Name: genome-wide gene deletions in streptococcus sanguinis by high throughput pcr
Uploaded: 2012-11-23T13:00:00
Description: Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

이 작품은 버지니아 커먼 웰스 대학의 대통령 연구 인센티브 프로그램 (PRIP) 144602-3 (PX)에 의해, 건강 (PX)의 국립 연구소에서 보조금 R01DE018138 의해 부분적으로 지원되었다. 우리는 Drs 감사드립니다. 레이 첸, 게놈 전체 돌연변이의 건설을 지원에 Yuetan쪽으로 앉아야하고 왕을 Xiaojing. 우리는 또한 DNA 배열을 위해 버지니아 커먼 웰스 대학에서 DNA 핵심 시설 감사드립니다.

1. 프라이머 디자인 <ol><li> 프리 머은 S.에 따라 집 스크립트에서 사용 설계되어 있습니다 sanguinis SK36 게놈 시퀀스. 프리 머, F1/R1, F2/R2, 그리고 F3/R3 세 세트 대상 유전자 aphA-3 유전자 인코딩 kanamycin 저항 (km R) 단백질 (3) 및 (1)의 1 킬로바이트 상류 시퀀스의 증폭을 위해 설계되었습니다 각각 대상 유전자의-KB 하류 순서 (그림 1). 이러한 프리 머 가운...

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

초기 뇌관이 설계하면서 이웃 유전자에 대한 외인성 항생제 유전자과 하나가 타겟 유전자의 교체 가능한 극성 효과를 최소화하기 위해 두 단계 이동합니다. 삭제 된 유전자의 대부분은 프리 머 R1과 F3는 사전 정지 코돈 30 BP로 시작 코돈에 따라 6 BP에서 코딩 영역을 삭제할 수 있도록 설계되었습니다. 지난 30 기본 쌍은 인접 하류 유전자에 의해 사용 가능성 ribosomal 구속력이 사이트를 보호하기 위?...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; 이름</strong</td&gt;<td<strong&gt; 회사 소개</strong</td&gt;<td<strong&gt; 카탈로그 #</strong</td&gt;<td<strong&gt; 코멘트 (선택 사항)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 F2</td&gt;<td&gt; 통합 DNA 기술</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 R2</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 F2p</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 P1</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 P2</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 5 &#39;end_R1_seq</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 5 &#39;end_F3_seq</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 5 &#39;end_R1p_seq</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; 순서 : NH2-DLRGVPNPWGWIFGR-COOH</td&gt;</tr&gt;<tr&gt;<td&gt; DNA의 중합 효소</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; 11304-102</td&gt;<td&gt; 플래티넘 DNA 형성 촉매 효소 DNA 고 충실도</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; 뉴 잉글랜드 Biolabs 주식회사</td&gt;<td&gt; R0101S</td&gt;<td&gt; 제한 효소</td&gt;</tr&gt;<tr&gt;<td&gt; 한천</td&gt;<tdBioanalytical&gt; 미국</td&gt;<td&gt; AB01185</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; 아가로 오스</td&gt;<td&gt; Promega</td&gt;<td&gt; V3125</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 237500</td&gt;<td&gt; 뇌 하트 주입</td&gt;</tr&gt;<tr&gt;<td&gt; 말 혈청</td&gt;<td&gt; 피셔 과학</td&gt;<td&gt; SH3007403</td&gt;<td&gt; 말 혈청</td&gt;</tr&gt;<tr&gt;<td&gt; km</td&gt;<td&gt; 피셔 과학</td&gt;<td&gt; BP906-5</td&gt;<td&gt; Kanamycin</td&gt;</tr&gt;<tr&gt;<td&gt; TH 국물</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 249240</td&gt;<td&gt; 토드 휴이트 국물</td&gt;</tr&gt;<tr&gt;<td&gt; PureLink 96</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; K310096</td&gt;<td&gt; PureLink 96 PCR 정화 키트</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; Qiagen</td&gt;<td&gt; 28,106</td&gt;<td&gt; QIAquick PCR 정화 키트</td&gt;</tr&gt;<tr&gt;<td&gt; 필터</td&gt;<td&gt; 코닝</td&gt;<td&gt; 431117</td&gt;<td&gt; 0.22 μm의 폴리스티렌 필터</td&gt;</tr&gt;<tr&gt;<td&gt; Anoxomat 시스템</td&gt;<td&gt; 마트 미생물 BV</td&gt;<td&gt; Anoxomat 마크 II</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Benchtop의 원심 분리기</td&gt;<td&gt; 열 과학</td&gt;<td&gt; 75004377</td&gt;<td&gt; Sorvall 전설 RT 플러스 microplate 회</td&gt;</tr&gt;<tr&gt;<td&gt; 젤 문서</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc - 이건 210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; 보육</td&gt;<td&gt; 피셔 과학</td&gt;<td&gt; 11-690 - 625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; Labnet의 젤 XL</td&gt;<td&gt; Labnet</td&gt;<td&gt; E0160</td&gt;<td&gt; Labnet의 젤 XL</td&gt;</tr&gt;<tr&gt;<td&gt; Microcentrifuge</td&gt;<td&gt; Eppendorf</td&gt;<td&gt; 22621408</td&gt;<td&gt; Microcentrifuge 5415 R</td&gt;</tr&gt;<tr&gt;<td&gt; 멀티 채널 피펫</td&gt;<td&gt; 열 Scientfic</td&gt;<td&gt; 4661040, 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; 열 자전거 타는 사람</td&gt;<td&gt; 응용 Biosystems 주식회사</td&gt;<td&gt; N805-0200</td&gt;<td&gt; GeneAmp PCR 시스템 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Transposon mutagenesis 및 단일 유전자 삭제 박테리아 1,2의 게놈 전체 유전자 녹아웃에 적용된 두 가지 방법이 있습니다. transposon의 mutagenesis이 적은 시간이 소요 적은 비용이 많이 드는, 그리고 완성 된 게놈 정보를 요구하지 않습니다하지만,이 방법은 두 약점이 있습니다 : 감소 경쟁과 뮤턴트 카운터 선택하는 혼합 돌연변이 라이브러리의 서로 다른 돌연변이 (1) 가능성, (2) 일부 유전자 불 활성화의 가능성은 상기 유전자가 완전히 transposon의 삽입에 따라 자신의 기능을 잃게하지 않습니다. 단일 유전자 삭제 분석 transposon의 mutagenesis와 관련된 단점을 보완 할 수 있습니다. 게놈 전체의 단일 유전자 삭제의 효율성을 개선하기 위해, 우리는 모델 생물로 연쇄상 구균의 sanguinis를 사용하여 게놈 전체의 단일 유전자 삭제에 대한 높은 처리량 기술을 확립하려고합니다. 각 유전자 삭제 S.에 구축 sanguinis 게놈는 1을 구성하도록 설계되었습니다타겟 유전자 aphA-3 유전자 인코딩 kanamycin 저항 단백질, 그리고 타겟 유전자의 1 이하 하류-KB 상류. 프리 머 F1/R1, F2/R2, 그리고 F3/R3 세 세트를 각각 설계, 각 삭제 그 세 가지 구성 요소 구성의 PCR-amplifications을위한 96 - 웰 플레이트 형식으로 합성됩니다. 프리 머 R1과 F3는 5 &#39;끝 부분에있는 aphA-3 유전자의 지역에 보완 25 BP 시퀀스가 포함되어 있습니다. aphA-3 유전자의 대규모 PCR 증폭은 모든 단일 유전자 삭제 구조를 만드는 한 번 수행됩니다. aphA-3 유전자의 프로모터는 처음 kanamycin 카세트의 잠재력 극성 효과를 최소화하기 위해 제외됩니다. 유전자 삭제 구조를 만들려면, 높은 처리량 PCR의 증폭 및 정화는 96 - 웰 플레이트 형식으로 수행됩니다. 각 유전자 삭제에 대한 선형 재조합 PCR의 amplicon는 고 충실도의 DNA 중합 효소를 사용하여 네 PCR 반응을 통해 구성됩니다. 초기 exponS.의 ential 성장 단계 2.5 % inactivated 말 혈청이 PCR-재조합 구조의 변화에 대한 능력을 향상하는 데 사용됩니다와 토드 휴이트 국물에 배양 sanguinis이 보충. S.의 조건, 최대 20 % sanguinis 세포는 DNA의 ~ 50 NG를 통해 변환 할 수 있습니다. 이 방법에 따라, 단일 유전자 삭제로 2048 뮤턴트은 궁극적으로 S.에있는 2,270 유전자에서 얻은되었습니다 네 유전자 ORFs 제외 sanguinis은 S.의 다른 ORFs 내에 완전히 포함 sanguinis SK36 218 가능성이 필수적인 유전자. 유전자 삭제 구조를 만드는 방법에 대한 기술은 높은 처리량이며, 모든 transformable 박테리아 게놈 전체의 단일 유전자 삭제에 사용하기 쉬운 될 수 있습니다.

후 PCR의 프리 머 F1과 R1을 사용하여 증폭하고, F3 및 R3, 각 S. 약 1 킬로바이트 업스트림 및 다운 스트림 sanguinis 유전자는 96도 형식은 각각 (그림 2A)에서 얻은되었습니다. 우리의 PCR 조건 및 사용하여 설계 프리 머에서 특정 제품 S.에서 증폭 된 각 PCR 반응에 sanguinis 게놈 DNA. 이 결과는 프리 머은 S.의 목표에 매우 구체적인이었다 표시 sanguinis. PCR?...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

효율적인 게놈 전체의 단일 유전자 돌연변이 방법은 사용하는 설립되었습니다<em&gt; 연쇄상 구균 sanguinis</em&gt; 모델 생물로. 이 방법은 높은 처리량 재조합 PCRs 및 변환을 통해 달성했다.

게놈 전체 유전자 삭제할에<em&gt; 연쇄상 구균 sanguinis</em&gt; 높은 처리량 PCR에 의한

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

이소형 특정 유전자 목표를 식별 칩을 사용하여 게놈 차원의 분석

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

연구

생물학

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

선교 대상 아이디 라이브러리를 사용하여 miRNA 목표를위한 게놈 - 와이드 스크린

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

의 정량 및 자동화된 고속 처리량 게놈 전체의 RNAi 화면 C. elegans</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

고해상도 용융 분석과 PCR을 이용하여 신속하고 효율적인 Zebrafish의 유전자형

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

정량적 RT-PCR에 의해 개별 인간 배아 줄기 세포를 프로파일 링

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

살아있는 세포의 단백질 조각 보완 분석 (PCA)에 의해 게놈 전체 단백질 - 단백질 상호 작용 상영

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

후 전사적으로 규제 유전자의 화학 변조기에 대한 높은 처리량 검사

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

qPCRTag 분석 - 높은 처리량, Sc2.0 유전형에 대한 실시간 PCR 분석

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

COSMIC와 세포의 약물-DNA 상호 작용의 게놈 넓은 매핑 (작은 분자의 가교는 염색질을 분리)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

DamID-SEQ : 아데닌 - 메틸화 된 DNA 단편의 높은 처리량 시퀀싱에 의해 단백질 DNA 상호 작용의 게놈 넓은 매핑

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...