Name: the green monster process for the generation of yeast strains carrying multiple gene deletions
Uploaded: 2012-12-15T15:03:00
Description: Watch this Scientific Journal Video about The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions at JoVE.com

Dit werk werd ondersteund door de US Defense Advanced Research Projects Agency contract N66001-12-C-4039 aan YS, een subsidie ​​van de Alfred P. Sloan Foundation om RSL, en de Amerikaanse National Institutes of Health subsidies R01 HG003224 en R21 CA130266 te FPRFPR was ook ondersteund door een beurs van de Canadese Institute for Advanced Research en door de Canada Excellence Research Chairs programma.

1. Generatie ProMonsters <ol><li> Bereid de universele GFP vervanging cassette door het amplificeren van een tetO 2-GFP marker en de URA3 marker uit het plasmide pYOGM012 (ampicillineresistentie) met behulp van primers met sequenties: GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG en GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (vetgedrukt regio bieden homologie met de flankerende gebieden van de cassette...

<ol>
	<li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science's STKE. 294, 2364-23 (2001).</li><li>Hillenmeyer, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Beh, C. T., Cool, L., Phillips, J., Rine, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+functions+of+the+yeast+oxysterol-binding+protein+homologues.">Overlapping functions of the yeast oxysterol-binding protein homologues.</a> Genetics. 157, 1117 (2001).</li><li>Wieczorke, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+knock-out+of+at+least+20+transporter+genes+is+required+to+block+uptake+of+hexoses+in+Saccharomyces+cerevisiae.">Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae.</a> FEBS letters. 464, 123-128 (1999).</li><li>Alani, E., Cao, L., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gene+disruption+that+allows+repeated+use+of+URA3+selection+in+the+construction+of+multiply+disrupted+yeast+strains.">A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.</a> Genetics. 116, 541-545 (1987).</li><li>Akada, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+seamless+gene+deletion+and+marker+recycling+in+Saccharomyces+cerevisiae.">PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae.</a> Yeast. 23, 399-405 (2006).</li><li>Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+efficient+gene+disruption+cassette+for+repeated+use+in+budding+yeast.">A new efficient gene disruption cassette for repeated use in budding yeast.</a> Nucleic acids research. 24, 2519 (1996).</li><li>Delneri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+redundancy+in+the+yeast+genome:+an+improved+strategy+for+use+of+the+cre-loxP+system.">Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system.</a> Gene. 252, 127-135 (2000).</li><li>Storici, F., Lewis, L. K., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+site-directed+mutagenesis+using+oligonucleotides.">In vivo site-directed mutagenesis using oligonucleotides.</a> Nat. Biotech. 19, 773-776 (2001).</li><li>Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+repeat+coupled+with+endonuclease+cleavage+(TREC):+a+seamless+modification+tool+for+genome+engineering+in+yeast.">Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast.</a> Nucl. Acids Res. 38, 2570-2576 (2010).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knocking+out+multigene+redundancies+via+cycles+of+sexual+assortment+and+fluorescence+selection.">Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection.</a> Nat. Methods. 8, 159-164 (2011).</li><li>Winzeler, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Characterization+of+the+S.+Genome+by+Gene+Deletion+and+Parallel+Analysis.">Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis.</a> Science. 285, 901-906 (1999).</li><li>Woods, R. A., Gietz, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+plasmid+DNA+into+yeast.">High-efficiency transformation of plasmid DNA into yeast.</a> Methods Mol. Biol. 177, 85-97 (2001).</li><li>Hughes, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+aneuploidy+revealed+by+DNA+microarray+expression+profiling.">Widespread aneuploidy revealed by DNA microarray expression profiling.</a> Nature. 25, 333-337 (2000).</li><li>Goldstein, A. L., McCusker, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+new+dominant+drug+resistance+cassettes+for+gene+disruption+in+Saccharomyces+cerevisiae.">Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.</a> Yeast. 15, 1541-1553 (1999).</li><li>Newman, J. R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+proteomic+analysis+of+S.+cerevisiae+reveals+the+architecture+of+biological+noise.">Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise.</a> Nature. 441, 840-846 (2006).</li><li>Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+regulation+at+the+single-cell+level.">Gene regulation at the single-cell level.</a> Science. 307, 1962 (2005).</li></ol>

Bij het ontwikkelen van de Green Monster benadering zijn we bezig met de mogelijkheid van recombinatie tussen verschillende GFP vervangen cassettes, waardoor genoom omlegging. Verzachten tegen deze mogelijkheid is onze selectie voor cellen die succes hebben ondergaan meerdere ronden van paring en meiose. Cellen die herschikt genomen naar verwachting minder geschikt na koppeling met een identieke cellen zonder omlegging. Inderdaad, we hebben niet in acht te nemen genoom instabiliteit als gevolg van recombinatie tussen GF...

<table border="1"><tbody><tr><td> Naam van het reagens of het instrument </td><td> Vennootschap </td><td> Catalogusnummer </td><td> Opmerkingen (optioneel) </td></tr><tr><td> G418 </td><td> Sigma-Aldrich </td><td> A1720 </td><td> Oplossen in water en filter-steriliseren (0,2-um filter). De concentratie: 200 mg / ml. Bewaar bij 4 ° C. </td></tr><tr><td> ClonNAT (nourseothricin) </td><td> WERNER BioAgents </td><td> 5001000 </td><td> Oplossen in water en filter-steriliseren (0,2-um filter). De concentratie: 100 mg / ml. Bewaar bij 4 ° C. </td></tr><tr><td> Doxycycline </td><td> Sigma-Aldrich </td><td> D9891 </td><td> Oplossen in 50% ethanol en filter-steriliseren (0,2 urn filter). De concentratie: 10 mg / ml. Maak verse elke vier weken. Schild van licht met behulp van aluminiumfolie en bewaar bij 4 ° C. </td></tr><tr><td> Zymolyase </td><td> ZymoResearch </td><td> E1005 </td><td></td></tr><tr><td> Difco giststikstofbase w / o aminozuren </td><td> BD </td><td> 291940 </td><td></td></tr><tr><td> Revolver (rotator voor buizen) </td><td> Labnet </td><td> H5600 </td><td></td></tr><tr><td> Enduro Gel XL elektroforeseapparaat </td><td> Labnet </td><td> E0160 </td><td></td></tr><tr><td> Sonifier 450 </td><td> Branson </td><td> 101-063-198 </td><td></td></tr><tr><td> Microtip voor Sonifier 450 </td><td> Branson </td><td> 101-148-062 </td><td></td></tr><tr><td> FACSAria celsorteerder </td><td> BD </td><td></td><td></td></tr><tr><td> MoFlo celsorteerder </td><td> Beckman Coulter- </td><td></td><td></td></tr><tr><td> Biomek FX of gelijkwaardig robot </td><td> Beckman Coulter </td><td></td><td> Optioneel. Voor het instellen van genotypering PCR&#39;s. </td></tr></tbody> &lt;/ Table&gt;

the green monster process for the generation of yeast strains carrying multiple gene deletions

Fenotypes voor gendeletie vaak onthuld wanneer de mutatie getest in een bepaalde genetische achtergrond of omgevingsconditie 1,2. Er zijn voorbeelden waar veel genen moeten worden verwijderd om te ontmaskeren verborgen genfuncties 3,4. Ondanks het potentieel voor belangrijke ontdekkingen, zijn genetische interacties met drie of meer genen grotendeels onontgonnen. Uitputtende zoekopdrachten van multi-mutant interacties zou onpraktisch zijn als gevolg van het grote aantal mogelijke combinaties van verwijderingen. Zou echter studies van geselecteerde sets van genen, zoals sets van paralogen met meer a priori kans van een gemeenschappelijke functie informatief. In de gist Saccharomyces cerevisiae is knockout bewerkstelligd door vervanging van een gen met een selecteerbare merker via homologe recombinatie. Omdat het aantal markers beperkt zijn werkwijzen ontwikkeld voor het verwijderen en opnieuw de sam<html> e marker 5,6,7,8,9,10. Echter achtereenvolgens techniek meerdere mutaties met deze methoden is tijdrovend omdat de tijdschalen lineair vereist met het aantal deleties te genereren. Hier beschrijven we de Green Monster methode voor routinematig engineering van meerdere deleties in gist 11. In deze methode wordt een groen fluorescerend eiwit (GFP) reporter geïntegreerd in deleties gebruikt om kwantitatief label stammen volgens het aantal deleties in elke stam (figuur 1). Herhaalde rondes van het assortiment van GFP-gemerkt deleties via gist mating en meiose gekoppeld met flow-cytometrische verrijking van stammen die meer van deze deleties leiden tot de ophoping van deleties in stammen (figuur 2). Het uitvoeren van meerdere processen in parallel met elk proces waarin een of meer deleties per ronde minder tijd nodig voor stam constructie. inhoud &quot;&gt; De eerste stap is de voorbereiding van haploïde single-mutanten genoemd &#39;ProMonsters,&#39; die elk draagt ​​een GFP reporter in een verwijderde locus en een van de &#39;toolkit&#39; loci-ofwel Green Monster GMToolkit-a of GMToolkit-α in de . can1Δ locus (Figuur 3) Gebruik stammen van de gist deletie collectie 12 kan GFP-gemerkte deleties eenvoudig worden gegenereerd door het vervangen van de gemeenschappelijke KanMX4 cassette bestaande in deze stammen met een universele GFP - URA3 fragment Elke GMToolkit bevat:. hetzij de a - of α-mating-type-specifieke haploïde selectiemerker 1 en precies een van de twee markers die, wanneer beide GMToolkits aanwezig zijn, samen zorgen voor selectie van diploïde. De tweede stap is het uitvoeren van de seksuele fietsen waardoor deletie loci kunnen in een cel worden gecombineerd door de willekeurige sortering en / of meiotische Recombination dat elke cyclus van de paring en sporulatie begeleidt.

Wanneer een a-haploïde stam die vier GFP-gemerkte deleties (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) werd gekruist met een α-haploïde stam die vier deleties (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ) met twee deleties (ycl033cΔ yer042wΔ) gedeeld door twee stammen, representant resultaat verkregen. De paring mengsel werd gekweekt in YPDA medium dat G418 en Nat te diploïden te selecteren. De resulterende diploïden werden gekweekt in de sporulatie medium. De sporen werden v...

Watch this Scientific Journal Video about The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions at JoVE.com

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

De Green Monster methode kan de snelle montage van meerdere deleties gemarkeerd met een reportergen codeert groen fluorescent eiwit. Deze methode is gebaseerd op een giststammen door herhaalde cycli van seksuele assortiment van deleties en fluorescentie gebaseerde verrijking van cellen die meer deleties.

The Green Monster Werkwijze voor de generatie van giststammen dragen Meerdere gendeleties

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Research

JoVE Journal

Biology

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

De vervaardiging van primaire hematopoietische cellen culturen uit Murine Bone Marrow voor Elektroporatie

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Spinal Cord Electrophysiology

Spinal Cord Elektrofysiologie

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

In vitro Reconstitution of the Active T. castaneum Telomerase

In vitro Reconstitution of the Active T. castaneum Telomerase

In vitro reconstitutie van de Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

Generatie van Muizen Afgeleid van geïnduceerde pluripotente stamcellen

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genoom-brede gendeleties in<em&gt; Streptococcus sanguinis</em&gt; Door High Throughput PCR

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

Ontluikende Gist Protein extractie en zuivering voor de Studie van de functie, interacties, en post-translationele modificaties

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously ...

Nanogold Labeling of the Yeast Endosomal System for Ultrastructural Analyses

Nanogold Labeling van de Gist endosomale systeem voor Ultrastructurele Analyses

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the ...

Isolating Potentiated Hsp104 Variants Using Yeast Proteinopathy Models

Isoleren versterkt Hsp104 Varianten Met behulp Gist proteïnopathie Modellen

Many protein-misfolding disorders can be modeled in the budding yeast Saccharomyces cerevisiae. Proteins such as TDP-43 and FUS, implicated in amyotrophic ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

Generatie van Genomic Deleties in zoogdiercellijnen via CRISPR / Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

Applications of pHluorin for Quantitative, Kinetic and High-throughput Analysis of Endocytosis in Budding Yeast

Toepassingen van pHluorin voor Quantitative, Kinetic en High-throughput analyse van de Humor in gist

Green fluorescent protein (GFP) and its variants are widely used tools for studying protein localization and dynamics of events such as cytoskeletal ...