Name: mapping bacterial functional networks and pathways in escherichia coli using synthetic genetic arrays
Uploaded: 2012-11-12T12:00:00
Description: Watch this Scientific Journal Video about Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays at JoVE.com

Questo lavoro è stato sostenuto da fondi del Genome Canada, l&#39;Ontario Institute Genomica e Istituti canadesi di borse di ricerca per la salute e JG AE AG è un destinatario della borsa di studio Vanier Canada Graduate.

1. Costruire HFR ceppi donatori Mutant Cavalli da Recombineering 15, 16 I passi per costruire le macchie donatori eSGA sono descritti di seguito. In breve, usiamo λ mirata - Red mediata ricombinazione omologa 16 di cassette amplificato marcatore selezionabile frammenti di DNA generati da PCR per creare non essenziali mutanti di delezione del gene (punto 1.1) o di geni essenziali ceppi mutanti hypomorphic donatori (paragrafo 1.2), che vengono poi utilizza...

<ol>
	<li>Bandyopadhyay, S., Kelley, R., Krogan, N. J., Ideker, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+maps+of+protein+complexes+from+quantitative+genetic+interaction+data.">Functional maps of protein complexes from quantitative genetic interaction data.</a> PLoS Comput. Biol. 4, e1000065 (2008).</li><li>Costanzo, M., Baryshnikova, A., Myers, C. L., Andrews, B., Boone, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Charting+the+genetic+interaction+map+of+a+cell.">Charting the genetic interaction map of a cell.</a> Curr. Opin. Biotechnol. 22, 66-74 (2011).</li><li>Costanzo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genetic+landscape+of+a+cell.">The genetic landscape of a cell.</a> Science. 327, 425-4231 (2010).</li><li>Fiedler, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+organization+of+the+S.+cerevisiae+phosphorylation+network.">Functional organization of the S. cerevisiae phosphorylation network.</a> Cell. 136, 952-963 (2009).</li><li>Roguev, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservation+and+rewiring+of+functional+modules+revealed+by+an+epistasis+map+in+fission+yeast.">Conservation and rewiring of functional modules revealed by an epistasis map in fission yeast.</a> Science. 322, 405-4010 (2008).</li><li>Schuldiner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploration+of+the+function+and+organization+of+the+yeast+early+secretory+pathway+through+an+epistatic+miniarray+profile.">Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile.</a> Cell. 123, 507-519 (2005).</li><li>Wilmes, G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+interaction+map+of+RNA-processing+factors+reveals+links+between+Sem1/Dss1-containing+complexes+and+mRNA+export+and+splicing.">A genetic interaction map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and mRNA export and splicing.</a> Mol. Cell. 32, 735-746 (2008).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systems-level+approaches+for+identifying+and+analyzing+genetic+interaction+networks+in+Escherichia+coli+and+extensions+to+other+prokaryotes.">Systems-level approaches for identifying and analyzing genetic interaction networks in Escherichia coli and extensions to other prokaryotes.</a> Mol. Biosyst. 12, 1439-1455 (2009).</li><li>Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=coli+synthetic+genetic+array+analysis.">coli synthetic genetic array analysis.</a> Nat. Methods. 5, 789-7895 (2008).</li><li>Typas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+peptidoglycan+synthesis+by+outer-membrane+proteins.">Regulation of peptidoglycan synthesis by outer-membrane proteins.</a> Cell. 143, 1097-10109 (2010).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, 2006-200008 (2006).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+interaction+maps+in+Escherichia+coli+reveal+functional+crosstalk+among+cell+envelope+biogenesis+pathways.">Genetic interaction maps in Escherichia coli reveal functional crosstalk among cell envelope biogenesis pathways.</a> PLoS Genet. 7, e1002377 (2011).</li><li>Nichols, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phenotypic+landscape+of+a+bacterial+cell.">Phenotypic landscape of a bacterial cell.</a> Cell. 144, 143-156 (2011).</li><li>Babu, M., Gagarinova, A., Greenblatt, J., Emili, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-based+synthetic+genetic+screens+to+map+bacterial+pathways+and+functional+networks+in+Escherichia+coli.">Array-based synthetic genetic screens to map bacterial pathways and functional networks in Escherichia coli.</a> Methods Mol Biol. 765, 125-153 (2011).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-665 (2000).</li><li>Yu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+recombination+system+for+chromosome+engineering+in+Escherichia+coli.">An efficient recombination system for chromosome engineering in Escherichia coli.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).</li><li>Typas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=quantitative+analyses+of+genetic+interactions+in.">quantitative analyses of genetic interactions in.</a> E. coli. Nat. Methods. 5, 781-787 (2008).</li><li>Zeghouf, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+Peptide+Affinity+(SPA)+system+for+the+identification+of+mammalian+and+bacterial+protein+complexes.">Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes.</a> J. Proteome Res. 3, 463-468 (2004).</li><li>Davierwala, A. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> , 1147-1152 (2005).</li><li>Breslow, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+strategy+enabling+high-resolution+functional+analysis+of+the+yeast+genome.">A comprehensive strategy enabling high-resolution functional analysis of the yeast genome.</a> Nat. Methods. 5, 711-718 (2008).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+peptide+affinity+purification+system+for+the+systematic+isolation+and+identification+of+protein+complexes+from+Escherichia+coli.">Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli.</a> Methods Mol. Biol. 564, 373-400 (2009).</li><li>Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+network+containing+conserved+and+essential+protein+complexes+in+Escherichia+coli.">Interaction network containing conserved and essential protein complexes in Escherichia coli.</a> Nature. 433, 531-537 (2005).</li><li>Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+functional+atlas+of+Escherichia+coli+encompassing+previously+uncharacterized+proteins.">Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins.</a> PLoS Biol. 7, (2009).</li><li>Anderson, R. P., Roth, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+genetic+duplications+in+phage+and+bacteria.">Tandem genetic duplications in phage and bacteria.</a> Annu. Rev. Microbiol. 31, 473-505 (1977).</li><li>Boone, C., Bussey, H., Andrews, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+genetic+interactions+and+networks+with+yeast.">Exploring genetic interactions and networks with yeast.</a> Nat. Rev. Genet. 8, 437-449 (2007).</li><li>Collins, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+dissection+of+protein+complexes+involved+in+yeast+chromosome+biology+using+a+genetic+interaction+map.">Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map.</a> Nature. 446, 806-8010 (2007).</li><li>Le Meur, N., Gentleman, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+synthetic+lethality.">Modeling synthetic lethality.</a> Genome Biol. 9, R135 (2008).</li><li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science. 294, 2364-2368 (2001).</li><li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+mapping+of+the+yeast+genetic+interaction+network.">Global mapping of the yeast genetic interaction network.</a> Science. 303, 808-813 (2004).</li><li>Wong, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combining+biological+networks+to+predict+genetic+interactions.">Combining biological networks to predict genetic interactions.</a> Proc. Natl. Acad. Sci. U.S.A. 101, 15682-15687 (2004).</li><li>van Opijnen, T., Bodi, K. L., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn-seq:+high-throughput+parallel+sequencing+for+fitness+and+genetic+interaction+studies+in+microorganisms.">Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms.</a> Nat. Methods. 6, 767-772 (2009).</li><li>Gagarinova, A., Emili, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+genetic+manipulation+methods+for+exploring+bacterial+molecular+biology.">Genome-scale genetic manipulation methods for exploring bacterial molecular biology.</a> Mol. Biosyst. 8, 1626-1638 (2012).</li><li>Dewey, C. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Positional+orthology:+putting+genomic+evolutionary+relationships+into+context.">Positional orthology: putting genomic evolutionary relationships into context.</a> Brief Bioinform. 12, 401-412 (2011).</li><li>St Onge, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+pathway+analysis+using+high-resolution+fitness+profiling+of+combinatorial+gene+deletions.">Systematic pathway analysis using high-resolution fitness profiling of combinatorial gene deletions.</a> Nat. Genet. 39, 199-206 (2007).</li></ol>

Abbiamo delineato un graduale protocollo per l&#39;utilizzo di robot per studiare lo screening eSGA funzioni geniche batteriche a livello percorso interrogando GI. Questo approccio può essere utilizzato per studiare singoli geni sia interi sistemi biologici in E. coli. Cura l&#39;esecuzione delle fasi sperimentali di cui sopra, tra cui tutti i controlli del caso, e rigorosamente in maniera indipendente l&#39;analisi e la validazione dei dati GI sono aspetti chiave per il successo di eSGA nel fare nuove scopert...

<table border="1" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>I. Antibiotics</td>
			<td>2</td>
			<td>36471 
			Remove</td>
		</tr>
		<tr>
			<td>Chloramphenicol</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#CLR201</td>
			<td>&nbsp;</td>
			<td>3</td>
			<td>36472 
			Remove</td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>#KAN201</td>
			<td>&nbsp;</td>
			<td>4</td>
			<td>36480 
			Remove</td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td># AMP201</td>
			<td>&nbsp;</td>
			<td>5</td>
			<td>36473 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>2. Luria-Bertani medium</td>
			<td>6</td>
			<td>36474 
			Remove</td>
		</tr>
		<tr>
			<td>LB powder</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#LBL405</td>
			<td>&nbsp;</td>
			<td>7</td>
			<td>36478 
			Remove</td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td>#AGR003</td>
			<td>&nbsp;</td>
			<td>8</td>
			<td>36481 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>3. Bacterial Strains and Plasmids</td>
			<td>9</td>
			<td>36475 
			Remove</td>
		</tr>
		<tr>
			<td>Hfr Cavalli strain &lambda;red system (JL238)</td>
			<td>&nbsp;</td>
			<td>Babu et al.14.</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>10</td>
			<td>36476 
			Remove</td>
		</tr>
		<tr>
			<td>pKD3</td>
			<td>&nbsp;</td>
			<td>E. coli Genetic Stock Centre, Yale</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>11</td>
			<td>36477 
			Remove</td>
		</tr>
		<tr>
			<td>Keio E. coli F- recipient collection</td>
			<td>&nbsp;</td>
			<td>National BioResource Project (NBRP) of Japan11</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>12</td>
			<td>36479 
			Remove</td>
		</tr>
		<tr>
			<td>Hypomorphic E. coli F- SPA-tag strains</td>
			<td>&nbsp;</td>
			<td>Open biosystems; Babu et al.14</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>13</td>
			<td>36491 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>4. Primers</td>
			<td>14</td>
			<td>36486 
			Remove</td>
		</tr>
		<tr>
			<td>pKD3-based desalted constant primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>F1: 5'-GGCTGACATGGGAATTAGC-3' 
			R1: 5'-AGATTGCAGCATTACACGTCTT-3'</td>
			<td>15</td>
			<td>36482 
			Remove</td>
		</tr>
		<tr>
			<td>Desalted custom primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>Cm-R: 5'-TTATACGCAAGGCGACAAGG-3' 
			Cm-F: 5'- GATCTTCCGTCACAGGTAGG-3'</td>
			<td>16</td>
			<td>36483 
			Remove</td>
		</tr>
		<tr>
			<td>Desalted custom primers</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions 
			F2 constant region: 
			5'-CATATGAATATCCTCCTTA-3' 
			R2 constant region: 
			5'-TGTGTAGGCTGGAGCTGCTTC-3'S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions 
			S1 constant region: 
			5'AGCTGGAGGATCCATGGAAAAGAGAAG -3' 
			S2 constant region: 
			5'- GGCCCCATATGAATATCCTCCTTAGTT -3' 
			 
			KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential 
			gene SPA-tag insertion site</td>
			<td>17</td>
			<td>36484 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>5. PCR and Electrophoresis Reagents</td>
			<td>18</td>
			<td>36485 
			Remove</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>19</td>
			<td>36487 
			Remove</td>
		</tr>
		<tr>
			<td>10X PCR buffer</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>20</td>
			<td>36488 
			Remove</td>
		</tr>
		<tr>
			<td>10 mM dNTPs</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>21</td>
			<td>36489 
			Remove</td>
		</tr>
		<tr>
			<td>25 mM MgCl2</td>
			<td>&nbsp;</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
			<td>22</td>
			<td>36490 
			Remove</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># AGA002</td>
			<td>&nbsp;</td>
			<td>23</td>
			<td>36492 
			Remove</td>
		</tr>
		<tr>
			<td>Loading dye</td>
			<td>&nbsp;</td>
			<td>NEB</td>
			<td>#B7021S</td>
			<td>&nbsp;</td>
			<td>24</td>
			<td>36493 
			Remove</td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># ETB444</td>
			<td>&nbsp;</td>
			<td>25</td>
			<td>36497 
			Remove</td>
		</tr>
		<tr>
			<td>10X TBE buffer</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># ETB444.10</td>
			<td>&nbsp;</td>
			<td>26</td>
			<td>36494 
			Remove</td>
		</tr>
		<tr>
			<td>Tris Base</td>
			<td>&nbsp;</td>
			<td>Bioshop</td>
			<td># TRS001</td>
			<td>&nbsp;</td>
			<td>27</td>
			<td>36495 
			Remove</td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td># T1503-1KG</td>
			<td>&nbsp;</td>
			<td>28</td>
			<td>36496 
			Remove</td>
		</tr>
		<tr>
			<td>0.5 M EDTA (pH 8.0)</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td># B6768-500G</td>
			<td>&nbsp;</td>
			<td>29</td>
			<td>36498 
			Remove</td>
		</tr>
		<tr>
			<td>DNA ladder</td>
			<td>&nbsp;</td>
			<td>NEB</td>
			<td>#N3232L</td>
			<td>&nbsp;</td>
			<td>30</td>
			<td>36499 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>6. DNA isolation and Clean-up Kits</td>
			<td>31</td>
			<td>36500 
			Remove</td>
		</tr>
		<tr>
			<td>Genomic DNA isolation and purification kit</td>
			<td>&nbsp;</td>
			<td>Promega</td>
			<td>#A1120</td>
			<td>&nbsp;</td>
			<td>32</td>
			<td>36501 
			Remove</td>
		</tr>
		<tr>
			<td>Plasmid Midi kit</td>
			<td>&nbsp;</td>
			<td>Qiagen</td>
			<td># 12143</td>
			<td>&nbsp;</td>
			<td>33</td>
			<td>36502 
			Remove</td>
		</tr>
		<tr>
			<td>QIAquick PCR purification kit</td>
			<td>&nbsp;</td>
			<td>Qiagen</td>
			<td>#28104</td>
			<td>&nbsp;</td>
			<td>34</td>
			<td>36512 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>7. Equipment for PCR, Transformation and Replica-pinning</td>
			<td>35</td>
			<td>36503 
			Remove</td>
		</tr>
		<tr>
			<td>Thermal cycler</td>
			<td>&nbsp;</td>
			<td>BioRad, iCycler</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>36</td>
			<td>36504 
			Remove</td>
		</tr>
		<tr>
			<td>Agarose gel electrophoresis</td>
			<td>&nbsp;</td>
			<td>BioRad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>37</td>
			<td>36505 
			Remove</td>
		</tr>
		<tr>
			<td>Electroporator</td>
			<td>&nbsp;</td>
			<td>Bio-Rad GenePulser II</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>38</td>
			<td>36506 
			Remove</td>
		</tr>
		<tr>
			<td>0.2 cm electroporation cuvette</td>
			<td>&nbsp;</td>
			<td>Bio-Rad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>39</td>
			<td>36507 
			Remove</td>
		</tr>
		<tr>
			<td>42 &deg;C water bath shaker</td>
			<td>&nbsp;</td>
			<td>Innova 3100</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>40</td>
			<td>36508 
			Remove</td>
		</tr>
		<tr>
			<td>Beckman Coulter TJ-25 centrifuge</td>
			<td>&nbsp;</td>
			<td>Beckman Coulter</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>41</td>
			<td>36519 
			Remove</td>
		</tr>
		<tr>
			<td>32 &deg;C shaker</td>
			<td>&nbsp;</td>
			<td>New Brunswick Scientific, USA</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>42</td>
			<td>36509 
			Remove</td>
		</tr>
		<tr>
			<td>32 &deg;C plate incubator</td>
			<td>&nbsp;</td>
			<td>Fisher Scientific</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>43</td>
			<td>36510 
			Remove</td>
		</tr>
		<tr>
			<td>RoToR-HDA benchtop robot</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>44</td>
			<td>36511 
			Remove</td>
		</tr>
		<tr>
			<td>96, 384 and 1,536 pin density pads</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>45</td>
			<td>36513 
			Remove</td>
		</tr>
		<tr>
			<td>96 or 384 long pins</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>46</td>
			<td>36514 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>8. Imaging Equipments</td>
			<td>47</td>
			<td>36515 
			Remove</td>
		</tr>
		<tr>
			<td>Camera stand</td>
			<td>&nbsp;</td>
			<td>Kaiser</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>48</td>
			<td>36516 
			Remove</td>
		</tr>
		<tr>
			<td>Digital camera, 10 megapixel</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>49</td>
			<td>36517 
			Remove</td>
		</tr>
		<tr>
			<td>Light boxes, Testrite 16" x 24" units</td>
			<td>&nbsp;</td>
			<td>Testrite</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>50</td>
			<td>36527 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>9. Pads or Plates Recycling </td>
			<td>51</td>
			<td>36518 
			Remove</td>
		</tr>
		<tr>
			<td>10% bleach</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>52</td>
			<td>36520 
			Remove</td>
		</tr>
		<tr>
			<td>70% ethanol</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>53</td>
			<td>36521 
			Remove</td>
		</tr>
		<tr>
			<td>Sterile distilled water</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>54</td>
			<td>36522 
			Remove</td>
		</tr>
		<tr>
			<td>Flow hood</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>55</td>
			<td>36523 
			Remove</td>
		</tr>
		<tr>
			<td>Ultraviolet lamp</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>56</td>
			<td>36524 
			Remove</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>10. Labware</td>
			<td>57</td>
			<td>36525 
			Remove</td>
		</tr>
		<tr>
			<td>50 ml polypropylene tubes</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>58</td>
			<td>36526 
			Remove</td>
		</tr>
		<tr>
			<td>1.5 ml micro-centrifuge tubes</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>59</td>
			<td>36528 
			Remove</td>
		</tr>
		<tr>
			<td>250 ml conical flaks</td>
			<td>&nbsp;</td>
			<td>VWR</td>
			<td># 29140-045</td>
			<td>&nbsp;</td>
			<td>60</td>
			<td>36529 
			Remove</td>
		</tr>
		<tr>
			<td>15 ml sterile culture tubes</td>
			<td>&nbsp;</td>
			<td>Thermo Scientific</td>
			<td># 366052</td>
			<td>&nbsp;</td>
			<td>61</td>
			<td>36530 
			Remove</td>
		</tr>
		<tr>
			<td>Cryogenic vials</td>
			<td>&nbsp;</td>
			<td>VWR</td>
			<td># 479-3221</td>
			<td>&nbsp;</td>
			<td>62</td>
			<td>36531 
			Remove</td>
		</tr>
		<tr>
			<td>Rectangular Plates</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>63</td>
			<td>36532 
			Remove</td>
		</tr>
		<tr>
			<td>96-well and 384-well microtitre plates</td>
			<td>&nbsp;</td>
			<td>Singer Instruments</td>
			<td>Nunc</td>
			<td>&nbsp;</td>
			<td>64</td>
			<td>36533 
			Remove</td>
		</tr>
		<tr>
			<td>Plate roller for sealing multi-well</td>
			<td>&nbsp;</td>
			<td>Sigma</td>
			<td>#R1275</td>
			<td>&nbsp;</td>
			<td>65</td>
			<td>36535 
			Remove</td>
		</tr>
		<tr>
			<td>plates</td>
			<td>&nbsp;</td>
			<td>ABgene</td>
			<td># AB-0580</td>
			<td>&nbsp;</td>
			<td>66</td>
			<td>36534 
			Remove</td>
		</tr>
		<tr>
			<td>Adhesive plate seals</td>
			<td>&nbsp;</td>
			<td>Fisher Scientific</td>
			<td># 13-990-14</td>
			<td>&nbsp;</td>
			<td>67</td>
			<td>36537 
			Remove</td>
		</tr>
		<tr>
			<td>-80 &deg;C freezer</td>
			<td>&nbsp;</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>68</td>
			<td>36536 
			Remove</td>
		</tr>
	</tbody>
</table>

mapping bacterial functional networks and pathways in escherichia coli using synthetic genetic arrays

Fenotipi sono determinati da una serie complessa di fisica (ad esempio proteina-proteina) e funzionali (ad esempio gene-gene o genetico) interazioni (GI) 1. Mentre interazioni fisiche in grado di indicare quali proteine ​​batteriche sono associati come complessi, non necessariamente rivelano percorso a livello di relationships1 funzionali. GI schermi, in cui si misura la crescita dei doppi mutanti recanti due geni cancellati o inattivato e rispetto ai corrispondenti singoli mutanti, in grado di illuminare le dipendenze epistatiche tra loci e, quindi, fornire un mezzo per interrogare e scoprire nuove relazioni funzionali 2. Mappe a grande scala GI sono stati riportati per gli organismi eucarioti, come lievito 3-7, ma le informazioni GI rimangono sparse per procarioti 8, che ostacola l&#39;annotazione funzionale dei genomi batterici. A tal fine, noi e altri hanno sviluppato high-throughput quantitative batteriche metodi di screening GI 9, 10 </sup&gt;. Qui, presentiamo i passaggi chiave necessari per eseguire quantitativa E. coli sintetico Genetic Array (eSGA) Procedura di screening su un genoma scala 9, utilizzando naturale coniugazione batterica e ricombinazione omologa per generare sistemica e misurare l&#39;idoneità di un gran numero di doppi mutanti in un formato matrice colonia. Brevemente, un robot è utilizzato per trasferire , attraverso la coniugazione, cloramfenicolo (Cm) - segnato da alleli mutanti Hfr ingegneria (ad alta frequenza di ricombinazione) &#39;ceppi donatori in un array ordinato di kanamicina (Kan) - marcati F-destinatario ceppi. In genere, si usa la perdita di funzione singoli mutanti recanti non essenziali delezioni del gene (ad esempio, la collezione &#39;Keio&#39; 11) e le mutazioni geniche essenziali hypomorphic alleli (cioè conferiscono ridotta espressione della proteina, la stabilità, o attività 9, 12, 13) a interrogare le associazioni funzionali di geni non essenziali ed essenziali, resture rispettivamente. Dopo coniugazione mediata e conseguente scambio genetico mediante ricombinazione omologa, i mutanti risultanti doppie sono selezionati su terreno solido contenente entrambi gli antibiotici. Dopo conseguenza, le piastre vengono create digitalmente delle immagini e le dimensioni delle colonie sono quantitativamente valutato con un proprio sistema automatico di elaborazione delle immagini 14. IG si rivelano quando il tasso di crescita di un doppio mutante o è significativamente migliore o peggiore del previsto 9. Aggravanti (o negativo) GIS spesso il risultato tra la perdita-di-funzione mutazioni in coppie di geni provenienti da percorsi di compensazione che incidono sullo stesso processo essenziale 2. Qui, la perdita di un singolo gene è tamponata, in modo tale che sia mutante singolo è praticabile. Tuttavia, la perdita di entrambi i percorsi è deleteria e provoca letalità sintetica o malattia (ovvero crescita lenta). Viceversa, alleviare (o positivo) possono verificarsi interazioni tra i geni della via stessa o proteina complessa 2 comedelezione del gene o da solo è spesso sufficiente a perturbare la normale funzione della via o complesso tale che perturbazioni supplementari non ridurre l&#39;attività, e quindi la crescita, ulteriormente. Nel complesso, l&#39;identificazione sistematica e l&#39;analisi delle reti GI in grado di fornire, località turistiche, mappe globali delle relazioni funzionali tra un gran numero di geni, da cui percorso informazioni a livello di perdere per altri approcci possono dedurre 9.

GIs reveal functional relationships between genes. Similarly, since genes in the same pathway display similar GI patterns and the GI profile similarity represents the congruency of phenotypes, we can group functionally related genes into pathways by clustering their GI profiles. Integrating GI and GI correlation networks with physical interaction information or other association data, such as genomic context (GC) relationships can also reveal the organization of higher-order functional modules that define core bio...

Watch this Scientific Journal Video about Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays at JoVE.com

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Sistematiche e su larga scala di sintesi genetica (gene-gene o epistasi) schermi di interazione può essere utilizzato per esplorare la ridondanza genetica e via di cross-talk. Qui, descriviamo un high-throughput quantitativa sintetica genetica tecnologia di retinatura array, definito eSGA che abbiamo sviluppato per chiarire i rapporti epistatiche ed esplorare reti di interazione genetici in<em&gt; Escherichia coli</em&gt;.

Mappatura batteriche reti funzionali e sulle vie di<em&gt; Escherichia Coli</em&gt; Utilizzando matrici sintetiche genetiche

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

Research

JoVE Journal

Biology

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Light/dark Transition Test for Mice

Luce / buio test di transizione per i Topi

Although all of the mouse genome sequences have been determined, we do not yet know the functions of most of these genes. Gene-targeting techniques, ...

Ricerca

Biologia

How to Culture, Record and Stimulate Neuronal Networks on Micro-electrode Arrays (MEAs)

How to Culture, Record and Stimulate Neuronal Networks on Micro-electrode Arrays MEAs

Come la cultura, record e stimolare reti neuronali sulla micro-array di elettrodi (MEA)

For the last century, many neuroscientists around the world have dedicated their lives to understanding how neuronal networks work and why they stop ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Protocolli di selezione mutagenesi e funzionale per l&#39;evoluzione Regia di proteine ​​in E. coli</em

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

Throughput Screening elevati di attività Endoglucanase fungine in Escherichia coli</em

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted ...

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Identificazione di complessi proteici in<em&gt; Escherichia coli</em&gt; Con sequenziale purificazione per affinità Peptide in combinazione con Tandem Mass Spectrometry

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the ...

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

Rapid Protocollo per la preparazione di elettrocompetenti<em&gt; Escherichia coli</em&gt; E<em&gt; Vibrio cholerae</em

Electroporation has become a widely used method for rapidly and efficiently introducing foreign DNA into a wide range of cells. Electrotransformation has ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Protocolli per l&#39;implementazione di un<em&gt; Escherichia coli</em&gt; Sulla base TX-TL cellulare-Free Expression System per la biologia sintetica

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

Rilevamento dal vivo<em&gt; Escherichia coli</em&gt; O157: H7 Celle di PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Green Fluorescent Protein-base Espressione Proiezione di proteine ​​di membrana in<em&gt; Escherichia coli</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

I benefici multiforme Protein Co-espressione in<em&gt; Escherichia coli</em

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in ...