Name: the green monster process for the generation of yeast strains carrying multiple gene deletions
Uploaded: 2012-12-15T15:03:00
Description: Watch this Scientific Journal Video about The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions at JoVE.com

이 작품은 FPRFPR에 YS, RSL의 알프레드 P. 슬로안 재단의 교부금 및 건강 교부금의 미국 국립 연구소 R01 HG003224와 R21 CA130266에 미국 국방 고급 연구 프로젝트 기관 계약 N66001-12-C-4039에 의해 지원했던 건 또한 고급 연구 캐나다 연구소에서 친목 의해 캐나다 우수 연구 의자 프로그램에 의해 지원됩니다.

1. ProMonsters의 생성 <ol><li> tetO 2 GFP 마커와 순서와 프리 머를 사용하여 플라스미드 pYOGM012 (암피실린 저항)에서 URA3 마커를 증폭하여 보편적 인 GFP 교체 카세트 준비 : GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG 및 GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (굵게 표시된 지역 타겟이 분명한 교체를 허용 KanMX4 카세트의 측?...

<ol>
	<li>Tong, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+genetic+analysis+with+ordered+arrays+of+yeast+deletion+mutants.">Systematic genetic analysis with ordered arrays of yeast deletion mutants.</a> Science's STKE. 294, 2364-23 (2001).</li><li>Hillenmeyer, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+genomic+portrait+of+yeast:+uncovering+a+phenotype+for+all+genes.">The chemical genomic portrait of yeast: uncovering a phenotype for all genes.</a> Science. 320, 362-365 (2008).</li><li>Beh, C. T., Cool, L., Phillips, J., Rine, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overlapping+functions+of+the+yeast+oxysterol-binding+protein+homologues.">Overlapping functions of the yeast oxysterol-binding protein homologues.</a> Genetics. 157, 1117 (2001).</li><li>Wieczorke, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concurrent+knock-out+of+at+least+20+transporter+genes+is+required+to+block+uptake+of+hexoses+in+Saccharomyces+cerevisiae.">Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae.</a> FEBS letters. 464, 123-128 (1999).</li><li>Alani, E., Cao, L., Kleckner, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gene+disruption+that+allows+repeated+use+of+URA3+selection+in+the+construction+of+multiply+disrupted+yeast+strains.">A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.</a> Genetics. 116, 541-545 (1987).</li><li>Akada, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+seamless+gene+deletion+and+marker+recycling+in+Saccharomyces+cerevisiae.">PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae.</a> Yeast. 23, 399-405 (2006).</li><li>Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+efficient+gene+disruption+cassette+for+repeated+use+in+budding+yeast.">A new efficient gene disruption cassette for repeated use in budding yeast.</a> Nucleic acids research. 24, 2519 (1996).</li><li>Delneri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+redundancy+in+the+yeast+genome:+an+improved+strategy+for+use+of+the+cre-loxP+system.">Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system.</a> Gene. 252, 127-135 (2000).</li><li>Storici, F., Lewis, L. K., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+site-directed+mutagenesis+using+oligonucleotides.">In vivo site-directed mutagenesis using oligonucleotides.</a> Nat. Biotech. 19, 773-776 (2001).</li><li>Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+repeat+coupled+with+endonuclease+cleavage+(TREC):+a+seamless+modification+tool+for+genome+engineering+in+yeast.">Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast.</a> Nucl. Acids Res. 38, 2570-2576 (2010).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knocking+out+multigene+redundancies+via+cycles+of+sexual+assortment+and+fluorescence+selection.">Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection.</a> Nat. Methods. 8, 159-164 (2011).</li><li>Winzeler, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Characterization+of+the+S.+Genome+by+Gene+Deletion+and+Parallel+Analysis.">Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis.</a> Science. 285, 901-906 (1999).</li><li>Woods, R. A., Gietz, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+plasmid+DNA+into+yeast.">High-efficiency transformation of plasmid DNA into yeast.</a> Methods Mol. Biol. 177, 85-97 (2001).</li><li>Hughes, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+aneuploidy+revealed+by+DNA+microarray+expression+profiling.">Widespread aneuploidy revealed by DNA microarray expression profiling.</a> Nature. 25, 333-337 (2000).</li><li>Goldstein, A. L., McCusker, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+new+dominant+drug+resistance+cassettes+for+gene+disruption+in+Saccharomyces+cerevisiae.">Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.</a> Yeast. 15, 1541-1553 (1999).</li><li>Newman, J. R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+proteomic+analysis+of+S.+cerevisiae+reveals+the+architecture+of+biological+noise.">Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise.</a> Nature. 441, 840-846 (2006).</li><li>Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+regulation+at+the+single-cell+level.">Gene regulation at the single-cell level.</a> Science. 307, 1962 (2005).</li></ol>

우리가 그린 몬스터 접근 방식을 개발로서, 우리는 게놈 다시 정리하기로 이어지는, 다른 GFP 교체 카세트 사이의 재조합의 가능성에 관심을했습니다. 이 가능성에 대한 완화하는 것은 성공적으로 결합하고 세포의 감수 분열의 여러 순찰을받은 세포에 대한 선택입니다. 재 배열 genomes을 간직한 세포는 동일한 다시 정리하기없이 셀에 결합 후 더 적합 할 것으로 예상됩니다. 사실, 우리는 GFP 카세트...

<table border="1"><tbody><tr><td> 시약이나 악기의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td><td> 코멘트 (선택 사항) </td></tr><tr><td> G418 </td><td> 시그마 - 알드리치 </td><td> A1720 </td><td> (0.2-μm 필터) 물에 녹아 및 필터 - 소독. 주식 농도 : 200 밀리그램 / ML. 4 ° C.에 저장 </td></tr><tr><td> ClonNAT (nourseothricin) </td><td> 워너 BioAgents </td><td> 5001000 </td><td> (0.2-μm 필터) 물에 녹아 및 필터 - 소독. 주식 농도 : 100 밀리그램 / ML. 4 ° C.에 저장 </td></tr><tr><td> Doxycycline </td><td> 시그마 - 알드리치 </td><td> D9891 </td><td> (0.2-μm 필터) 50 % 에탄올에 용해 여과 - 소독. 주식 농도 : 10 밀리그램 / ML. 4 주마다 신선한하십시오. 4에 알루미늄 호일 및 매장을 사용하여 빛의 방패 ° C. </td></tr><tr><td> Zymolyase </td><td> ZymoResearch </td><td> E1005 </td><td></td></tr><tr><td> Difco 효모 질소 기지 w / O 아미노산 </td><td> BD </td><td> 291940 </td><td></td></tr><tr><td> 권총 (튜브 용 회전하는 것) </td><td> Labnet </td><td> H5600 </td><td></td></tr><tr><td> Enduro 젤 XL 전기 영동 장치 </td><td> Labnet </td><td> E0160 </td><td></td></tr><tr><td> Sonifier 450 </td><td> 브랜슨 </td><td> 101-063-198 </td><td></td></tr><tr><td> Sonifier 450에 대한 Microtip </td><td> 브랜슨 </td><td> 101-148-062 </td><td></td></tr><tr><td> FACSAria 셀 정렬 </td><td> BD </td><td></td><td></td></tr><tr><td> MoFlo 셀 정렬 </td><td> Beckman - 보습 바로 앞에 달린 풀 베는 날 </td><td></td><td></td></tr><tr><td> Biomek FX 또는 동급 로봇 </td><td> Beckman 보습 바로 앞에 달린 풀 베는 날 </td><td></td><td> 선택 사항입니다. genotyping의 PCRs을 설정하십시오. </td></tr></tbody> &lt;/ TABLE&gt;

the green monster process for the generation of yeast strains carrying multiple gene deletions

유전자 삭제에 대한 Phenotypes은 종종 변이가 특정 유전 배경이나 환경 조건 1,2에서 테스트하는 경우에만 공개됩니다. 많은 유전자 숨겨진 유전자의 기능에게 3,4 가면을 벗어 라하기 삭제해야 예제가 있습니다. 중요한 발견의 가능성에도 불구하고, 세 개 이상 유전자를 포함한 유전자 상호 작용은 크게 미개척 있습니다. 다중 돌연변이의 상호 작용 철저한 검색의 삭제 가능한 조합의 깎아 지른듯한 숫자로 인해 비실용적 것입니다. 그러나, 이러한 일반적인 기능을 공유 큰 사전 기회로 paralogs 세트 등 유전자,의 선택한 세트의 연구 정보를 것입니다. 효모 Saccharomyces cerevisiae에서 유전자 녹아웃는 상동 재조합을 통해 선택 마커로 유전자를 대체하여 수행됩니다. 마커의 수가 제한되어 있기 때문에, 방법은 샘을 제거하고 재사용을 위해 개발 된<html> 전자 표시 5,6,7,8,9,10. 시간이 생성 될 삭제의 수와 비늘 선형 필요하기 때문에 그러나, 이러한 방법을 사용하여 순차적으로 엔지니어링 여러 변이은 시간이 오래 걸릴 수 있습니다. 여기 정기적으로 효모 11 여러 삭제를 꾸민위한 그린 몬스터 방법을 설명합니다. 이 방법에서는, 삭제에 통합 녹색 형광 단백질 (GFP) 기자는 각 변형에 포함 된 삭제의 수 (그림 1)에 따라 양적 라벨 긴장하는 데 사용됩니다. 효모 결합 및 세포의 감수 분열을 통해 GFP-표시의 삭제 구색의 반복 라운드는 긴장의 삭제의 축적 (그림 2)로 연결이 삭제 더 많은을 가진 변종의 흐름 cytometric 강화와 결합. , 라운드 당 하나 이상의 삭제를 통합하는 각 과정, 병렬로 여러 프로세스를 수행하면 변형 건설에 필요한 시간을 줄일 수 있습니다. 내용이 &quot;&gt; 첫 번째 단계는 haploid 단일 돌연변이는 칭했다 준비하는 것입니다 &#39;ProMonsters&#39;를 GFP를 삭제 궤적에서 기자와 &#39;툴킷&#39;중 하나를 수행 각각의 loci을 하나 그린 몬스터 GMToolkit -이나 GMToolkit-α .. can1Δ 궤적 (그림 3) 효모 삭제 컬렉션 12 일부터 변종을 사용하여이 GFP-마크 삭제 편리하게 보편적 GFP을 통해 이러한 변종에 존재하는 일반적인 KanMX4 카세트 교체에 의해 생성 될 수있다 - URA3 조각을 각 GMToolkit에는 다음이 포함됩니다 중 - 또는 α-결합 형 특정 haploid 선택 마커 1과 정확히 두 GMToolkits이 존재 경우, 이하 diploids의 선택을 허용, 그런 두 마커 중 하나입니다. 두 번째 단계는 삭제 loci는 무작위 구색 및 / 또는 meiotic recomb하여 단일 세포 내에서 결합 할 수있는을 통해 성적 자전거를 수행하는 것입니다결합 및 sporulation의 각주기를 함께 ination.

네 GFP-마크 삭제합니다 (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) 수행 - haploid 변형은 네 삭제를 수행 α-haploid 변형으로 건너되었을 때 (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), 두 삭제와 (ycl033cΔ yer042wΔ)은 두 변종이 대표에서 공유 결과는 얻은 것입니다. 짝짓기 혼합물은 diploids을 선택 G418 및 NAT를 포함하는 YPDA 매체에 배양되었다. 그 결과 diploids는 sporulation 매체에 배양 하였다. 포자는 zymolyase ...

Watch this Scientific Journal Video about The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions at JoVE.com

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

그린 몬스터 방법은 리포터 유전자 인코딩 녹색 형광 단백질로 표시된 여러 삭제의 급속한 조립이 가능합니다. 이 방법은 반복 삭제의 성적 구색의 사이클 등 삭제를 들고 세포의 형광 기반의 강화를 통해 효모 변종 운전에 기반을두고 있습니다.

여러 유전자 삭제를 운반 효모 종자의 생성에 대한 초록 괴물 프로세스

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Research

JoVE Journal

Biology

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

Electroporation에 대한 Murine 골수에서 조혈 세포 차 문화의 준비

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

연구

생물학

Spinal Cord Electrophysiology

척수 전기 생리학

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

In vitro Reconstitution of the Active T. castaneum Telomerase

In vitro Reconstitution of the Active T. castaneum Telomerase

활성 T.의 체외의 Reconstitution에서 castaneum의 Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

유도 만능의 줄기 세포에서 파생 마우스의 생성

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

게놈 전체 유전자 삭제할에<em&gt; 연쇄상 구균 sanguinis</em&gt; 높은 처리량 PCR에 의한

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

함수의 연구, 상호 작용, 그리고 번역 후 수정을위한 신진 효모 단백질 추출 및 정제

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously ...

Nanogold Labeling of the Yeast Endosomal System for Ultrastructural Analyses

미세 구조의 분석을위한 효모 엔도 좀의 시스템 Nanogold 라벨링

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the ...

Isolating Potentiated Hsp104 Variants Using Yeast Proteinopathy Models

효력을 더 Hsp104 변종 사용 효모 Proteinopathy 모델을 분리

Many protein-misfolding disorders can be modeled in the budding yeast Saccharomyces cerevisiae. Proteins such as TDP-43 and FUS, implicated in amyotrophic ...

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

CRISPR / Cas9를 통해 포유 동물 세포주의 게놈에 삭제 세대

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

Applications of pHluorin for Quantitative, Kinetic and High-throughput Analysis of Endocytosis in Budding Yeast

신진 효모의 세포 내 이입의 양적, 운동 및 높은 처리량 분석을위한 pHluorin의 응용 프로그램

Green fluorescent protein (GFP) and its variants are widely used tools for studying protein localization and dynamics of events such as cytoskeletal ...