Name: the green monster process for the generation of yeast strains carrying multiple gene deletions
Uploaded: 2012-12-15T15:03:00
Description: Watch this Scientific Journal Video about The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions at JoVE.com

עבודה זו נתמכה על ידי חוזה ההגנה האמריקנית המחקר המתקדם פרויקטי סוכנות N66001-12-C-4039 לי&quot;ש, מענק של פ אלפרד סלואן הקרן לRSL, והמוסד אמריקאי הלאומי לבריאות מענקי R01 HG003224 וR21 CA130266 לFPRFPR היה גם נתמך על ידי מלגה מהמכון הקנדי למחקר מתקדם ועל ידי תכנית מחקר כיסאות אקסלנס קנדה.

1. דור של ProMonsters <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן את קלטת החלפת GFP האוניברסלית על ידי הגברת TETO סמן 2-GFP וסמן URA3 מpYOGM012 פלסמיד (התנגדות אמפיצילין) תוך שימוש בפריימרים עם רצפים: GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG ו...

<ol>
	<li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science's STKE. 294, 2364-23 (2001).</li><li>Hillenmeyer, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Beh, C. T., Cool, L., Phillips, J., Rine, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+functions+of+the+yeast+oxysterol-binding+protein+homologues.">Overlapping functions of the yeast oxysterol-binding protein homologues.</a> Genetics. 157, 1117 (2001).</li><li>Wieczorke, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+knock-out+of+at+least+20+transporter+genes+is+required+to+block+uptake+of+hexoses+in+Saccharomyces+cerevisiae.">Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae.</a> FEBS letters. 464, 123-128 (1999).</li><li>Alani, E., Cao, L., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gene+disruption+that+allows+repeated+use+of+URA3+selection+in+the+construction+of+multiply+disrupted+yeast+strains.">A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.</a> Genetics. 116, 541-545 (1987).</li><li>Akada, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+seamless+gene+deletion+and+marker+recycling+in+Saccharomyces+cerevisiae.">PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae.</a> Yeast. 23, 399-405 (2006).</li><li>Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+efficient+gene+disruption+cassette+for+repeated+use+in+budding+yeast.">A new efficient gene disruption cassette for repeated use in budding yeast.</a> Nucleic acids research. 24, 2519 (1996).</li><li>Delneri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+redundancy+in+the+yeast+genome:+an+improved+strategy+for+use+of+the+cre-loxP+system.">Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system.</a> Gene. 252, 127-135 (2000).</li><li>Storici, F., Lewis, L. K., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+site-directed+mutagenesis+using+oligonucleotides.">In vivo site-directed mutagenesis using oligonucleotides.</a> Nat. Biotech. 19, 773-776 (2001).</li><li>Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+repeat+coupled+with+endonuclease+cleavage+(TREC):+a+seamless+modification+tool+for+genome+engineering+in+yeast.">Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast.</a> Nucl. Acids Res. 38, 2570-2576 (2010).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knocking+out+multigene+redundancies+via+cycles+of+sexual+assortment+and+fluorescence+selection.">Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection.</a> Nat. Methods. 8, 159-164 (2011).</li><li>Winzeler, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Characterization+of+the+S.+Genome+by+Gene+Deletion+and+Parallel+Analysis.">Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis.</a> Science. 285, 901-906 (1999).</li><li>Woods, R. A., Gietz, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+plasmid+DNA+into+yeast.">High-efficiency transformation of plasmid DNA into yeast.</a> Methods Mol. Biol. 177, 85-97 (2001).</li><li>Hughes, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+aneuploidy+revealed+by+DNA+microarray+expression+profiling.">Widespread aneuploidy revealed by DNA microarray expression profiling.</a> Nature. 25, 333-337 (2000).</li><li>Goldstein, A. L., McCusker, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+new+dominant+drug+resistance+cassettes+for+gene+disruption+in+Saccharomyces+cerevisiae.">Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.</a> Yeast. 15, 1541-1553 (1999).</li><li>Newman, J. R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+proteomic+analysis+of+S.+cerevisiae+reveals+the+architecture+of+biological+noise.">Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise.</a> Nature. 441, 840-846 (2006).</li><li>Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+regulation+at+the+single-cell+level.">Gene regulation at the single-cell level.</a> Science. 307, 1962 (2005).</li></ol>

כפי שפתחנו את גישת המפלצת הירוקה, שהעסקנו אותנו לאפשרות של רקומבינציה בין קלטות החלפת GFP שונות, שהוביל לארגון מחדש הגנום. מקלים נגד האפשרות הזאת הוא הבחירה שלנו לתאים שעברו סבבים רבים של הזדווגות ומיוזה בהצלחה. תאים הנושאים הגנום סודר מחדש צפויים להיות בכושר ירוד לאח...

<table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> שמו של המגיב או המכשיר </td><td> חברה </td><td> מספר קטלוגים </td><td> תגובות (אופציונלי) </td></tr><tr><td> G418 </td><td> סיגמה אולדריץ </td><td> A1720 </td><td> מתמוסס במים ומסננים לעקר (מסנן 0.2-מיקרומטר). ריכוז המלאי: 200 מ&quot;ג / מ&quot;ל. לאחסן ב 4 ° C. </td></tr><tr><td> ClonNAT (nourseothricin) </td><td> Bioagents רנר </td><td> 5001000 </td><td> מתמוסס במים ומסננים לעקר (מסנן 0.2-מיקרומטר). ריכוז המלאי: 100 מ&quot;ג / מ&quot;ל. לאחסן ב 4 ° C. </td></tr><tr><td> דוקסיציקלין </td><td> סיגמה אולדריץ </td><td> D9891 </td><td> להמס באתנול 50% ולסנן-לעקר (מסנן 0.2-מיקרומטר). ריכוז המלאי: 10 מ&quot;ג / מ&quot;ל. הפוך טרי מדי ארבעה שבועות. חומה מאור עם רדיד אלומיניום ולאחסן ב 4 ° C. </td></tr><tr><td> Zymolyase </td><td> ZymoResearch </td><td> E1005 </td><td></td></tr><tr><td> Difco בסיס w / o חומצות אמין חנקן שמרים </td><td> BD </td><td> 291940 </td><td></td></tr><tr><td> (מסובב לצינורות) אקדח </td><td> Labnet </td><td> H5600 </td><td></td></tr><tr><td> יחידת אלקטרופורזה XL ג&#39;ל אנדורו </td><td> Labnet </td><td> E0160 </td><td></td></tr><tr><td> Sonifier 450 </td><td> ברנסון </td><td> 101-063-198 </td><td></td></tr><tr><td> Microtip לSonifier 450 </td><td> ברנסון </td><td> 101-148-062 </td><td></td></tr><tr><td> סדרן התא FACSAria </td><td> BD </td><td></td><td></td></tr><tr><td> סדרן התא MoFlo </td><td> Beckman-קולטר </td><td></td><td></td></tr><tr><td> Biomek FX או רובוט מקביל </td><td> Beckman Coulter </td><td></td><td> אופציונלי. להקמת PCRs genotyping. </td></tr></tbody> &lt;/ שולחן&gt;

the green monster process for the generation of yeast strains carrying multiple gene deletions

פנוטיפים למחיקת גן לעתים קרובות מתגלים רק כאשר המוטציה נבדקת ברקע גנטי מסוים או 1,2 תנאי הסביבה. ישנן דוגמאות שבו גנים רבים זקוקות למחיקה לחשוף פונקציות גנים נסתרות 3,4. למרות הפוטנציאל לתגליות חשובות, אינטראקציות הקשורים בשלושה או יותר גנים נחקרו במידה רבה. חיפושים הממצים של אינטראקציות מרובות מוטציה יהיו מעשיים בשל המספר העצום של צירופים אפשריים של מחיקות. עם זאת, מחקרים של קבוצות נבחרות של גנים, כגון ערכות של paralogs עם יותר סיכוי מראש של שיתוף פעולה משותפת, יהיו אינפורמטיבי. בcerevisiae Saccharomyces השמרים, נוקאאוט הגן מושג על ידי החלפת גנים עם סמן בחירה באמצעות רקומבינציה הומולוגית. מכיוון שמספר הסמנים הוא מוגבל, פותחו שיטות להסרה ושימוש חוזר בסם<html> סמן הדואר 5,6,7,8,9,10. עם זאת, ברצף מוטציות רבות הנדסיות באמצעות שיטות אלה הן זמן רב משום שהזמן דרוש ליניארית קשקשים עם מספר המחיקות להיות שנוצר. כאן אנו מתארים שיטת המפלצת הירוקה להנדסת מחיקות מרובות באופן שגרתי בשמרי 11. בשיטה זו, כתב חלבון פלואורסצנטי ירוק (GFP) שולב מחיקות משמש לכמותית זני תווית בהתאם למספר של מחיקות כלולות בכל מאמץ (איור 1). סיבובים חוזרים ונשנים של מבחר של GFP-מסומנים מחיקות באמצעות הזדווגות שמרים ומיוזה יחד עם העשרת הזרימה cytometric של זנים נושאים יותר של המחיקות הללו מובילות להצטברות של מחיקות בזנים (איור 2). ביצוע מספר רבים של תהליכים במקבילים, כאשר כל תהליך שילוב מחיקות אחד או יותר בכל סבב, מפחית את הזמן הנדרש לבניית מתח. תוכן &quot;&gt; הצעד הראשון הוא יכין מוטציות בודדות ההפלואידים כינו &#39;ProMonsters,&quot; כל אחד מהם נושא את כתב ה-GFP במוקד נמחק ואחד&#39; ארגז הכלים &#39;הלוקוסים-או GMToolkit-המפלצת הירוקה או GMToolkit-α ב . Can1Δ לוקוס (איור 3) שימוש בזנים מאוסף מחיקת שמרי 12, מחיקות GFP-מסומנות יכול להיות שנוצר בנוחות על ידי החלפת KanMX4 הקלטת המשותפת קיימת בזנים אלה עם GFP אוניברסלי - URA3 בר כל GMToolkit מכיל:. או - או α-הזדווגות סוג ספציפי סמן הפלואידים בחירה 1 ובדיוק אחד משני הסמנים ש, כאשר שני GMToolkits נמצא, באופן קולקטיבי מאפשרים בחירה של diploids. הצעד השני הוא לבצע רכיבה המינית שדרכו ניתן לשלב לוקוסי מחיקה בתוך תא בודד על ידי מבחר האקראי ו / או recomb meioticination המלווה כל מחזור של הזדווגות ונביגה.

כאשר מתח-הפלואידים נושאים ארבע מחיקות מסומנות-GFP (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) נחצה עם מתח α-הפלואידים נושאים ארבע מחיקות (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), עם שתי מחיקות (ycl033cΔ yer042wΔ) משותף לשני זנים, נציג תוצאה הושגה. תערובת ההזדווגות הייתה בתרבית במדיום המכיל YPDA G418 ונט ...

Watch this Scientific Journal Video about The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions at JoVE.com

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

שיטת המפלצת הירוקה מאפשרת הרכבה המהירה של מחיקות מרובות מסומנות בחלבון כתב גן קידוד ירוק זרחני. שיטה זו מבוססת על נהיגת זני שמרים במחזורים חוזרים ונשנים של מגוון מיני של מחיקות והעשרה פלואורסצנטי המבוסס של תאים שנשאו יותר מחיקות.

תהליך המפלצת הירוקה לדור של זני שמרי נשיאת מחיקות Gene מרובות

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Research

JoVE Journal

Biology

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

הכנת ראשי בתרביות תאים hematopoietic ממח העצם Murine עבור electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Spinal Cord Electrophysiology

חוט השדרה Electrophysiology

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

In vitro Reconstitution of the Active T. castaneum Telomerase

In vitro Reconstitution of the Active T. castaneum Telomerase

ב הכינון במבחנה של ט פעילים castaneum שהטלומרז

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

דור של עכברים שמקורם בתאי גזע pluripotent מושרים

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

מחיקות Gene הגנום ב<em&gt; סטרפטוקוקוס sanguinis</em&gt; על ידי תפוקה הגבוהה PCR

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

הפקת ניצני שמרים וטיהור חלבון לחקר תפקוד, האינטראקציות, ולאחר translational השינויים

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously ...

Nanogold Labeling of the Yeast Endosomal System for Ultrastructural Analyses

Nanogold תיוג של מערכת endosomal שמרים לניתוח Ultrastructural

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the ...

Isolating Potentiated Hsp104 Variants Using Yeast Proteinopathy Models

בידוד דוגמניות Proteinopathy שמרי שימוש potentiated Hsp104 גרסאות

Many protein-misfolding disorders can be modeled in the budding yeast Saccharomyces cerevisiae. Proteins such as TDP-43 and FUS, implicated in amyotrophic ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

דור של מחיקות הגנומי בשורות תאים יונקים באמצעות CRISPR / Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

Applications of pHluorin for Quantitative, Kinetic and High-throughput Analysis of Endocytosis in Budding Yeast

יישומים של pHluorin עבור כמותי, קינטי וניתוח תפוקה גבוהה של אנדוציטוזה שמרים הנצה

Green fluorescent protein (GFP) and its variants are widely used tools for studying protein localization and dynamics of events such as cytoskeletal ...