Name: the green monster process for the generation of yeast strains carrying multiple gene deletions
Uploaded: 2012-12-15T15:03:00
Description: Watch this Scientific Journal Video about The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions at JoVE.com

وأيد هذا العمل من قبل الولايات المتحدة للبحث المتقدم الدفاع كالة مشاريع العقد N66001-12-C-4039 إلى YS، على منحة من مؤسسة ألفرد سلون P. لRSL، والمعاهد الامريكية الوطنية للصحة منح R01 R21 HG003224 وCA130266 لFPRFPR كان كما دعمت من قبل الزمالة من المعهد الكندي للأبحاث المتقدمة والتميز من قبل برنامج كراسي البحث كندا.

1. جيل من ProMonsters <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد استبدال GFP العالمية الكاسيت عن طريق تضخيم وتيتو 2-GFP علامة وعلامة URA3 من pYOGM012 بلازميد (الأمبيسلين المقاومة) باستخدام الاشعال مع تسلسل: GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAAT...

<ol>
	<li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science's STKE. 294, 2364-23 (2001).</li><li>Hillenmeyer, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Beh, C. T., Cool, L., Phillips, J., Rine, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+functions+of+the+yeast+oxysterol-binding+protein+homologues.">Overlapping functions of the yeast oxysterol-binding protein homologues.</a> Genetics. 157, 1117 (2001).</li><li>Wieczorke, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+knock-out+of+at+least+20+transporter+genes+is+required+to+block+uptake+of+hexoses+in+Saccharomyces+cerevisiae.">Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae.</a> FEBS letters. 464, 123-128 (1999).</li><li>Alani, E., Cao, L., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gene+disruption+that+allows+repeated+use+of+URA3+selection+in+the+construction+of+multiply+disrupted+yeast+strains.">A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.</a> Genetics. 116, 541-545 (1987).</li><li>Akada, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+seamless+gene+deletion+and+marker+recycling+in+Saccharomyces+cerevisiae.">PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae.</a> Yeast. 23, 399-405 (2006).</li><li>Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+efficient+gene+disruption+cassette+for+repeated+use+in+budding+yeast.">A new efficient gene disruption cassette for repeated use in budding yeast.</a> Nucleic acids research. 24, 2519 (1996).</li><li>Delneri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+redundancy+in+the+yeast+genome:+an+improved+strategy+for+use+of+the+cre-loxP+system.">Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system.</a> Gene. 252, 127-135 (2000).</li><li>Storici, F., Lewis, L. K., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+site-directed+mutagenesis+using+oligonucleotides.">In vivo site-directed mutagenesis using oligonucleotides.</a> Nat. Biotech. 19, 773-776 (2001).</li><li>Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+repeat+coupled+with+endonuclease+cleavage+(TREC):+a+seamless+modification+tool+for+genome+engineering+in+yeast.">Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast.</a> Nucl. Acids Res. 38, 2570-2576 (2010).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knocking+out+multigene+redundancies+via+cycles+of+sexual+assortment+and+fluorescence+selection.">Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection.</a> Nat. Methods. 8, 159-164 (2011).</li><li>Winzeler, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Characterization+of+the+S.+Genome+by+Gene+Deletion+and+Parallel+Analysis.">Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis.</a> Science. 285, 901-906 (1999).</li><li>Woods, R. A., Gietz, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+plasmid+DNA+into+yeast.">High-efficiency transformation of plasmid DNA into yeast.</a> Methods Mol. Biol. 177, 85-97 (2001).</li><li>Hughes, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+aneuploidy+revealed+by+DNA+microarray+expression+profiling.">Widespread aneuploidy revealed by DNA microarray expression profiling.</a> Nature. 25, 333-337 (2000).</li><li>Goldstein, A. L., McCusker, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+new+dominant+drug+resistance+cassettes+for+gene+disruption+in+Saccharomyces+cerevisiae.">Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.</a> Yeast. 15, 1541-1553 (1999).</li><li>Newman, J. R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+proteomic+analysis+of+S.+cerevisiae+reveals+the+architecture+of+biological+noise.">Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise.</a> Nature. 441, 840-846 (2006).</li><li>Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+regulation+at+the+single-cell+level.">Gene regulation at the single-cell level.</a> Science. 307, 1962 (2005).</li></ol>

كما قمنا بتطوير النهج الوحش الأخضر، ونشعر بالقلق مع إمكانية إعادة التركيب بين مختلف الأشرطة استبدال GFP، مما يؤدي إلى إعادة ترتيب الجينوم. تخفيف من هذا الاحتمال هو اختيارنا للخلايا التي خضعت بنجاح جولات متعددة من التزاوج والانقسام الاختزالي. ومن المتوقع أن الخلايا ا?...

<table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> اسم كاشف أو صك </td><td> شركة </td><td> كتالوج رقم </td><td> التعليقات (اختياري) </td></tr><tr><td> G418 </td><td> سيغما الدريخ </td><td> A1720 </td><td> تذوب في الماء وفلتر تعقيم-(0.2 ميكرون فلتر). تركيز المخزون: 200 ملغ / مل. تخزين في C. ° 4 </td></tr><tr><td> ClonNAT (nourseothricin) </td><td> WERNER BioAgents </td><td> 5001000 </td><td> تذوب في الماء وفلتر تعقيم-(0.2 ميكرون فلتر). تركيز المخزون: 100 ملغ / مل. تخزين في C. ° 4 </td></tr><tr><td> الدوكسيسيكلين </td><td> سيغما الدريخ </td><td> D9891 </td><td> تذوب في الايثانول 50٪ وتصفية تعقيم-(0.2 ميكرون فلتر). تركيز المخزون: 10 ملغ / مل. جعل جديدة كل أربعة أسابيع. درع من الضوء باستخدام رقائق الألومنيوم وتخزينها في 4 درجات مئوية. </td></tr><tr><td> Zymolyase </td><td> ZymoResearch </td><td> E1005 </td><td></td></tr><tr><td> Difco قاعدة النيتروجين الخميرة ث / س الأحماض الأمينية </td><td> BD </td><td> 291940 </td><td></td></tr><tr><td> مسدس (المدورة للأنابيب) </td><td> Labnet </td><td> H5600 </td><td></td></tr><tr><td> ENDURO الكهربائي XL جل وحدة </td><td> Labnet </td><td> E0160 </td><td></td></tr><tr><td> Sonifier 450 </td><td> برانسون </td><td> 101-063-198 </td><td></td></tr><tr><td> Microtip لSonifier 450 </td><td> برانسون </td><td> 101-148-062 </td><td></td></tr><tr><td> FACSAria الخلية فارز </td><td> BD </td><td></td><td></td></tr><tr><td> MoFlo الخلية فارز </td><td> بيكمان كولتر، </td><td></td><td></td></tr><tr><td> Biomek FX أو ما يعادلها الروبوت </td><td> بيكمان كولتر </td><td></td><td> اختيارية. لإنشاء تقارير إتمام المشروعات التنميط الجيني. </td></tr></tbody> &lt;/ الجدول&gt;

the green monster process for the generation of yeast strains carrying multiple gene deletions

غالبا ما يتم الكشف عن الظواهر لحذف الجينات فقط عندما يتم اختبار الطفرة الوراثية في خلفية معينة أو البيئية 1،2 الشرط. هناك أمثلة حيث العديد من الجينات تحتاج إلى حذف وظائف الجينات لكشف المخفي 3،4. على الرغم من إمكانية الاكتشافات الهامة، لم تستكشف بعد بشكل كبير التفاعلات الوراثية التي تنطوي على ثلاثة أو أكثر من الجينات. والبحث حصرية متعددة متحولة التفاعلات غير عملي نظرا للعدد الهائل من التوليفات الممكنة من الحذف. ومع ذلك، فإن الدراسات من مجموعات مختارة من الجينات، مثل مجموعات من paralogs مع فرصة أكبر مسبق من أشكال تقاسم وظيفة مشتركة، تكون غنية بالمعلومات. في الخميرة خميرة الخباز، ويتم إنجاز خروج المغلوب من خلال استبدال الجينات الجين مع علامة اختيار إعادة التركيب مثلي عبر. لأن عدد علامات محدودة، وقد وضعت طرق لإزالة وإعادة استخدام سام<html> ه علامة 5،6،7،8،9،10. ومع ذلك، والطفرات الهندسة بالتسلسل متعددة باستخدام هذه الأساليب وقتا طويلا لأن الوقت اللازم جداول خطيا مع عدد من الحذف يمكن إنشاء. نحن هنا وصف الأسلوب الوحش الأخضر للهندسة بشكل روتيني الحذف متعددة في الخميرة 11. في هذه الطريقة، يتم استخدام البروتين الأخضر نيون (GFP) مراسل دمجها في الحذف لسلالات التسمية من الناحية الكمية وفقا لعدد من الحذف الواردة في كل سلالة (الشكل 1). جولات متكررة من مجموعة متنوعة من GFP وضع علامات الحذف عن طريق التزاوج الخميرة والانقسام الاختزالي إلى جانب تدفق cytometric تخصيب سلالات تحمل أكثر من هذه الحذف يؤدي إلى تراكم الضغوط في الحذف (الشكل 2). أداء عدة عمليات في نفس الوقت، مع كل عملية دمج واحدة أو أكثر الحذف لكل جولة، ويقلل من الوقت اللازم للبناء سلالة. المحتوى &quot;&gt; الخطوة الأولى هي إعداد فرداني واحد يسمى طفرات &#39;ProMonsters،&#39; كل منها يحمل مراسل GFP في موضع حذف واحد من&quot; مجموعة أدوات &quot;مواضع، إما GMToolkit-A الوحش الأخضر أو GMToolkit α-في . can1Δ مكان (الشكل 3) باستخدام سلالات من الخميرة جمع حذف 12، يمكن GFP بعلامات الحذف ولدت مريح عن طريق استبدال مشتركة KanMX4 الكاسيت الموجودة في هذه السلالات مع GFP عالمية - جزء يحتوي على كل URA3 GMToolkit: إما أ - أو α-التزاوج من نوع خاص علامة اختيار فرداني 1 و بالضبط واحدة من علامات اللذين عند كل GMToolkits موجودة، تسمح بشكل جماعي لاختيار diploids. والخطوة الثانية هي لتنفيذ ركوب الدراجات من خلال الجنسي التي يمكن دمجها ضمن مواضع الحذف خلية واحدة من تشكيلة عشوائية و / أو recomb الانتصافيination التي ترافق كل دورة من التزاوج وتبوغ.

عندما يتقاطع سلالة A-فرداني تقل أربعة الحذف GFP بعلامات (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) مع سلالة α-فرداني تقل أربعة الحذف (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ)، مع اثنين من الحذف (ycl033cΔ yer042wΔ) المشتركة من قبل اثنين من سلالات، وممثل تم الحصول على نتيجة. كان مثقف الخليط ال?...

Watch this Scientific Journal Video about The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions at JoVE.com

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

طريقة الوحش الأخضر تمكن الجمعية من الحذف السريع متعددة ملحوظ مع بروتين الجين الترميز مراسل الخضراء الفلورية. ويستند هذا الأسلوب على القيادة سلالات الخميرة من خلال دورات متكررة من تشكيلة الجنسي للالحذف ومضان على أساس تخصيب الخلايا تحمل أكثر الحذف.

عملية الوحش الأخضر لتوليد سلالات الخميرة حمل حذوفات متعددة الجينات

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Research

JoVE Journal

Biology

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

التحضير لزراعة الخلايا المكونة للدم الابتدائية من نخاع عظام الفئران لElectroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Spinal Cord Electrophysiology

الحبل الشوكي الكهربية

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

In vitro Reconstitution of the Active T. castaneum Telomerase

In vitro Reconstitution of the Active T. castaneum Telomerase

إعادة إعماره في المختبر من أحدث T. castaneum تيلوميراز

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

جيل من الفئران المستمدة من الخلايا الجذعية المحفزة المستحثة

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

حذوفات الجينات في الجينوم على نطاق<em&gt; العقدية الدم</em&gt; من جانب PCR إنتاجية عالية

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

مهدها الخميرة استخراج البروتين وتنقية لدراسة وظيفة، والتفاعلات، والتعديلات بعد متعدية

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously ...

Nanogold Labeling of the Yeast Endosomal System for Ultrastructural Analyses

Nanogold وصفها نظام Endosomal خميرة التحليلات التركيبية

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the ...

Isolating Potentiated Hsp104 Variants Using Yeast Proteinopathy Models

عزل Potentiated Hsp104 المتغيرات عن طريق الخميرة Proteinopathy نماذج

Many protein-misfolding disorders can be modeled in the budding yeast Saccharomyces cerevisiae. Proteins such as TDP-43 and FUS, implicated in amyotrophic ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

جيل من الجينوم الحذف في خطوط خلايا الثدييات عبر كريسبر / Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

Applications of pHluorin for Quantitative, Kinetic and High-throughput Analysis of Endocytosis in Budding Yeast

تطبيقات pHluorin لالكمي، الحركية وعالية الإنتاجية تحليل الإلتقام في مهدها الخميرة

Green fluorescent protein (GFP) and its variants are widely used tools for studying protein localization and dynamics of events such as cytoskeletal ...