Name: genome-wide gene deletions in streptococcus sanguinis by high throughput pcr
Uploaded: 2012-11-23T13:00:00
Description: Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Dit werk werd ondersteund door subsidies R01DE018138 van de National Institutes of Health (PX) en gedeeltelijk door Virginia Commonwealth University Presidential Research Incentive Program (PRIP) 144.602-3 (PX). Wij danken Drs. Lei Chen, Yuetan Dou en Xiaojing Wang voor het assisteren bij de bouw van genoom brede mutanten. We danken ook de DNA-Core Facility in Virginia Commonwealth University voor DNA-sequencing.

1. Primer ontwerp <ol><li> Primers zijn ontworpen met behulp huis scripts gebaseerd op de S. sanguinis SK36 genoomsequentie. Drie sets van primers, F1/R1, F2/R2 en F3/R3 zijn ontworpen voor amplificatie van de 1-kb stroomopwaartse sequentie van het doelwitgen, de APHA-3 gen dat codeert voor kanamycine resistentie (Km r) eiwit 3 en de 1 -kb stroomafwaartse sequentie van het doelwitgen, respectievelijk (Figuur 1). Van deze primers wordt F1 en R3 ontworpen met ePri...

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

Om de mogelijke polaire effecten van de vervanging van een targetgen met exogeen gen antibiotica op naburige genen minimaliseren, worden twee stappen terwijl de initiële primer ontwerpen. Voor de meeste van verwijderde genen, de primers R1 en F3 om de coderende regio 6 bp verwijderen na het startcodon tot 30 bp vóór het stopcodon. De laatste 30 basenparen vastgehouden mogelijke ribosomale bindingsplaats die de aangrenzende downstream gen beschermen. De bewaarde gebied tussen twee naburige genen wordt uitgebreid tot 1...

<table border="1">
	<tbody>
 <tr>
 <td>Names</td>
 <td>Company</td>
 <td>Catalog#</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>Primer F2</td>
 <td>Integrated DNA Technologies</td>
 <td></td>
 <td>TGACTAACTAGGAGGAATAAATG GCTAAAATGAGAATAT</td>
 </tr>
 <tr>
 <td>Primer R2</td>
 <td>ibid</td>
 <td></td>
 <td>CATTATTCCCTCCAGGTACTAAAA CAATTCATCCAGT</td>
 </tr>
 <tr>
 <td>Primer F2p</td>
 <td>ibid</td>
 <td></td>
 <td>GATAAACCCAGCGAACCATTTGA</td>
 </tr>
 <tr>
 <td>Primer P1</td>
 <td>ibid</td>
 <td></td>
 <td>GCTTATATACCTTAGCAGGAGACA</td>
 </tr>
 <tr>
 <td>Primer P2</td>
 <td>ibid</td>
 <td></td>
 <td>GTATGACATTGCCTTCTGCGTCC</td>
 </tr>
 <tr>
 <td>Primer 5' end_R1_seq</td>
 <td>ibid</td>
 <td></td>
 <td>GCCATTTATTCCTCCTAGTTAGTCA</td>
 </tr>
 <tr>
 <td>Primer 5' end_F3_seq</td>
 <td>ibid</td>
 <td></td>
 <td>GTTTTAGTACCTGGAGGGAATAATG</td>
 </tr>
 <tr>
 <td>Primer 5' end_R1p_seq</td>
 <td>ibid</td>
 <td></td>
 <td>CCTCAAATGGTTCGCTGGGTTTATC</td>
 </tr>
 <tr>
 <td>CSP</td>
 <td>Synprep</td>
 <td></td>
 <td>Sequence:NH2-DLRGVPNPWGWIFGR-COOH</td>
 </tr>
 <tr>
 <td>DNA Polymerase </td>
 <td>Invitrogen</td>
 <td>11304-102</td>
 <td>Platinum Taq DNA Polymerase High Fidelity</td>
 </tr>
 <tr>
 <td>EcoRI</td>
 <td>New England Biolabs Inc</td>
 <td>R0101S</td>
 <td>Restriction enzyme</td>
 </tr>
 <tr>
 <td>Agar</td>
 <td>American Bioanalytical</td>
 <td>AB01185</td>
 <td></td>
 </tr>
 <tr>
 <td>Agarose</td>
 <td>Promega</td>
 <td>V3125</td>
 <td></td>
 </tr>
 <tr>
 <td>BHI</td>
 <td>BD Biosciences </td>
 <td>237500</td>
 <td>Brain Heart Infusion</td>
 </tr>
 <tr>
 <td>Horse serum</td>
 <td>Fisher Scientific</td>
 <td>SH3007403</td>
 <td>Horse serum</td>
 </tr>
 <tr>
 <td>Km</td>
 <td>Fisher Scientific</td>
 <td>BP906-5</td>
 <td>Kanamycin</td>
 </tr>
 <tr>
 <td>TH broth</td>
 <td>BD Biosciences </td>
 <td>249240</td>
 <td>Todd Hewitt broth</td>
 </tr>
 <tr>
 <td>PureLink 96</td>
 <td>Invitrogen</td>
 <td>K310096</td>
 <td>PureLink 96 PCR purification kit</td>
 </tr>
 <tr>
 <td>QIAquick</td>
 <td>Qiagen</td>
 <td>28106</td>
 <td>QIAquick PCR purification kit</td>
 </tr>
 <tr>
 <td>Filter</td>
 <td>Corning</td>
 <td>431117</td>
 <td>0.22 &mu;m polystyrene filter</td>
 </tr>
 <tr>
 <td>Anoxomat System</td>
 <td>Mart Microbiology b.v.</td>
 <td>Anoxomat Mark II</td>
 <td></td>
 </tr>
 <tr>
 <td>Benchtop centrifuge</td>
 <td>Thermo Scientific</td>
 <td>75004377</td>
 <td>Sorvall Legend RT Plus microplate rotor</td>
 </tr>
 <tr>
 <td>Gel Documentation</td>
 <td>UVP LLC</td>
 <td>BioDoc-It 210</td>
 <td></td>
 </tr>
 <tr>
 <td>Incubator</td>
 <td>Fisher Scientific</td>
 <td>11-690-625D</td>
 <td>Isotemp </td>
 </tr>
 <tr>
 <td>Labnet's Gel XL</td>
 <td>Labnet</td>
 <td>E0160</td>
 <td>Labnet's Gel XL</td>
 </tr>
 <tr>
 <td>Microcentrifuge</td>
 <td>Eppendorf</td>
 <td>22621408</td>
 <td>Microcentrifuge 5415 R</td>
 </tr>
 <tr>
 <td>Multichannel pipettes</td>
 <td>Thermo Scientfic</td>
 <td>4661040, 4661020</td>
 <td>Finnpipette F1</td>
 </tr>
 <tr>
 <td>Thermal Cycler</td>
 <td>Applied Biosystems Inc.</td>
 <td>N805-0200</td>
 <td>GeneAmp PCR system 9700</td>
 </tr>
	 </tbody>
 </table>

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Transposon mutagenese en single-gendeletie zijn twee methoden toegepast genoom knockout in bacteriën 1,2. Hoewel transposon mutagenese is minder tijdrovend, minder duur en vereist geen voltooid genoominformatie zijn er twee zwakke punten in deze werkwijze: (1) de mogelijkheid van een heterogene mutanten in de gemengde mutant bibliotheek die tegen de mutanten geselecteerd met verminderde concurrentie; en (2) de mogelijkheid van gedeeltelijke geninactivering waarbij genen niet geheel verliezen hun functie na het inbrengen van een transposon. Single-gendeletie analyse kan compenseren voor de nadelen van transposon mutagenese. Om de efficiëntie van genoom-brede enkele gendeletie te verbeteren, proberen we een high-throughput techniek voor genoom-wijde enkele gendeletie met Streptococcus sanguinis als een model organisme. Elk gen in S. deletieconstruct sanguinis genoom ontworpen om 1 omvat-Kb stroomopwaarts van het targetgen, de APHA-3-gen, dat codeert voor kanamycine resistentie-eiwit, en 1 kb stroomafwaarts van het targetgen. Drie sets van primers F1/R1, F2/R2 en F3/R3 respectievelijk zijn ontworpen en gesynthetiseerd in een 96-well plaat formaat voor PCR-amplificaties van deze drie componenten van elke deletieconstruct. Primers R1 en F3 bevatten 25-bp sequenties die complementair zijn aan gebieden van de APHA-3 gen einde hun 5&#39;. Een grootschalige PCR amplificatie van de APHA-3 gen wordt eenmaal uitgevoerd voor het maken van alle enkel gen deletieconstructen. De promotor van APHA-3 gen aanvankelijk niet het potentiële effect van kanamycine polaire cassette minimaliseren. De gendeletie constructies te realiseren, worden high-throughput PCR amplificatie en zuivering uitgevoerd in een 96-well plaat formaat. Een lineaire recombinant PCR amplicon voor elk gen deletie wordt samengesteld door vier PCR-reacties met high-fidelity DNA polymerase. De initiële exponpreferentiële groeifase van S. sanguinis gekweekt in Todd Hewitt bouillon aangevuld met 2,5% geïnactiveerd paardenserum wordt de bekwaamheid verhogen voor de transformatie van PCR-recombinant constructen. Onder deze voorwaarde, tot 20% van S. sanguinis cellen kunnen worden getransformeerd met ~ 50 ng DNA. Op basis van deze benadering werden 2.048 mutanten met enkele gendeletie uiteindelijk verkregen uit de 2.270 genen in S. sanguinis met uitzondering van vier gen ORFs die volledig binnen andere ORFs in S. sanguinis SK36 en 218 potentiële essentiële genen. De techniek voor het maken gendeletie constructen high throughput en kan gemakkelijk in genoom gen deleties gebruiken voor transformeerbaar bacteriën.

After PCR amplification using primers F1 and R1, and F3 and R3, approximately 1-kb upstream and downstream of each S. sanguinis gene were obtained in 96-well format, respectively (Figure 2A). Under our PCR conditions and using designed primers, a specific product was amplified from S. sanguinis genomic DNA in each PCR reaction. This result indicated the primers were highly specific to the targets of S. sanguinis. Through PCR re-amplification using primers F1 and R3 and t...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Een efficiënte genoom-brede enkel gen mutatie methode is vastgesteld aan de hand<em&gt; Streptococcus sanguinis</em&gt; Als modelorganisme. Deze methode heeft bereikt via high throughput recombinant PCRs en transformaties.

Genoom-brede gendeleties in<em&gt; Streptococcus sanguinis</em&gt; Door High Throughput PCR

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Genoom-brede analyse met behulp van chip Isoform-specifieke Gene targets te identificeren

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

Genoom-brede scherm voor miRNA Doelen Met behulp van de MISSION Target ID Bibliotheek

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

Kwantitatieve en geautomatiseerde high-throughput genoomwijde RNAi schermen in C. elegans</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Snelle en efficiënte zebravis Genotyping Met behulp van PCR met een hoge resolutie Melt Analyse

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Profilering Individuele menselijke embryonale stamcellen door kwantitatieve RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

Genoom-brede Eiwit-eiwit Interactie Screening door Eiwit-fragment Complementatie Assay (PCA) in levende cellen

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

High-throughput screening voor Chemische Modulators van Post-transcriptioneel gereguleerde genen

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

qPCRTag Analyse - Een High Throughput, Real Time PCR test voor Sc2.0 genotypering

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Genoombrede kartering van Drug-DNA interacties in cellen met kosmische (Crosslinking van kleine moleculen te isoleren chromatine)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

Damid-seq: Genoom-brede kaart brengen van eiwit-DNA-interacties door High Throughput Sequencing van adenine gemethyleerd DNA-fragmenten

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...