systémique pour évaluer la justesse d&#39;un grand nombre de doubles mutants dans un format de tableau colonie. bref, un robot est utilisé pour transférer , grâce à la conjugaison, le chloramphénicol (Cm) - a marqué allèles mutants de Hfr ingénierie (haute fréquence de recombinaison) «souches donateurs dans un ensemble ordonné de kanamycine (Kan) - marqués F-bénéficiaires souches. Typiquement, nous utilisons la perte de fonction simples mutants portant des délétions de gènes non essentiels (par exemple, la collection «Keio &#39;11) et des mutations de gènes essentiels hypomorphes (allèles conférant à savoir l&#39;expression des protéines réduite, la stabilité ou l&#39;activité 9, 12, 13) interroger les associations fonctionnelles de gènes non essentiels et indispensables, respectivement. Après conjugaison et qui a suivi l&#39;échange génétique induite par recombinaison homologue, les mutants résultants doubles sont sélectionnés sur milieu solide contenant deux antibiotiques. Après conséquence, les plaques sont numériquement imagée et la taille des colonies sont quantitativement classé par un système interne automatisé de traitement d&#39;image 14. Les IG sont révélés lorsque le taux de croissance d&#39;un double mutant est soit significativement meilleure ou pire que 9 attendu. Aggravante (ou négative) des IG entraînent souvent entre la perte de fonction des mutations dans les gènes de paires de voies compensatoires qui empiètent sur ​​le même processus essentiel 2. Ici, la perte d&#39;un seul gène est tamponnée, de sorte que soit seul mutant est viable. Cependant, la perte des deux voies est délétère et les résultats de létalité synthétique ou de maladie (c.-à croissance lente). A l&#39;inverse, apaisantes (ou positif) des interactions entre les gènes peuvent se produire dans la même voie ou de protéines complexes 2 commedélétion de gène supporte seul est souvent suffisante pour perturber le fonctionnement normal de la voie ou complexes tels que des perturbations supplémentaires ne réduisent pas l&#39;activité, et donc la croissance, en outre. Dans l&#39;ensemble, l&#39;identification systématique et l&#39;analyse des réseaux IG peut fournir sans parti pris, des cartes mondiales des relations fonctionnelles entre un grand nombre de gènes, d&#39;où la voie au niveau de l&#39;information manquée par d&#39;autres approches peuvent être inférées 9.

GIs reveal functional relationships between genes. Similarly, since genes in the same pathway display similar GI patterns and the GI profile similarity represents the congruency of phenotypes, we can group functionally related genes into pathways by clustering their GI profiles. Integrating GI and GI correlation networks with physical interaction information or other association data, such as genomic context (GC) relationships can also reveal the organization of higher-order functional modules that define core bio...

Watch this Scientific Journal Video about Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays at JoVE.com

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Systématiques et à grande échelle de synthèse génétiques écrans d&#39;interaction gène-gène (ou épistasie) peut être utilisé pour explorer la redondance génétique et la voie de la diaphonie. Ici, nous décrivons un haut débit quantitatif synthétique de la technologie génétique de dépistage tableau, appelé ESGA que nous avons développé pour élucider les relations épistatiques et l&#39;exploration des réseaux d&#39;interactions génétiques<em&gt; Escherichia coli</em&gt;.

La cartographie des réseaux fonctionnels bactériens et voies de<em&gt; Escherichia Coli</em&gt; En utilisant des tableaux synthétiques génétiques

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

Research

JoVE Journal

Biology

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Light/dark Transition Test for Mice

Test de transition clair / foncé pour souris

Although all of the mouse genome sequences have been determined, we do not yet know the functions of most of these genes. Gene-targeting techniques, ...

Recherche

Biologie

How to Culture, Record and Stimulate Neuronal Networks on Micro-electrode Arrays (MEAs)

How to Culture, Record and Stimulate Neuronal Networks on Micro-electrode Arrays MEAs

Comment la culture, d&#39;enregistrement et stimuler les réseaux neuronaux sur les micro-électrodes Arrays (AME)

For the last century, many neuroscientists around the world have dedicated their lives to understanding how neuronal networks work and why they stop ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Protocoles de sélection mutagenèse et fonctionnelles pour l&#39;évolution dirigée de protéines dans les E. coli</em

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

Criblage à haut débit activité endoglucanase fongique dans les Escherichia coli</em

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted ...

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Identification des complexes protéiques dans<em&gt; Escherichia coli</em&gt; En utilisant séquentielle Purification par affinité peptide en combinaison avec la spectrométrie de masse en tandem

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the ...

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

Protocole rapide pour la préparation de électrocompétentes<em&gt; Escherichia coli</em&gt; Et<em&gt; Vibrio cholerae</em

Electroporation has become a widely used method for rapidly and efficiently introducing foreign DNA into a wide range of cells. Electrotransformation has ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Protocoles pour la mise en œuvre d&#39;un<em&gt; Escherichia coli</em&gt; Sur la base du système d&#39;expression cellulaire gratuit TX-TL pour la biologie synthétique

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

Détection de Live<em&gt; Escherichia coli</em&gt; O157: H7 par les cellules PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Green Fluorescent Protein base Expression dépistage des protéines membranaires dans<em&gt; Escherichia coli</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

Les avantages multiples de la protéine co-expression dans<em&gt; Escherichia coli</em

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in ...