Name: multiplex pcr assay for typing of staphylococcal cassette chromosome mec types i to v in methicillin-resistant staphylococcus aureus
Uploaded: 2013-09-05T15:00:00
Description: Watch this Scientific Journal Video about Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus at JoVE.com

We thank T. Ito, K. Hiramatsu, R. Daum, H. de Lencastre, and D. Coleman for the kind gift of some reference strains used in this study. This work was in part supported financially by the Centre for Antimicrobial Resistance (CAR), Alberta Health Services-Calgary/Calgary Laboratory Services/University of Calgary.

Diese Verfahren sollten in einem zertifizierten Labor Sicherheitsstufe 2 durchgef

<ol>
	<li>IWG-SCC. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Classification+of+staphylococcal+cassette+chromosome+mec+(SCCmec):+guidelines+for+reporting+novel+SCCmec+elements.">Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements.</a> Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).</li><li>Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+for+Reporting+Novel+mecA+Gene+Homologues.">Guidelines for Reporting Novel mecA Gene Homologues.</a> Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).</li><li>Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissemination+of+new+methicillin-resistant+Staphylococcus+aureus+clones+in+the+community.">Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community.</a> Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).</li><li>Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combination+of+multiplex+PCRs+for+staphylococcal+cassette+chromosome+mec+type+assignment:+rapid+identification+system+for+mec,+ccr,+and+major+differences+in+junkyard+regions.">Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions.</a> Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).</li><li>Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+strategy+for+rapid+identification+of+structural+types+and+variants+of+the+mec+element+in+methicillin-resistant+Staphylococcus+aureus.">Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).</li><li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Update+to+the+multiplex+PCR+strategy+for+assignment+of+mec+element+types+in+Staphylococcus+aureus.">Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).</li><li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+strategy+for+subtyping+the+staphylococcal+cassette+chromosome+mec+type+IV+in+methicillin-resistant+Staphylococcus+aureus:+'SCCmec+IV+multiplex'.">Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'.</a> Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).</li><li>Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+multiplex+PCR+assay+for+characterization+and+concomitant+subtyping+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus.">Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).</li><li>Zhang, K., McClure, J. A., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+multiplex+PCR+assay+for+typing+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus.">Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Molecular and Cellular Probes. 26 (5), 218-221 (2012).</li><li>de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one-step+microbial+DNA+extraction+method+using+"Chelex+100"+suitable+for+gene+amplification.">A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification.</a> Research in Microbiology. 143 (8), 785-790 (1992).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J. Vis. Exp. (62), e3923 (2012).</li><li>McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+assay+to+facilitate+identification+of+the+recently+described+Staphylococcal+cassette+chromosome+mec+type+VIII.">Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII.</a> Molecular and Cellular Probes. 24 (4), 229-232 (2010).</li><li>Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+staphylococcal+cassette+chromosome+mec+type,+tentatively+designated+type+VIII,+harboring+class+A+mec+and+type+4+ccr+gene+complexes+in+a+Canadian+epidemic+strain+of+methicillin-resistant+Staphylococcus+aureus.">Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).</li></ol>

The multiplex PCR assay described here provides a simple, reliable method for classifying types and major subtypes of SCCmec I-V in Staphylococci, with simultaneous discrimination of MRSA from MSSA. The assay is robust, conveniently done in a single PCR reaction and results are easy to interpret. The assay does have limitations in that it targets individual loci within each SCCmec type, but does not offer comprehensive ccr and mec complex typing, and therefore cannot be considered a go...

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.
In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:
TTCTCATTGATGCTGAAGCC
To:
GAAACTAGTTATTTCCAACGG

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.

Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

Methicillin-resistente Staphylococcus aureus (MRSA) erworben hat und in ihr Genom ein 21-67-kb mobilen genetischen Elements integriert, bezeichnet die Staphylokokken-Kassette Chromosom mec (SCC mec), die Methicillin-Resistenz (mecA-Gen) und anderen Antibiotika-Resistenz-Determinanten 1 birgt . SCC mec wird durch die Gegenwart von endst

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent</td>
			<td>Company</td>
			<td>Catalogue Number</td>
		 </tr>
		 <tr>
			<td>Tryptic Soy Agar</td>
			<td>Fisher (BD)</td>
			<td>CA90002-700 (236920)</td>
		 </tr>
		 <tr>
			<td>Sterile distilled water</td>
			<td>Life Technologies</td>
			<td>10977-015</td>
		 </tr>
		 <tr>
			<td>Platinum Taq: including 10x PCR buffer and 50 mM MgCl2</td>
			<td>Life Technologies</td>
			<td>10966-034</td>
		 </tr>
		 <tr>
			<td>100 mM dNTP</td>
			<td>Life Technologies</td>
			<td>10297-018</td>
		 </tr>
		 <tr>
			<td>Tris base</td>
			<td>Sigma-Aldrich</td>
			<td>T6066</td>
		 </tr>
		 <tr>
			<td>Boric acid</td>
			<td>Sigma-Aldrich</td>
			<td>B7901</td>
		 </tr>
		 <tr>
			<td>EDTA</td>
			<td>Life Technologies</td>
			<td>15576-028</td>
		 </tr>
		 <tr>
			<td>Agarose</td>
			<td>Life Technologies</td>
			<td>16500-500</td>
		 </tr>
		 <tr>
			<td>Glycerol</td>
			<td>Life Technologies</td>
			<td>15514-011</td>
		 </tr>
		 <tr>
			<td>Bromophenol blue</td>
			<td>Sigma-Aldrich</td>
			<td>B8026</td>
		 </tr>
		 <tr>
			<td>1Kb+ DNA ladder</td>
			<td>Life Technologies</td>
			<td>10787-026</td>
		 </tr>
		 <tr>
			<td>Ethidium bromide</td>
			<td>Sigma-Aldrich</td>
			<td>E7637</td>
		 </tr>
		 <tr>
			<td>1.5ml Microcentrifuge tubes </td>
			<td>VWR (Axygen Scientific)</td>
			<td>10011-700 </td>
		 </tr>
		 <tr>
			<td>Culture sticks</td>
			<td>VWR</td>
			<td>CA10805-018</td>
		 </tr>
		 <tr>
			<td>PCR tubes</td>
			<td>Diamed</td>
			<td>AD0210-FCN (new #: DIATEC420-1250)</td>
		 </tr>
		 <tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5417c</td>
		 </tr>
		 <tr>
			<td>Heat block</td>
			<td>VWR</td>
			<td>13259-030 / 13259-286 </td>
		 </tr>
		 <tr>
			<td>Thermalcycler</td>
			<td>Applied Biosystems (2720)</td>
			<td>4359659 </td>
		 </tr>
		 <tr>
			<td>Horizontal, submersible gel electrophoresis chamber with gel mold</td>
			<td>BioRad</td>
			<td>170-4469</td>
		 </tr>
		 <tr>
			<td>Power supply</td>
			<td>BioRad</td>
			<td>164-5050</td>
		 </tr>
		 <tr>
			<td>Rocker shaker</td>
			<td>VWR</td>
			<td>40000-300 </td>
		 </tr>
		 <tr>
			<td>Molecular Imager Gel Doc System</td>
			<td>BioRad</td>
			<td>1708170 </td>
		 </tr>
		</tbody>
 </table>

multiplex pcr assay for typing of staphylococcal cassette chromosome mec types i to v in methicillin-resistant staphylococcus aureus

Staphylokokken Cassette Chromosome mec (SCC mec) Typisierung ist eine sehr wichtige molekulare Werkzeug f

This updated M-PCR is able to determine (classify) SCCmec types I-V, as well major subtypes of SCCmec IV. The assay targets unique and specific loci of SCCmec I, II, III, IVa, IVb, IVc, IVd, IVE and V, with concomitant mecA gene detection. Tentative identification of SCCmec VI and VIII is also possible, but would require further testing to confirm. Figure 3 illustrates representative SCCmec I-VI and VIII and the locations of each target within the ele...

Watch this Scientific Journal Video about Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus at JoVE.com

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.

Multiplex PCR Assay f

Staphylococcal Cassette Chromosome mec (SCCmec) typing  is a very important molecular tool for understanding the epidemiology and  clonal strain ...

Research

JoVE Journal

Immunology and Infection

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

The Use of Drip Flow and Rotating Disk Reactors for Staphylococcus aureus Biofilm Analysis

The Use of Drip Flow and Rotating Disk Reactors for Staphylococcus aureus Biofilm Analysis

Die Verwendung von Drip Flow und Rotating Disk-Reaktoren für Staphylococcus aureus Biofilm Analysis

Most microbes in nature are thought to exist as surface-associated communities in biofilms.1  Bacterial biofilms are encased within a matrix and attached ...

Forschung

Immunologie und Infektion

Subcutaneous Infection of Methicillin Resistant Staphylococcus Aureus (MRSA)

Subcutaneous Infection of Methicillin Resistant Staphylococcus Aureus MRSA

Subkutane Infektion von Methicillin-resistenten Staphylococcus Aureus (MRSA)

MRSA is a worldwide threat to public health, and MRSA skin and soft-tissue infections now account for more than half of all soft-tissue infections in the ...

Experimental Endocarditis Model of Methicillin Resistant Staphylococcus aureus (MRSA) in Rat

Experimental Endocarditis Model of Methicillin Resistant Staphylococcus aureus MRSA in Rat

Experimentelle Endokarditis Modell von Methicillin-resistenten<em&gt; Staphylococcus aureus</em&gt; (MRSA) in Ratten

Endovascular infections, including endocarditis, are life-threatening infectious syndromes1-3. Staphylococcus aureus is the most common world-wide cause ...

Staphylococcus aureus Growth using Human Hemoglobin as an Iron Source

Staphylococcus aureus Growth using Human Hemoglobin as an Iron Source

Staphylococcus aureus Wachstum mit menschlichen Hämoglobins als Eisenquelle

S. aureus is a pathogenic bacterium that requires iron to  carry out vital metabolic functions and cause disease. The most abundant  reservoir of iron ...

Studying Interactions of Staphylococcus aureus with Neutrophils by Flow Cytometry and Time Lapse Microscopy

Studying Interactions of Staphylococcus aureus with Neutrophils by Flow Cytometry and Time Lapse Microscopy

Studieren Wechselwirkungen von<em&gt; Staphylococcus aureus</em&gt; Mit Neutrophilen durch Durchflusszytometrie und Mikroskopie Zeitraffer

We present methods to study the effect of phenol soluble modulins (PSMs)  and other toxins produced and secreted by Staphylococcus  aureus on neutrophils. ...

2D and 3D Chromosome Painting in Malaria Mosquitoes

2D und 3D Chromosom Malerei in Malaria-Mücken

Fluorescent in situ hybridization (FISH) of whole arm chromosome probes is a robust technique for mapping genomic regions of interest, detecting ...

High-throughput Quantitative Real-time RT-PCR Assay for Determining Expression Profiles of Types I and III Interferon Subtypes

Hochdurchsatz-quantitative Echtzeit-RT-PCR-Assay zur Bestimmung Expressionsprofile der Typen I und III Interferon-Formationsglieder

Described in this report is a qRT-PCR assay for the analysis of seventeen human IFN subtypes in a 384-well plate format that incorporates highly specific ...

Targeting Biofilm Associated Staphylococcus aureus Using Resazurin Based Drug-susceptibility Assay

Targeting Biofilm Associated Staphylococcus aureus Using Resazurin Based Drug-susceptibility Assay

Targeting Biofilm Assoziierte<em&gt; Staphylococcus aureus</em&gt; Verwendung von Resazurin Based Drug-Anfälligkeit Assay

Most pathogenic bacteria are able to form biofilms during infection, but due to the difficulty of manipulating and assessing biofilms, the vast majority ...

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR (RS-PCR)

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR RS-PCR

Genotypisierung<em&gt; Staphylococcus aureus</em&gt; Durch ribosomalen Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, ...

Methodology for the Study of Horizontal Gene Transfer in Staphylococcus aureus

Methodology for the Study of Horizontal Gene Transfer in Staphylococcus aureus

Methodik für die Studie des horizontalen Gentransfers in<em&gt; Staphylococcus aureus</em

One important feature of the major opportunistic human pathogen Staphylococcus aureus is its extraordinary ability to rapidly acquire resistance to ...