Name: mapping bacterial functional networks and pathways in escherichia coli using synthetic genetic arrays
Uploaded: 2012-11-12T12:00:00
Description: Watch this Scientific Journal Video about Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays at JoVE.com

עבודה זו נתמכה על ידי קרנות מהגנום קנדה, מכון ג&#39;נומיקס אונטריו, והמכון הקנדי למענקי מחקר לבריאות JG ו AE AG הוא מקבל מלגת Vanier קנדה בוגר.

1. בניית זני Mutant תורם קוואלי HFR ידי Recombineering 15, 16 השלבים לבנייה את הכתמים התורמים eSGA מתוארים להלן. בקצרה, אנו משתמשים λ הממוקד - אדום מתווכים הומולוגי רקומבינציה 16 מתוך קלטת סמן מוגבר לבחירת ה-DNA שברים שנוצר על ידי ...

<ol>
	<li>Bandyopadhyay, S., Kelley, R., Krogan, N. J., Ideker, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+maps+of+protein+complexes+from+quantitative+genetic+interaction+data.">Functional maps of protein complexes from quantitative genetic interaction data.</a> PLoS Comput. Biol. 4, e1000065 (2008).</li><li>Costanzo, M., Baryshnikova, A., Myers, C. L., Andrews, B., Boone, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Charting+the+genetic+interaction+map+of+a+cell.">Charting the genetic interaction map of a cell.</a> Curr. Opin. Biotechnol. 22, 66-74 (2011).</li><li>Costanzo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genetic+landscape+of+a+cell.">The genetic landscape of a cell.</a> Science. 327, 425-4231 (2010).</li><li>Fiedler, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+organization+of+the+S.+cerevisiae+phosphorylation+network.">Functional organization of the S. cerevisiae phosphorylation network.</a> Cell. 136, 952-963 (2009).</li><li>Roguev, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservation+and+rewiring+of+functional+modules+revealed+by+an+epistasis+map+in+fission+yeast.">Conservation and rewiring of functional modules revealed by an epistasis map in fission yeast.</a> Science. 322, 405-4010 (2008).</li><li>Schuldiner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+function+and+organization+of+the+yeast+early+secretory+pathway+through+an+epistatic+miniarray+profile.">Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile.</a> Cell. 123, 507-519 (2005).</li><li>Wilmes, G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+interaction+map+of+RNA-processing+factors+reveals+links+between+Sem1/Dss1-containing+complexes+and+mRNA+export+and+splicing.">A genetic interaction map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and mRNA export and splicing.</a> Mol. Cell. 32, 735-746 (2008).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systems-level+approaches+for+identifying+and+analyzing+genetic+interaction+networks+in+Escherichia+coli+and+extensions+to+other+prokaryotes.">Systems-level approaches for identifying and analyzing genetic interaction networks in Escherichia coli and extensions to other prokaryotes.</a> Mol. Biosyst. 12, 1439-1455 (2009).</li><li>Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=coli+synthetic+genetic+array+analysis.">coli synthetic genetic array analysis.</a> Nat. Methods. 5, 789-7895 (2008).</li><li>Typas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+peptidoglycan+synthesis+by+outer-membrane+proteins.">Regulation of peptidoglycan synthesis by outer-membrane proteins.</a> Cell. 143, 1097-10109 (2010).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, 2006-200008 (2006).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+interaction+maps+in+Escherichia+coli+reveal+functional+crosstalk+among+cell+envelope+biogenesis+pathways.">Genetic interaction maps in Escherichia coli reveal functional crosstalk among cell envelope biogenesis pathways.</a> PLoS Genet. 7, e1002377 (2011).</li><li>Nichols, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phenotypic+landscape+of+a+bacterial+cell.">Phenotypic landscape of a bacterial cell.</a> Cell. 144, 143-156 (2011).</li><li>Babu, M., Gagarinova, A., Greenblatt, J., Emili, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-based+synthetic+genetic+screens+to+map+bacterial+pathways+and+functional+networks+in+Escherichia+coli.">Array-based synthetic genetic screens to map bacterial pathways and functional networks in Escherichia coli.</a> Methods Mol Biol. 765, 125-153 (2011).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-665 (2000).</li><li>Yu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+recombination+system+for+chromosome+engineering+in+Escherichia+coli.">An efficient recombination system for chromosome engineering in Escherichia coli.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).</li><li>Typas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=quantitative+analyses+of+genetic+interactions+in.">quantitative analyses of genetic interactions in.</a> E. coli. Nat. Methods. 5, 781-787 (2008).</li><li>Zeghouf, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+Peptide+Affinity+(SPA)+system+for+the+identification+of+mammalian+and+bacterial+protein+complexes.">Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes.</a> J. Proteome Res. 3, 463-468 (2004).</li><li>Davierwala, A. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> , 1147-1152 (2005).</li><li>Breslow, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+strategy+enabling+high-resolution+functional+analysis+of+the+yeast+genome.">A comprehensive strategy enabling high-resolution functional analysis of the yeast genome.</a> Nat. Methods. 5, 711-718 (2008).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+peptide+affinity+purification+system+for+the+systematic+isolation+and+identification+of+protein+complexes+from+Escherichia+coli.">Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli.</a> Methods Mol. Biol. 564, 373-400 (2009).</li><li>Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+network+containing+conserved+and+essential+protein+complexes+in+Escherichia+coli.">Interaction network containing conserved and essential protein complexes in Escherichia coli.</a> Nature. 433, 531-537 (2005).</li><li>Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+functional+atlas+of+Escherichia+coli+encompassing+previously+uncharacterized+proteins.">Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins.</a> PLoS Biol. 7, (2009).</li><li>Anderson, R. P., Roth, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+genetic+duplications+in+phage+and+bacteria.">Tandem genetic duplications in phage and bacteria.</a> Annu. Rev. Microbiol. 31, 473-505 (1977).</li><li>Boone, C., Bussey, H., Andrews, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+genetic+interactions+and+networks+with+yeast.">Exploring genetic interactions and networks with yeast.</a> Nat. Rev. Genet. 8, 437-449 (2007).</li><li>Collins, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+dissection+of+protein+complexes+involved+in+yeast+chromosome+biology+using+a+genetic+interaction+map.">Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map.</a> Nature. 446, 806-8010 (2007).</li><li>Le Meur, N., Gentleman, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+synthetic+lethality.">Modeling synthetic lethality.</a> Genome Biol. 9, R135 (2008).</li><li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+mapping+of+the+yeast+genetic+interaction+network.">Global mapping of the yeast genetic interaction network.</a> Science. 303, 808-813 (2004).</li><li>Wong, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combining+biological+networks+to+predict+genetic+interactions.">Combining biological networks to predict genetic interactions.</a> Proc. Natl. Acad. Sci. U.S.A. 101, 15682-15687 (2004).</li><li>van Opijnen, T., Bodi, K. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn-seq:+high-throughput+parallel+sequencing+for+fitness+and+genetic+interaction+studies+in+microorganisms.">Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms.</a> Nat. Methods. 6, 767-772 (2009).</li><li>Gagarinova, A., Emili, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+genetic+manipulation+methods+for+exploring+bacterial+molecular+biology.">Genome-scale genetic manipulation methods for exploring bacterial molecular biology.</a> Mol. Biosyst. 8, 1626-1638 (2012).</li><li>Dewey, C. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Positional+orthology:+putting+genomic+evolutionary+relationships+into+context.">Positional orthology: putting genomic evolutionary relationships into context.</a> Brief Bioinform. 12, 401-412 (2011).</li><li>St Onge, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+pathway+analysis+using+high-resolution+fitness+profiling+of+combinatorial+gene+deletions.">Systematic pathway analysis using high-resolution fitness profiling of combinatorial gene deletions.</a> Nat. Genet. 39, 199-206 (2007).</li></ol>

נציין פרוטוקול צעד חכם לשימוש בהקרנת eSGA רובוטית לחקור פונקציות גני חיידקים ברמת מסלול על ידי חוקר במערכת עיכול. גישה זו יכולה לשמש כדי לחקור גנים בודדים, כמו גם מערכות ביולוגיות שלמות בE. coli. זהירות ביצוע צעדי הניסוי שתוארו לעיל, כולל את כל הבקרות המתאימות, וקפדנו...

<table border="1" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>I. Antibiotics</td>
			<td>2</td>
			<td>36471 
			Remove</td>
		</tr>
		<tr>
			<td>Chloramphenicol</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#CLR201</td>
			<td>&nbsp;</td>
			<td>3</td>
			<td>36472 
			Remove</td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>#KAN201</td>
			<td>&nbsp;</td>
			<td>4</td>
			<td>36480 
			Remove</td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td># AMP201</td>
			<td>&nbsp;</td>
			<td>5</td>
			<td>36473 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>2. Luria-Bertani medium</td>
			<td>6</td>
			<td>36474 
			Remove</td>
		</tr>
		<tr>
			<td>LB powder</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#LBL405</td>
			<td>&nbsp;</td>
			<td>7</td>
			<td>36478 
			Remove</td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#AGR003</td>
			<td>&nbsp;</td>
			<td>8</td>
			<td>36481 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>3. Bacterial Strains and Plasmids</td>
			<td>9</td>
			<td>36475 
			Remove</td>
		</tr>
		<tr>
			<td>Hfr Cavalli strain &lambda;red system (JL238)</td>
			<td>&nbsp;</td>
			<td>Babu et al.14.</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>10</td>
			<td>36476 
			Remove</td>
		</tr>
		<tr>
			<td>pKD3</td>
			<td>&nbsp;</td>
			<td>E. coli Genetic Stock Centre, Yale</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>11</td>
			<td>36477 
			Remove</td>
		</tr>
		<tr>
			<td>Keio E. coli F- recipient collection</td>
			<td>&nbsp;</td>
			<td>National BioResource Project (NBRP) of Japan11</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>12</td>
			<td>36479 
			Remove</td>
		</tr>
		<tr>
			<td>Hypomorphic E. coli F- SPA-tag strains</td>
			<td>&nbsp;</td>
			<td>Open biosystems; Babu et al.14</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>13</td>
			<td>36491 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>4. Primers</td>
			<td>14</td>
			<td>36486 
			Remove</td>
		</tr>
		<tr>
			<td>pKD3-based desalted constant primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>F1: 5'-GGCTGACATGGGAATTAGC-3' 
			R1: 5'-AGATTGCAGCATTACACGTCTT-3'</td>
			<td>15</td>
			<td>36482 
			Remove</td>
		</tr>
		<tr>
			<td>Desalted custom primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>Cm-R: 5'-TTATACGCAAGGCGACAAGG-3' 
			Cm-F: 5'- GATCTTCCGTCACAGGTAGG-3'</td>
			<td>16</td>
			<td>36483 
			Remove</td>
		</tr>
		<tr>
			<td>Desalted custom primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions 
			F2 constant region: 
			5'-CATATGAATATCCTCCTTA-3' 
			R2 constant region: 
			5'-TGTGTAGGCTGGAGCTGCTTC-3'S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions 
			S1 constant region: 
			5'AGCTGGAGGATCCATGGAAAAGAGAAG -3' 
			S2 constant region: 
			5'- GGCCCCATATGAATATCCTCCTTAGTT -3' 
			 
			KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential 
			gene SPA-tag insertion site</td>
			<td>17</td>
			<td>36484 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>5. PCR and Electrophoresis Reagents</td>
			<td>18</td>
			<td>36485 
			Remove</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>19</td>
			<td>36487 
			Remove</td>
		</tr>
		<tr>
			<td>10X PCR buffer</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>20</td>
			<td>36488 
			Remove</td>
		</tr>
		<tr>
			<td>10 mM dNTPs</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>21</td>
			<td>36489 
			Remove</td>
		</tr>
		<tr>
			<td>25 mM MgCl2</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>22</td>
			<td>36490 
			Remove</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># AGA002</td>
			<td>&nbsp;</td>
			<td>23</td>
			<td>36492 
			Remove</td>
		</tr>
		<tr>
			<td>Loading dye</td>
			<td>&nbsp;</td>
			<td>NEB</td>
			<td>#B7021S</td>
			<td>&nbsp;</td>
			<td>24</td>
			<td>36493 
			Remove</td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># ETB444</td>
			<td>&nbsp;</td>
			<td>25</td>
			<td>36497 
			Remove</td>
		</tr>
		<tr>
			<td>10X TBE buffer</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># ETB444.10</td>
			<td>&nbsp;</td>
			<td>26</td>
			<td>36494 
			Remove</td>
		</tr>
		<tr>
			<td>Tris Base</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># TRS001</td>
			<td>&nbsp;</td>
			<td>27</td>
			<td>36495 
			Remove</td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td># T1503-1KG</td>
			<td>&nbsp;</td>
			<td>28</td>
			<td>36496 
			Remove</td>
		</tr>
		<tr>
			<td>0.5 M EDTA (pH 8.0)</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td># B6768-500G</td>
			<td>&nbsp;</td>
			<td>29</td>
			<td>36498 
			Remove</td>
		</tr>
		<tr>
			<td>DNA ladder</td>
			<td>&nbsp;</td>
			<td>NEB</td>
			<td>#N3232L</td>
			<td>&nbsp;</td>
			<td>30</td>
			<td>36499 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>6. DNA isolation and Clean-up Kits</td>
			<td>31</td>
			<td>36500 
			Remove</td>
		</tr>
		<tr>
			<td>Genomic DNA isolation and purification kit</td>
			<td>&nbsp;</td>
			<td>Promega</td>
			<td>#A1120</td>
			<td>&nbsp;</td>
			<td>32</td>
			<td>36501 
			Remove</td>
		</tr>
		<tr>
			<td>Plasmid Midi kit</td>
			<td>&nbsp;</td>
			<td>Qiagen</td>
			<td># 12143</td>
			<td>&nbsp;</td>
			<td>33</td>
			<td>36502 
			Remove</td>
		</tr>
		<tr>
			<td>QIAquick PCR purification kit</td>
			<td>&nbsp;</td>
			<td>Qiagen</td>
			<td>#28104</td>
			<td>&nbsp;</td>
			<td>34</td>
			<td>36512 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>7. Equipment for PCR, Transformation and Replica-pinning</td>
			<td>35</td>
			<td>36503 
			Remove</td>
		</tr>
		<tr>
			<td>Thermal cycler</td>
			<td>&nbsp;</td>
			<td>BioRad, iCycler</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>36</td>
			<td>36504 
			Remove</td>
		</tr>
		<tr>
			<td>Agarose gel electrophoresis</td>
			<td>&nbsp;</td>
			<td>BioRad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>37</td>
			<td>36505 
			Remove</td>
		</tr>
		<tr>
			<td>Electroporator</td>
			<td>&nbsp;</td>
			<td>Bio-Rad GenePulser II</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>38</td>
			<td>36506 
			Remove</td>
		</tr>
		<tr>
			<td>0.2 cm electroporation cuvette</td>
			<td>&nbsp;</td>
			<td>Bio-Rad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>39</td>
			<td>36507 
			Remove</td>
		</tr>
		<tr>
			<td>42 &deg;C water bath shaker</td>
			<td>&nbsp;</td>
			<td>Innova 3100</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>40</td>
			<td>36508 
			Remove</td>
		</tr>
		<tr>
			<td>Beckman Coulter TJ-25 centrifuge</td>
			<td>&nbsp;</td>
			<td>Beckman Coulter</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>41</td>
			<td>36519 
			Remove</td>
		</tr>
		<tr>
			<td>32 &deg;C shaker</td>
			<td>&nbsp;</td>
			<td>New Brunswick Scientific, USA</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>42</td>
			<td>36509 
			Remove</td>
		</tr>
		<tr>
			<td>32 &deg;C plate incubator</td>
			<td>&nbsp;</td>
			<td>Fisher Scientific</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>43</td>
			<td>36510 
			Remove</td>
		</tr>
		<tr>
			<td>RoToR-HDA benchtop robot</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>44</td>
			<td>36511 
			Remove</td>
		</tr>
		<tr>
			<td>96, 384 and 1,536 pin density pads</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>45</td>
			<td>36513 
			Remove</td>
		</tr>
		<tr>
			<td>96 or 384 long pins</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>46</td>
			<td>36514 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>8. Imaging Equipments</td>
			<td>47</td>
			<td>36515 
			Remove</td>
		</tr>
		<tr>
			<td>Camera stand</td>
			<td>&nbsp;</td>
			<td>Kaiser</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>48</td>
			<td>36516 
			Remove</td>
		</tr>
		<tr>
			<td>Digital camera, 10 megapixel</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>49</td>
			<td>36517 
			Remove</td>
		</tr>
		<tr>
			<td>Light boxes, Testrite 16" x 24" units</td>
			<td>&nbsp;</td>
			<td>Testrite</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>50</td>
			<td>36527 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>9. Pads or Plates Recycling </td>
			<td>51</td>
			<td>36518 
			Remove</td>
		</tr>
		<tr>
			<td>10% bleach</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>52</td>
			<td>36520 
			Remove</td>
		</tr>
		<tr>
			<td>70% ethanol</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>53</td>
			<td>36521 
			Remove</td>
		</tr>
		<tr>
			<td>Sterile distilled water</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>54</td>
			<td>36522 
			Remove</td>
		</tr>
		<tr>
			<td>Flow hood</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>55</td>
			<td>36523 
			Remove</td>
		</tr>
		<tr>
			<td>Ultraviolet lamp</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>56</td>
			<td>36524 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>10. Labware</td>
			<td>57</td>
			<td>36525 
			Remove</td>
		</tr>
		<tr>
			<td>50 ml polypropylene tubes</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>58</td>
			<td>36526 
			Remove</td>
		</tr>
		<tr>
			<td>1.5 ml micro-centrifuge tubes</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>59</td>
			<td>36528 
			Remove</td>
		</tr>
		<tr>
			<td>250 ml conical flaks</td>
			<td>&nbsp;</td>
			<td>VWR</td>
			<td># 29140-045</td>
			<td>&nbsp;</td>
			<td>60</td>
			<td>36529 
			Remove</td>
		</tr>
		<tr>
			<td>15 ml sterile culture tubes</td>
			<td>&nbsp;</td>
			<td>Thermo Scientific</td>
			<td># 366052</td>
			<td>&nbsp;</td>
			<td>61</td>
			<td>36530 
			Remove</td>
		</tr>
		<tr>
			<td>Cryogenic vials</td>
			<td>&nbsp;</td>
			<td>VWR</td>
			<td># 479-3221</td>
			<td>&nbsp;</td>
			<td>62</td>
			<td>36531 
			Remove</td>
		</tr>
		<tr>
			<td>Rectangular Plates</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>63</td>
			<td>36532 
			Remove</td>
		</tr>
		<tr>
			<td>96-well and 384-well microtitre plates</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>Nunc</td>
			<td>&nbsp;</td>
			<td>64</td>
			<td>36533 
			Remove</td>
		</tr>
		<tr>
			<td>Plate roller for sealing multi-well</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td>#R1275</td>
			<td>&nbsp;</td>
			<td>65</td>
			<td>36535 
			Remove</td>
		</tr>
		<tr>
			<td>plates</td>
			<td>&nbsp;</td>
			<td>ABgene</td>
			<td># AB-0580</td>
			<td>&nbsp;</td>
			<td>66</td>
			<td>36534 
			Remove</td>
		</tr>
		<tr>
			<td>Adhesive plate seals</td>
			<td>&nbsp;</td>
			<td>Fisher Scientific</td>
			<td># 13-990-14</td>
			<td>&nbsp;</td>
			<td>67</td>
			<td>36537 
			Remove</td>
		</tr>
		<tr>
			<td>-80 &deg;C freezer</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>68</td>
			<td>36536 
			Remove</td>
		</tr>
	</tbody>
</table>

mapping bacterial functional networks and pathways in escherichia coli using synthetic genetic arrays

פנוטיפים נקבעים על ידי סדרה מורכבת של אינטראקציות פיסיות (בין חלבונים לדוגמה) ופונקציונליות (גני גן או גנטי לדוגמה) (GI) 1. בעוד אינטראקציות פיסיות יכולות להעיד שחלבונים חיידקיים משויכים כמתחמים, שהם לא בהכרח לחשוף relationships1 הפונקציונלי מסלול ברמה. מסכי מערכת עיכול, שבו הצמיחה של מוטנטים כפולים, ושני גנים שנמחקו או מומתים נמדדה והשוואה למוטנטים הבודדים המתאימים, יכולים להאיר תלות epistatic בין לוקוסים ומכאן לספק אמצעים לשאילתה ולגלות קשרים פונקציונליים חדשים 2. מפות GI בקנה מידה גדולה כבר דיווחו לאורגניזמים האיקריוטים כמו שמרים 3-7, אך מידע GI נותר דליל לפרוקריוטים 8, אשר מעכב את הביאור הפונקציונלי של הגנום של חיידקים. לשם כך, אנחנו ואחרים פתחנו שיטות תפוקה גבוהה כמותיים חיידקים במערכת עיכול הקרנה 9, 10 </sup&gt;. כאן, אנו מציגים את השלבים העיקריים הנדרשים לביצוע ה כמותית coli מערך הליך סינטטי גנטי (eSGA) הקרנה על הגנום בהיקף 9, תוך שימוש בנטייה טבעית חיידקים והומולוגיים רקומבינציה המערכתית כדי להפיק ולמדוד את הכושר של מספר גדול של מוטציות כפולות בפורמט מערך מושבה. בקצרה, רובוט משמש להעברה , דרך הצמידה chloramphenicol (CM) - מסומן אללים מוטנטים מHFR המהונדס (תדירות גבוהה של רקומבינציה) &#39;זנים תורמים&#39; למערך מסודר של kanamycin (קאן) - זנים מסומנים F-נמענים. בדרך כלל, אנחנו משתמשים במוטציות אובדן של פונקציה בודדות נושא מחיקות גנים שאינם חיוניות (למשל, האוסף &#39;קיו&#39; 11) ומוטציות גנטיות hypomorphic חיוניות (כלומר האללים מקנים ביטוי מופחת חלבון, יציבות, או פעילות 9, 12, 13) כדי שאילתא העמותות הפונקציונליות של גנים שאינם חיוניים והכרחיים, מילpectively. לאחר הצמיד ותיווך חילופים גנטי שהתפתח על ידי הומולוגי רקומבינציה, המוטציות הכפולות כתוצאה מכך הם נבחרו על המצע מוצק המכיל גם אנטיביוטיקה. לאחר תולדה, הצלחות הם צלמו באופן דיגיטלי וגדלי מושבת כמותית מקבלים נקודות באמצעות מערכת בבית אוטומטית עיבוד תמונת 14. החיילים אמריקאים מתגלים כאשר שיעור הצמיחה של מוטציה כפולה הוא גם באופן משמעותי טוב יותר או גרוע יותר מצפויים 9. חיילים אמריקאים מחמירים (או שלילי) לעתים קרובות תוצאה בין מוטציות אובדן של פונקציה בזוגות של גנים ממסלולי פיצוי התלויים באותו התהליך החיוני 2. הנה, אובדנו של גן יחיד נאגר, כך שגם מוטציה אחת היא בת קיימא. עם זאת, ההפסד של שני המסלולים הוא מזיק ותוצאות בהקטלניות או מחלה סינטטיות (כלומר צמיחה איטית). לעומת זאת, אינטראקציות הקלה (או חיובי) יכולות להתרחש בין גנים באותו מסלול או חלבון מורכב 2 כמומחיקה של שני הגנים בלבד היא לעתים קרובות מספיק כדי לטרוד את התפקוד התקין של המסלול או המורכב כגון הפרעות נוספות שלא לצמצם את הפעילות, ולכן צמיחה, נוספת. בסך הכל, באופן שיטתי זיהוי וניתוח רשתות GI יכול לספק מפות משוחדות, גלובליות של קשרים הפונקציונליים בין מספר הגדול של גנים, שממנו מידע מסלול ברמה החמיץ ידי גישות אחרות ניתן להסיק 9.

GIs reveal functional relationships between genes. Similarly, since genes in the same pathway display similar GI patterns and the GI profile similarity represents the congruency of phenotypes, we can group functionally related genes into pathways by clustering their GI profiles. Integrating GI and GI correlation networks with physical interaction information or other association data, such as genomic context (GC) relationships can also reveal the organization of higher-order functional modules that define core bio...

Watch this Scientific Journal Video about Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays at JoVE.com

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

(גני גן או epistasis) מסכים שיטתיים, בקנה מידה גדול סינטטיים גנטיים אינטראקציה יכולים לשמש כדי לחקור יתירות ומסלול-הצטלבות גנטית. כאן, אנו מתארים טכנולוגית תפוקה גבוהה כמותית סינטתית גנטית מערך הקרנה, כינת eSGA שפתחנו להבהרת יחסי epistatic ולחקור רשתות אינטראקציה גנטיות ב<em&gt; חיידקי Escherichia</em&gt;.

מיפוי רשתות פונקציונליות חיידקיים ומסלולים ב<em&gt; חיידקי Escherichia</em&gt; באמצעות מערכים גנטיים סינטטיים

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

Research

JoVE Journal

Biology

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Light/dark Transition Test for Mice

אור / חושך מעבר מבחן עכברים

Although all of the mouse genome sequences have been determined, we do not yet know the functions of most of these genes. Gene-targeting techniques, ...

How to Culture, Record and Stimulate Neuronal Networks on Micro-electrode Arrays (MEAs)

How to Culture, Record and Stimulate Neuronal Networks on Micro-electrode Arrays MEAs

איך להקליט התרבות לעידוד רשתות נוירונים על מיקרו אלקטרודה מערכים (MEAs)

For the last century, many neuroscientists around the world have dedicated their lives to understanding how neuronal networks work and why they stop ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

בחירת הפרוטוקולים mutagenesis ו פונקציונאלי אבולוציה מכוונת של חלבונים א coli</em

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

הקרנת תפוקה גבוהה של פעילות Endoglucanase פטרייתיים ב Escherichia coli</em

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted ...

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

זיהוי של קומפלקסי חלבונים ב<em&gt; חיידקי Escherichia</em&gt; באמצעות טיהור זיקת פפטיד סדרתית בשילוב עם טנדם המוני ספקטרומטריית

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the ...

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

ראפיד פרוטוקול להכנת Electrocompetent<em&gt; חיידקי Escherichia</em&gt; ו<em&gt; Vibrio cholerae</em

Electroporation has become a widely used method for rapidly and efficiently introducing foreign DNA into a wide range of cells. Electrotransformation has ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

פרוטוקולים ליישום<em&gt; חיידקי Escherichia</emמערכת&gt; בהתבסס TX-TL סלולרי ללא ביטוי של ביולוגיה סינתטית

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

איתור של שידור חי<em&gt; חיידקי Escherichia</em&gt; O157: H7 תאים על ידי PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

הקרנה ירוקה פלורסנט מבוסס חלבון ביטוי של החלבונים ממברנה ב<em&gt; Coli Escherichia</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

תועלת רבה פנים של Co-ביטוי חלבון ב<em&gt; Coli Escherichia</em

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in ...