Name: genome-wide gene deletions in streptococcus sanguinis by high throughput pcr
Uploaded: 2012-11-23T13:00:00
Description: Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

עבודה זו נתמכה על ידי מענקי R01DE018138 מהמכונים הלאומיים לבריאות (PX), ובחלקו, על ידי תכנית אוניברסיטת וירג&#39;יניה הנשיאותית מחקר תמריץ (PRIP) 144602-3 (PX). אנו מודים לבני זוג. ליי חן, Yuetan Dou וXiaojing ואנג לסיוע בבנייה של מוטציות רחבות הגנום. אנו מודים גם למתקן ליבת ה-DNA באוניברסיטת וירג&#39;יניה לרצפי DNA.

1. עיצוב פריימר <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> Primers תוכנן באמצעות תסריטים בבית המבוסס על ס רצף הגנום sanguinis SK36. שלושה זוגות של פריימרים, F1/R1, F2/R2, וF3/R3 מיועדים להגברה של רצף 1-kb במעלה הזרם של גן המטרה, התנגדות APHA-3 גן קידוד kanamycin (הק&quot;מ R)</su...

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

כדי למזער את ההשפעות האפשריות של קוטב החלפת הגן ממוקד אחד עם אנטיביוטיקת גן אקסוגני בגנים סמוכים, שני צעדים נלקחים תוך פריימר הראשוני בעיצוב. עבור רוב הגנים שנמחקו, פריימרים R1 ו F3 נועדו למחוק את אזור קידוד מ6 נ&quot;ב לאחר קודון התחילה ועד 30 נ&quot;ב לפני קודון העצירה. את 30 ז...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; שמות</strong</td&gt;<td<strong&gt; חברה</strong</td&gt;<td<strong&gt; קטלוג #</strong</td&gt;<td<strong&gt; תגובות (אופציונלי)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; פריימר F2</td&gt;<td&gt; משולבות טכנולוגיות ה-DNA</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<td&gt; R2 פריימר</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<td&gt; פריימר F2P</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<td&gt; P1 פריימר</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<td&gt; P2 פריימר</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; פריימר 5 &#39;end_R1_seq</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; פריימר 5 &#39;end_F3_seq</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; פריימר 5 &#39;end_R1p_seq</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; רצף: NH2-DLRGVPNPWGWIFGR-COOH</td&gt;</tr&gt;<tr&gt;<td&gt; פולימראז ה-DNA</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; 11304-102</td&gt;<td&gt; פלטינום תקי פולימראז ה-DNA נאמנות גבוהה</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; ניו אינגלנד Biolabs Inc</td&gt;<td&gt; R0101S</td&gt;<td&gt; אנזים הגבלה</td&gt;</tr&gt;<tr&gt;<td&gt; אגר</td&gt;<td&gt; אמריקאי Bioanalytical</td&gt;<td&gt; AB01185</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Agarose</td&gt;<td&gt; Promega</td&gt;<td&gt; V3125</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 237500</td&gt;<td&gt; עירוי לב המוח</td&gt;</tr&gt;<tr&gt;<td&gt; סוס סרום</td&gt;<td&gt; הפישר סיינטיפיק</td&gt;<td&gt; SH3007403</td&gt;<td&gt; סוס סרום</td&gt;</tr&gt;<tr&gt;<td&gt; ק&quot;מ</td&gt;<td&gt; הפישר סיינטיפיק</td&gt;<td&gt; BP906-5</td&gt;<td&gt; Kanamycin</td&gt;</tr&gt;<tr&gt;<td&gt; TH מרק</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 249240</td&gt;<td&gt; טוד יואיט מרק</td&gt;</tr&gt;<tr&gt;<td&gt; PureLink 96</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; K310096</td&gt;<td&gt; PureLink 96 ערכת טיהור PCR</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; Qiagen</td&gt;<td&gt; 28106</td&gt;<td&gt; ערכת טיהור PCR QIAquick</td&gt;</tr&gt;<tr&gt;<td&gt; סינון</td&gt;<td&gt; קורנינג</td&gt;<td&gt; 431117</td&gt;<td&gt; מסנן קלקר מיקרומטר 0.22</td&gt;</tr&gt;<tr&gt;<td&gt; Anoxomat מערכת</td&gt;<td&gt; מארט מיקרוביולוגיה bv</td&gt;<td&gt; Anoxomat Mark II</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; צנטריפוגה Benchtop</td&gt;<td&gt; Thermo Scientific</td&gt;<td&gt; 75004377</td&gt;<td&gt; Sorvall מקרא RT פלוס microplate הרוטור</td&gt;</tr&gt;<tr&gt;<td&gt; תיעוד ג&#39;ל</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc-זה 210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; חממה</td&gt;<td&gt; הפישר סיינטיפיק</td&gt;<td&gt; 11-690-625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; של Labnet ג&#39;ל XL</td&gt;<td&gt; Labnet</td&gt;<td&gt; E0160</td&gt;<td&gt; של Labnet ג&#39;ל XL</td&gt;</tr&gt;<tr&gt;<td&gt; Microcentrifuge</td&gt;<td&gt; אפנדורף</td&gt;<td&gt; 22621408</td&gt;<td&gt; 5415 R microcentrifuge</td&gt;</tr&gt;<tr&gt;<td&gt; Pipettes רב</td&gt;<td&gt; Thermo Scientfic</td&gt;<td&gt; 4661040, 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; Cycler תרמית</td&gt;<td&gt; יישומי BioSystems בע&quot;מ</td&gt;<td&gt; N805-0200</td&gt;<td&gt; GeneAmp PCR מערכת 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Transposon mutagenesis ומחיקה של גן היחיד הם שתי שיטות שיושמו בנוקאאוט גן גנום רחב ב1,2 חיידקים. למרות mutagenesis transposon הוא פחות זמן רב, יקר פחות, ואינו דורש מידע הגנום הושלם, יש שתי חולשות בשיטה זו: (1) האפשרות של מוטציות שונות בספריית המוטציה המעורבת שנגד בוחרת מוטנטים עם תחרות ירד; ו (2) האפשרות של איון גן החלקי לפיו גנים לא לגמרי מאבדת את תפקודם לאחר החדרת transposon. ניתוח מחיקה של הגן יחיד עשוי לפצות על חסרונות הקשורים mutagenesis transposon. כדי לשפר את היעילות של מחיקה הגנום בודדה גן, אנו מנסים להקים טכניקת תפוקה גבוהה למחיקת גן יחידה הגנום באמצעות sanguinis Streptococcus כאורגניזם מודל. כל מחיקת גן לבנות בס sanguinis הגנום נועד מהווה 1-KB זרם של הגן הממוקד, גן APHA-3, חלבון התנגדות kanamycin קידוד, או במורד 1-KB של הגן הממוקד. שלושה זוגות של פריימרים F1/R1, F2/R2, וF3/R3, בהתאמה, מתוכננים ומסונתזים בפורמט צלחת 96-גם ל- amplifications PCR של שלושה המרכיבים האלה של כל מחיקה להקים. Primers R1 ו F3 מכילים רצפי 25-BP שמשלימים לאזורים של-3 APHA הגן בקצה 5 &#39;שלהם. הגברת PCR קנה מידה גדולה של-3 APHA הגן מתבצעת פעם אחת ליצירה כל מבני המחיקה בגן בודד. האמרגן של גן APHA-3 בתחילה הוצא כדי למזער את ההשפעה הפוטנציאלית של קוטב קלטת kanamycin. כדי ליצור מבני מחיקת הגן, הגברת תפוקה גבוהה PCR וטיהור מבוצעות בפורמט צלחת 96-כן. Amplicon PCR רקומביננטי יניארית לכל מחיקת גן יהיה מורכב באמצעות ארבע תגובות PCR באמצעות DNA פולימראז באיכות גבוהה. Expon הראשונישלב הצמיחה ential של ס &#39; sanguinis תרבית בטוד יואיט מרק בתוספת 2.5% סרום סוס מומת משמש כדי להגדיל את היכולת של שינוי מבני PCR-רקומביננטי. תחת תנאי זה, עד 20% של ס &#39; תאי sanguinis ניתן להפוך באמצעות ~ 50 ng של DNA. בהתבסס על גישה זו, 2048 מוטנטים עם מחיקת גן יחיד סופו של דבר התקבלו מ2270 הגנים בס sanguinis למעט 4 ORFs גנים כלולים כולו בתוך ORFs האחר בס sanguinis SK36 ו218 גנים חיוניים פוטנציאליים. הטכניקה ביצירת מבני מחיקת גן היא תפוקה גבוהה ויכולה להיות קל לשימוש במחיקות גן יחידות הגנום לכל חיידקי transformable.

After PCR amplification using primers F1 and R1, and F3 and R3, approximately 1-kb upstream and downstream of each S. sanguinis gene were obtained in 96-well format, respectively (Figure 2A). Under our PCR conditions and using designed primers, a specific product was amplified from S. sanguinis genomic DNA in each PCR reaction. This result indicated the primers were highly specific to the targets of S. sanguinis. Through PCR re-amplification using primers F1 and R3 and t...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

שיטה יעילה הגנום בודדה גן מוטציה כבר נקבעה באמצעות<em&gt; סטרפטוקוקוס sanguinis</em&gt; כאורגניזם מודל. שיטה זו השיגה דרך PCRs גבוה התפוקה רקומביננטי ותמורות.

מחיקות Gene הגנום ב<em&gt; סטרפטוקוקוס sanguinis</em&gt; על ידי תפוקה הגבוהה PCR

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

הגנום כולו ניתוח באמצעות שבב זיהוי איזופורם ספציפי מטרות ג&#39;ין

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

הגנום כולו מסך עבור מטרות מירנה שימוש יעד המשימה ספריית מזהה

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

כמותיים אוטומטי תפוקה גבוהה הגנום כולו RNAi המסכים ג elegans</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

מהירה ויעילה דג הזברה Genotyping באמצעות PCR עם רזולוציה גבוהה ממיסים ניתוח

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

אפיון תאי גזע עוברי האנושי על ידי הפרט כמותי RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

הקרנת הגנום כל חלבונים אינטראקציה ידי חלבון-בר השלמה Assay (PCA) בתאים חיים

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

הקרנת תפוקה גבוהה עבור כימית מאפננים של גני Post-תעתיק מוסדר

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

qPCRTag ניתוח - תפוקה גבוהה, בזמן אמת PCR Assay עבור Genotyping Sc2.0

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

מיפוי הגנום של תרופות-DNA בתאי אינטראקציות עם COSMIC (Crosslinking של מולקולות קטנות לבודד הכרומטין)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

DamID-seq: מיפוי הגנום של אינטראקציות החלבון-DNA על ידי תפוקה גבוהה רצף של קטעי DNA-מפוגל אדנין

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...