Name: genome-wide gene deletions in streptococcus sanguinis by high throughput pcr
Uploaded: 2012-11-23T13:00:00
Description: Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

इस काम R01DE018138 स्वास्थ्य (PX) के राष्ट्रीय संस्थानों से अनुदान और भाग में समर्थित किया गया था, वर्जीनिया कॉमनवेल्थ विश्वविद्यालय राष्ट्रपति रिसर्च प्रोत्साहन कार्यक्रम (PRIP) 144602-3 (px). हम डीआरएस धन्यवाद. Lei चेन, Yuetan दोगुनी और जीनोम चौड़ा म्यूटेंट के निर्माण के साथ सहायता के लिए वैंग Xiaojing. हम भी वर्जीनिया कॉमनवेल्थ विश्वविद्यालय में डीएनए अनुक्रमण के लिए डीएनए कोर सुविधा धन्यवाद.

1. प्रथम डिजाइन <ol><li> प्राइमर्स एस के आधार पर घर लिपियों में उपयोग के लिए डिज़ाइन कर रहे हैं sanguinis SK36 जीनोम अनुक्रम. प्राइमरों, F1/R1, F2/R2, और F3/R3 के तीन सेट 1 केबी लक्ष्य जीन, जीन एन्कोडिंग APHA-3 केनामाइसिन (कि....

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

पड़ोसी जीन पर exogenous एंटीबायोटिक दवाओं जीन के साथ एक लक्षित जीन के प्रतिस्थापन के संभव ध्रुवीय प्रभाव को कम करने के लिए, दो कदम जबकि प्रारंभिक प्राइमर डिजाइन ले रहे हैं. हटाए गए जीनों के अधिकांश के लिए, प्र...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; नाम</strong</td&gt;<td<strong&gt; कंपनी</strong</td&gt;<td<strong&gt; कैटलॉग</strong</td&gt;<td<strong&gt; (वैकल्पिक)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; प्राइमर F2</td&gt;<td&gt; एकीकृत डीएनए टेक्नोलॉजीज</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<td&gt; प्राइमर R2</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<td&gt; प्राइमर F2P</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<td&gt; प्राइमर P1</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<td&gt; प्राइमर P2</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; 5 प्राइमर &#39;end_R1_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; 5 प्राइमर &#39;end_F3_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; 5 प्राइमर &#39;end_R1p_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; अनुक्रम NH2-DLRGVPNPWGWIFGR-COOH</td&gt;</tr&gt;<tr&gt;<td&gt; डीएनए पोलीमरेज़</td&gt;<td&gt; Invitrogen</td&gt;<td11304-102&gt;</td&gt;<td&gt; प्लेटिनम Taq डीएनए पोलीमरेज़ उच्च फिडेलिटी</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; न्यू इंग्लैंड Biolabs इंक</td&gt;<td&gt; R0101S</td&gt;<td&gt; प्रतिबंध एंजाइम</td&gt;</tr&gt;<tr&gt;<td&gt; अग्रवाल</td&gt;<td&gt; Bioanalytical अमेरिकन</td&gt;<tdAB01185&gt;</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Agarose</td&gt;<td&gt; PROMEGA</td&gt;<tdV3125&gt;</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; बी.डी. बायोसाइंसेज</td&gt;<td237500&gt;</td&gt;<td&gt; मस्तिष्क, हृदय आसव</td&gt;</tr&gt;<tr&gt;<td&gt; हार्स सीरम</td&gt;<td&gt; फिशर साइंटिफिक</td&gt;<tdSH3007403&gt;</td&gt;<td&gt; हार्स सीरम</td&gt;</tr&gt;<tr&gt;<td&gt; किमी</td&gt;<td&gt; फिशर साइंटिफिक</td&gt;<td&gt; BP906-5</td&gt;<td&gt; केनामाइसिन</td&gt;</tr&gt;<tr&gt;<td&gt; TH शोरबा</td&gt;<td&gt; बी.डी. बायोसाइंसेज</td&gt;<td249240&gt;</td&gt;<td&gt; टोड हेविट शोरबा</td&gt;</tr&gt;<tr&gt;<td&gt; 96 PureLink</td&gt;<td&gt; Invitrogen</td&gt;<tdK310096&gt;</td&gt;<td&gt; 96 पीसीआर शुद्धि किट PureLink</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; Qiagen</td&gt;<td28106&gt;</td&gt;<td&gt; QIAquick पीसीआर शुद्धि किट</td&gt;</tr&gt;<tr&gt;<td&gt; फिल्टर</td&gt;<td&gt; Corning</td&gt;<td431117&gt;</td&gt;<td&gt; 0.22 सुक्ष्ममापी polystyrene फिल्टर</td&gt;</tr&gt;<tr&gt;<td&gt; Anoxomat सिस्टम</td&gt;<td&gt; मार्ट माईक्रोबायोलॉजी bv</td&gt;<td&gt; Anoxomat मार्क द्वितीय</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Benchtop अपकेंद्रित्र</td&gt;<td&gt; थर्मो वैज्ञानिक</td&gt;<td75004377&gt;</td&gt;<td&gt; Sorvall लीजेंड आरटी प्लस microplate रोटर</td&gt;</tr&gt;<tr&gt;<td&gt; जेल प्रलेखन</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc यह-210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; इनक्यूबेटर</td&gt;<td&gt; फिशर साइंटिफिक</td&gt;<td&gt; 11 690 625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; Labnet जेल एक्स्ट्रा लार्ज</td&gt;<td&gt; Labnet</td&gt;<tdE0160&gt;</td&gt;<td&gt; Labnet जेल एक्स्ट्रा लार्ज</td&gt;</tr&gt;<tr&gt;<td&gt; Microcentrifuge</td&gt;<td&gt; Eppendorf</td&gt;<td22621408&gt;</td&gt;<td&gt; Microcentrifuge आर 5415</td&gt;</tr&gt;<tr&gt;<td&gt; Multichannel pipettes</td&gt;<td&gt; थर्मो Scientfic</td&gt;<td&gt; 4661040, 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; थर्मल cycler</td&gt;<td&gt; एप्लाइड Biosystems इंक</td&gt;<td&gt; N805 0200</td&gt;<td&gt; GeneAmp पीसीआर प्रणाली 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

बाद पीसीआर प्रवर्धन प्राइमरों F1 और R1 का उपयोग करते हुए, और F3 और R3, लगभग 1-केबी नदी के ऊपर और प्रत्येक एस के नीचे sanguinis जीन 96-प्रारूप, क्रमशः (2A चित्रा) में प्राप्त किया गया. हमारे पीसीआर शर्तों और का ...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

एक कुशल जीनोम चौड़ा एक जीन उत्परिवर्तन विधि का उपयोग कर स्थापित किया गया है<em&gt; Streptococcus sanguinis</em&gt; एक मॉडल जीव के रूप में. इस विधि उच्च throughput रीकॉम्बीनैंट PCRs और परिवर्तनों के माध्यम से हासिल किया गया है.

जीनोम चौड़ा जीन में विलोपन<em&gt; Streptococcus sanguinis</em&gt; उच्च Throughput पीसीआर द्वारा

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

जीनोम चौड़ा चिप का उपयोग isoform विशेष जीन लक्ष्य पहचानें विश्लेषण

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

MiRNA मिशन लक्ष्य आईडी पुस्तकालय का उपयोग लक्ष्य के लिए जीनोम चौड़ा स्क्रीन

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

मात्रात्मक और स्वचालित उच्च throughput जीनोम चौड़ा में आरएनएआई स्क्रीन के सी. एलिगेंस</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

उच्च संकल्प पिघल विश्लेषण के साथ पीसीआर का उपयोग तेजी से और कुशल Zebrafish जीनोटाइपिंग

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

मात्रात्मक RT-पीसीआर से व्यक्ति मानव भ्रूण स्टेम कोशिकाओं की रूपरेखा

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

जीवित कोशिकाओं में प्रोटीन-टुकड़ा complementation परख (पीसीए) द्वारा जीनोम चौड़ा प्रोटीन प्रोटीन सहभागिता स्क्रीनिंग

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

पोस्ट-transcriptionally विनियमित जीन का रासायनिक Modulators के लिए उच्च throughput स्क्रीनिंग

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

qPCRTag विश्लेषण - एक उच्च Throughput, Sc2.0 जीनोटाइपिंग के लिए वास्तविक समय पीसीआर परख

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

लौकिक के साथ कोशिकाओं में ड्रग-डीएनए सहभागिता के जीनोम चौड़ा मानचित्रण (छोटे अणुओं की crosslinking Chromatin को अलग करने के लिए)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

DamID-सेक: Adenine-methylated डीएनए टुकड़े के उच्च throughput अनुक्रमण द्वारा प्रोटीन डीएनए सहभागिता के जीनोम चौड़ा मानचित्रण

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...