Name: mouse genome engineering using designer nucleases
Uploaded: 2014-04-02T15:45:00
Duration: 12 min 4 s
Description: Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

نود أن نشكر مونيكا Tarnowska، كورنيليا ألبرخت، وإيوا Skoczylas للمساعدة التقنية الممتازة. وقد تم تمويل هذه الدراسة من قبل الجبهة الوطنية الصومالية SINERGIA منحة CRSI33-125073 لPP.

<ol>
	<li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat. Rev. Genetics. 6, 507-512 (2005).</li><li>Johansson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+zoo+of+mice+for+genetic+analyses:+a+comprehensive+protocol+for+the+rapid+generation+of+BAC+transgenic+mice.">Building a zoo of mice for genetic analyses: a comprehensive protocol for the rapid generation of BAC transgenic mice.</a> Genesis. 48, 264-280 (2010).</li><li>Skarnes, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+knockout+resource+for+the+genome-wide+study+of+mouse+gene+function.">A conditional knockout resource for the genome-wide study of mouse gene function.</a> Nature. 474, 337-342 (2011).</li><li>Carbery, I. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186, 451-459 (2010).</li><li>Meyer, M., de Angelis, M. H., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+by+homologous+recombination+in+mouse+zygotes+mediated+by+zinc-finger+nucleases.">Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 15022-15026 (2010).</li><li>Cui, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+integration+in+rat+and+mouse+embryos+with+zinc-finger+nucleases.">Targeted integration in rat and mouse embryos with zinc-finger nucleases.</a> Nat. Biotechnol. 29, 64-67 (2011).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat. Biotechnol. 31, 23-24 (2013).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+production+of+mouse+disease+models+by+embryo+microinjection+of+TALENs+and+oligodeoxynucleotides.">Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides.</a> Proc. Natl. Acad. Sci. U.S.A. 110, 3782-3787 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-Step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153, 910-918 (2013).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genetics. 11, 636-646 (2010).</li><li>ZFN, T. A. L. E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Joung, J. K., Sander, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TALENs:+a+widely+applicable+technology+for+targeted+genome+editing.">TALENs: a widely applicable technology for targeted genome editing.</a> Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013).</li><li>Cermak, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+design+and+assembly+of+custom+TALEN+and+other+TAL+effector-based+constructs+for+DNA+targeting.">Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting.</a> Nucleic Acids Res. 39, (2011).</li><li>Reyon, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH+assembly+of+TALENs+for+high-throughput+genome+editing.">FLASH assembly of TALENs for high-throughput genome editing.</a> Nat. Biotechnol. 30, 460-465 (2012).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcription+activator-like+effector+toolbox+for+genome+engineering.">A transcription activator-like effector toolbox for genome engineering.</a> Nat. Protoc. 7, 171-192 (2012).</li><li>Kim, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+library+of+TAL+effector+nucleases+spanning+the+human+genome.">A library of TAL effector nucleases spanning the human genome.</a> Nat. Biotechnol. 31, 251-258 (2013).</li><li>Schmid-Burgk, J. L., Schmidt, T., Kaiser, V., Honing, K., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ligation-independent+cloning+technique+for+high-throughput+assembly+of+transcription+activator-like+effector+genes.">A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes.</a> Nat. Biotechnol. 31, 76-81 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat. Biotechnol. 31, 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat. Biotechnol. 31, 822-826 (2013).</li><li>Hermann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+OPEN+zinc+finger+nucleases+for+direct+gene+targeting+of+the+ROSA26+locus+in+mouse+embryos.">Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos.</a> PLoS ONE. 7, (2012).</li><li>Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+disease+mutations+by+gene+targeting+in+one-cell+mouse+embryos.">Modeling disease mutations by gene targeting in one-cell mouse embryos.</a> Proc. Natl. Acad. Sci. U.S.A. 109, 9354-9359 (2012).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat. Biotechnol. 29, 143-148 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Doyon, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+zinc-finger-nuclease+activity+with+improved+obligate+heterodimeric+architectures.">Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures.</a> Nat. Methods. 8, 74-79 (2011).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Wefers, B., Wurst, W., K&#252;hn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Haueter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+vasectomy-overexpression+of+Prm1-EGFP+fusion+protein+in+elongating+spermatids+causes+dominant+male+sterility+in+mice.">Genetic vasectomy-overexpression of Prm1-EGFP fusion protein in elongating spermatids causes dominant male sterility in mice.</a> Genesis. 48, 151-160 (2010).</li><li>Perez-Pinera, P., Ousterout, D. G., Brown, M. T., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+to+the+ROSA26+locus+directed+by+engineered+zinc+finger+nucleases.">Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.</a> Nucleic Acids Res. 40, 3741-3752 (2012).</li><li>Bultmann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+transcriptional+activation+of+silent+oct4+pluripotency+gene+by+combining+designer+TALEs+and+inhibition+of+epigenetic+modifiers.">Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.</a> Nucleic Acids Res. 40, 5368-5377 (2012).</li><li>Valton, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+TALE+DNA+binding+domain+sensitivity+to+cytosine+methylation.">Overcoming TALE DNA binding domain sensitivity to cytosine methylation.</a> J. Biol. Chem. 287, 38427-38432 (2012).</li><li>Cradick, T. J., Ambrosini, G., Iseli, C., Bucher, P., McCaffrey, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN-Site+searches+genomes+for+zinc+finger+nuclease+target+sites+and+off-target+sites.">ZFN-Site searches genomes for zinc finger nuclease target sites and off-target sites.</a> BMC Bioinform. 12, (2011).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Byers, S. L., Payson, S. J., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+ten+inbred+mouse+strains+following+assisted+reproductive+technologies+(ARTs).">Performance of ten inbred mouse strains following assisted reproductive technologies (ARTs).</a> Theriogenology. 65, 1716-1726 (2006).</li><li>Luo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+strategies+for+6+commonly+used+mouse+strains.">Superovulation strategies for 6 commonly used mouse strains.</a> J. Am. Assoc. Lab. Animal Sci. 50, 471-478 (2011).</li><li>Pease, S., Saunders, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> International Society for Transgenic Technologies. Advanced protocols for animal transgenesis : an ISTT manual. , (2011).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+human+genome+engineering+via+Cas9.">RNA-Guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li></ol>

الكتاب تعلن أي تضارب مصالح.

مصمم يحركها نوكلياز الجينوم النهج التحرير قمنا بمد بشكل كبير من مجموعة من الأنواع قابلة للتعديلات التي تستهدف جينوم كل منهما 10،12. في الفئران، وقد تم في خلايا ES-استهداف الجينات تقنية قياسية لأكثر من عقدين من الزمن؛ ومع ذلك، فقد ثبت صعوبة في التكيف مع الخلايا الجذعية الجنينية من الأنواع الأخرى من الماوس، وإن كان هناك بعض النجاح الذي تحقق مؤخرا في الفئران خلايا ES. حتى مع توافر &quot;قبالة الجاهزة للاستخدام&quot; الماوس ES استنساخ الخلايا المستهدفة الجينات التي تقدمها اتحادات مثل EUCOMM، KOMP، أو NorCOMM 3 الجينوم التحرير من قبل ZFN وTALEN يوفر أعلى من الدقة والمرونة فيما يتعلق الطيف من التعديلات التي يمكن أن تكون أدخلت جينوم الفأر. الحيوانات مؤسس تحمل طفرات بوساطة نوكلياز يبدو أن غاية الجرثومية خط المختصة 4-6،20،21، وهي ليست الحال دائما للالوهم القادمة من حقن الكيسة الخلايا ES. وبالتالي، في بعض الحالات Microinjection من قصريمكن nucleases igner يؤدي إلى توليد أسرع بكثير من خطوط الماوس رواية مع بعض التعديلات الجينوم المستهدفة. الجيل الناجح من الفئران خروج المغلوب عن طريق الحقن من ZFN وTALEN يعتمد إلى حد كبير على نشاط الزوج نوكلياز حقن. وقد ثبت TALENs أن يكون لها نسبة نجاح عالية في استهداف مجموعة واسعة من الجينات في عدد من الكائنات الحية؛ ومع ذلك، تشير الدراسات الحديثة أن TALEN ملزمة حساس للالسيتوزين مثيلة 30،31. وهكذا، ولدت حديثا نوكلياز أزواج، على سبيل المثال TALENs المستنسخة في ناقلات pCAG-T7، يمكن عابر في خط الخلية الماوس مثل NIH-3T3 أو العصبية -2A، التي تحاكي الدولة لونين من الجنين الماوس إلى حد ما. هنا، والنشاط نوكلياز يمكن تقديرها باستخدام نوكلياز داخلية مقايسة T7 أو تقييد هضم المنتج PCR كما هو موضح في القسم 5 قبل التوليف مرنا وحقن مكروي. نوصي التسلسل الجيني في المنطقة من مصلحة في احترامإيف خط الخلية وسلالة الماوس تستخدم للتجارب حقن مكروي. في بيضات ملقحة الماوس، سوف TALEN مختلفة أو ZFN أزواج تعمل على النحو الأمثل بتركيزات مختلفة مرنا وبالتالي فإن تركيز العمل الأمثل للنوكلياز مرنا microinjected قد تضطر إلى أن تحدد تجريبيا. اعتمادا على الزوج نوكلياز، وتركيز منخفض جدا يؤدي إلى أي انشقاق في حين مرتفعة جدا يمكن أن يؤدي إلى الجنين الفتك. اعتمادا على الزوج نوكلياز، لقد حققنا نجاحا باستخدام مجموع تركيزات منخفضة مرنا قدر 2 نانوغرام / ميكرولتر ويصل إلى 200 ميكروغرام / شباط. هذه الآثار يصعب التنبؤ بها من التجارب في خلية ثقافة والأمثل تركيز نوكلياز لكلا بقاء الجنين ومعدل تعديل موضع الهدف يحتاج إلى أن تحدد تجريبيا. ZFN نشطة للغاية أو TALEN يمكن يلتصق تسلسل هدفهم تجاوز مرحلة خلية واحدة من الجنين، وبالتالي يسبب microinjected أنماط معقدة من الطفرات ود الاصباغ في المؤسسين. نحن وآخرون 4 لاحظت ثلاثة أو أكثر من الأليلات تحور واضح في مؤسس واحد (الشكل 5C). وبالتالي، عند إنشاء خط الفأرة الجديدة من هؤلاء المؤسسين، والأبناء لا بد من فحص بعناية من قبل تسلسل لوجود الطفرة مواتية منذ المقايسات الهضم تقديم الدليل الوحيد على أن طفرة غير معروف موجودا. واحدة من الانتقادات في كثير من الأحيان اعرب ضد أنظمة ZFN وTALEN هو احتمال أن هذه nucleases هي أيضا قادرة على الشق تسلسل الحاضر في مكان آخر في الجينوم التي تشبه إلى المواقع المستهدفة. وقد لوحظت هذه التأثيرات خارج الهدف مع الكواشف الجيل المبكر باستخدام المجال homodimeric FokI، وصممت ثوابت مغاير للتخفيف من آثار خارج الهدف 25. يمكن التنبؤ مواقع خارج هدفا محتملا إلى حد ما في سيليكون 32،33 وفرزهم من قبل PCR والتسلسل. ميزة واضحة سو باستخدام ZFNs وTALENs لتوليد الفئران بدلا من خطوط الخلايا هي إمكانية إزالة من الطفرات الهدف المنشود غير المرتبطة لتعديل الجينوم عن طريق إجراء العديد من backcrosses لسلالة من النوع البري في الاختيار. لتحليل عدد كبير من الفئران مؤسس، الجيل القادم التسلسل العميقة للمنتجات PCR ولدت من موضع استهداف ونوكلياز في سيليكون توقع خارج الهدف مواضع قد تقدم قراءات النوعي والكمي بديل لفحوصات هضم منتجات PCR. هي الأمثل للتقنيات المساعدة على الإنجاب وصفها في هذا البروتوكول لسلالات الفئران القياسية المستخدمة في التجارب حقن مكروي مثل C57BL/6J أو B6D2F1. الفئران من أصول مختلفة، مثل سلالات الأباعد، يمكن من حيث المبدأ أن تستخدم لنهج تحرير الجينوم ويمكن أن توفر خلفية وراثية أكثر ملاءمة للأسئلة بحثية محددة. أداء تقنيات الإنجاب المساعدة مثل فرط الإباضة يمكن أن يكون prediالمديرية لعدد من سلالات 34-36 ولكن قد تحتاج إلى مزيد من التحسين لسلالات غير قياسي من أجل الحصول على عدد كاف من الأجنة لحقن مكروي نوكلياز. إلى جانب ZFN وTALEN، والآن أدخلت nucleases مصمم جديدة مثل موجهة RNA نظام CRISPR/Cas9 9،37،38 لتطبيقات التحرير الجينوم. جميع الطرق لحقن مكروي وتحليل الحيوانات مؤسس وصفها هنا قابلة للتطبيق على CRISPR/Cas9 وسائط مستقبل تحرير الجينوم أيضا.

الفئران هي الآن الأكثر شعبية منصة لتوليد النماذج الحيوانية المعدلة وراثيا. الأدوات تنوعا للهندسة الوراثية للجنين الفأر 1-3 وقد تم تمديد مؤخرا من قبل نهج التحرير الجينوم على أساس nucleases مصمم مثل nucleases إصبع الزنك (ZFN) 4-6، والنسخ مثل المنشط nucleases المستجيب (TALEN) 7،8، وتتجمع interspaced بانتظام يكرر المتناوب قصيرة (CRISPR) / (CAS) 9 المرتبط CRISPR نظام 9. ZFN وظيفة TALEN كما أزواج اثنين من المجالات مصمم خصيصا البروتين على أساس ملزم الحمض النووي (صفائف من الزنك الاصبع البروتينات وتكرار متغير ثنائي بقايا (RVDs)، على التوالي) التي تقترن كل لنوكلياز داخلية FokI 10-12. على العكس، يتم توفير خصوصية Cas9 بوساطة الانقسام الحمض النووي عن طريق transactivating الرنا CRISPR (crRNA وtracrRNA، والتي يمكن أيضا أن تكون مجتمعة في واحدة جزيء RNA خيالية تسمى دليل الحمض النووي الريبي) 11 التي تعمل في مجمع معالبروتين CRISPR. TALENs مع تسلسل محدد من RVDs يمكن بناؤها بسرعة عن طريق المجربون الفردية مع العديد من الاستراتيجيات لاختيار التجمع 13-17. CRISPR/Cas9 عود الجيل كثيفة العمالة حتى أقل من nucleases مصمم، ولكن خصوصية دليل الحمض النووي الريبي الحمض النووي ملزمة لم يتم حل تماما 18،19. جيل من ZFNs مخصص وقد تم حتى الآن تقتصر على مختبرات الأكاديمية المتخصصة والتجارية للموردين مثل Sangamo العلوم البيولوجية والخدمة سيغما CompoZr. بشكل عام، يهدف الجينوم التحرير مع nucleases مصمم على تقديم فواصل حبلا مزدوجة (DSB) في مواضع محددة الجيني، والتي تجذب فيما بعد نهاية امتماثلان الانضمام (NHEJ) أو إعادة التركيب مثلي (HR) الأجهزة إصلاح الحمض النووي 10،12. إصلاح NHEJ بوساطة من جهاز تسوية المنازعات غالبا ما يؤدي إلى إدخال الإدراج والحذف على مقربة من موقع الإصلاح. NHEJ بالتالي إصلاح جويمكن استغلالها لضرب وظيفة الجين المستهدف من خلال إدخال طفرة الإطار تحول في الجينات ترميز بروتين تسلسل 4،7،9. بدلا من ذلك، بالإضافة إلى تعريف أو استبدال المعلومات الوراثية يمكن أن يتحقق من خلال توفير المانحة الحمض النووي مع nucleases المصمم. وتضم الجهات المانحة والحمض النووي تسلسل الحمض النووي مصمم المحقق يحيط بها مناطق التماثل مع مكان الهدف، وبالتالي تخدم كنموذج لإصلاح جهاز تسوية المنازعات عن طريق الموارد البشرية. كلا البلازميدات 5،6،20 واحد أليغنوكليوتيد] الذين تقطعت بهم السبل 8،9،21 وقد استخدمت بنجاح الجهات المانحة. لا تتطلب NHEJ-HR ولا بوساطة الجينوم تحرير إدخال علامة اختيار في جينوم الجنين الماوس، الأمر الذي يجعل هذه الاستراتيجيات لا سيما مناسبة تماما لخلق تغييرات صغيرة في تسلسل النوكليوتيدات من دون إزعاج العمارة الوراثية بشكل عام. في هذا البروتوكول وصفنا جميع الإجراءات الضرورية لتحرير الجينوم فيجنين فأر باستخدام TALENs. وتشمل هذه 1) تحديد موقع الهدف TALEN 22، 2) بناء TALENs كتبها golden بوابة الاستنساخ 13، 3) في المختبر توليف TALEN مرنا، 4) Microinjection من TALEN مرنا في البويضات المخصبة الماوس، 5) العمليات الجراحية لنقل الأجنة و6) تحليل الطفرات المستحثة TALEN في الحيوانات مؤسس. ونحن نركز على TALEN مرنا حقن مكروي والفرز من المؤسسين لNHEJ التي يسببها الإدراج / حذف. لهذا الغرض، ونحن قد ولدت يبني TALEN bifunctional التي تسمح على حد سواء التعبير في خلايا الثدييات عندما transfected البلازميدات وكما في التوليف المختبر من TALEN مرنا لحقن مكروي في أجنة الفئران. تتكون هذه التركيبات حكاية العمود الفقري اقتطاع 23 تنصهر لheterodimeric FokI النطاقات 24،25 الأمثل لتحرير الجينوم في خلايا الثدييات. ويمكن أيضا أن يعتمد هذا البروتوكول لMicroinjection من غيرها nucleases مصمم أو حقن مشتركة من nucleases مصممويبني المانحة (وقد وصفت تصميم المانحين الحمض النووي في المطبوعات الفنية الممتازة التي Wefers آخرون 26،27). بيان الأخلاقية أجريت جميع التجارب على الحيوانات وفقا للمبادئ التوجيهية واللوائح من المكتب البيطري كانتون كانتون زيوريخ.

<table border="0" cellpadding="0" cellspacing="0" width="524">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">BsaI</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">R0535S or L</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Esp3I</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">ER0451</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T4 Ligase</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0202S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Spectinomycin</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">S0692-1ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ampicillin&#160;</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">A0166</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">X-Gal</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">B4252</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">IPTG</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">I6758</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Plasmid-Safe nuclease</td>
			<td style="width:111px;">Epicentre</td>
			<td style="width:119px;">E3101K</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">27106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAGEN Plasmid Midi Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">12143</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAquick PCR Purification Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">28106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">mMESSAGE mMACHINE T7 Ultra Kit</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM1345</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NucAway Spin Columns</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM10070</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNaseZAP</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">R2020-250ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NorthernMax Formaldyde Load Dye</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM8552</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNA Millennium Markers</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM7150</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">10x TBE buffer</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">B52</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T7 endonuclease</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0302S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">pGEM-T EasyVector System I</td>
			<td style="width:111px;">Promega</td>
			<td style="width:119px;">A3600</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">S-7563</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">pregnant mare&#39;s serum gonadotrophin (PMSG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">G4877</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">human chorionic gonadotropin (hCG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">CG5</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M2 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7167</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M16 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7292</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Mineral oil, embryo tested</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M8410</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ketamine</td>
			<td style="width:111px;">CentraVet</td>
			<td style="width:119px;">Ket 201</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Xylazine</td>
			<td style="width:111px;">Sigma Aldrich</td>
			<td style="width:119px;">46995</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Equipment/Tools</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Inverted microscope with Nomarski DIC optics (for example Nikon Eclipse TE200)</td>
			<td style="width:111px;">Nikon</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Micromanipulator units (for example Narishige, NT88NF)</td>
			<td style="width:111px;">&#160;Narishige</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo holding capillaries</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;">B100-75-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo injection capillaries</td>
			<td style="width:111px;">Narishige</td>
			<td style="width:119px;">GD-1</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Capillary puller (for example Sutter P97)</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Microforge (for example Narishige MF-900)</td>
			<td style="width:111px;">Narishige&#160;</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Walton skin scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14077-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14041-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical probe</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">10140-03</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clip system (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12031-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clips (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12032-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dumont fine forceps 5</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11254-20</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria curvrd forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11370-31</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria fine forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11399-80</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dietrich bulldog clamp</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">18038-45</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Animals</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">C57BL/6J mice</td>
			<td style="width:111px;">Jackson labs</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">CD-1 mice</td>
			<td style="width:111px;">Charles river</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
	</tbody>
</table>

mouse genome engineering using designer nucleases

الفئران المعدلة وراثيا تحمل تعديلات في مواقع محددة الجينوم (خروج المغلوب، الضربة القاضية في) هي ذات أهمية حيوية لتشريح النظم البيولوجية المعقدة، فضلا عن الأمراض التي تصيب الإنسان لنمذجة واختبار الاستراتيجيات العلاجية. التطورات الحديثة في استخدام nucleases مصمم مثل nucleases إصبع الزنك (ZFNs)، والنسخ مثل المنشط nucleases المستجيب (TALENs)، وتتجمع interspaced بانتظام يكرر المتناوب قصيرة (CRISPR) / (CAS) المرتبطة CRISPR 9 نظام للموقع الهندسة الجينوم محددة فتح إمكانية لإجراء تعديل سريع الجينوم المستهدفة في الواقع أي الأنواع المختبر دون الحاجة إلى الاعتماد على الجذعية الجنينية (ES) تكنولوجيا الخلايا. يبدأ تجربة تحرير الجينوم عادة مع تحديد المواقع المستهدفة نوكلياز مصمم ضمن الجينات في المصالح تليها بناء المجالات الحمض النووي ملزم مخصصة لتوجيه النشاط نوكلياز إلى موضع الجيني محددة المحقق. البلازميدات مصمم نوكلياز في المختبر &lt;م /&gt; كتب لتوليد مرنا لMicroinjection من البويضات المخصبة الماوس. هنا، ونحن نقدم بروتوكول لتحقيق المستهدف تعديل الجينوم عن طريق الحقن المباشر للTALEN مرنا في البويضات المخصبة الماوس.

اقمنا البلازميدات الوجهة متوافق مع التجمع الذهبي GateTALEN نشرته سيرماك وآخرون 13 التي تسمح للتعبير عن TALENs في خلايا الثدييات وكذلك في المختبر التوليف مرنا من المروج T7 فج (الشكل 1C). هذه البلازميدات تحمل المجالات FokI heterodimeric (ELD أو KKR الطفرات) التي ثبت للحد من آثار خارج الهدف النسبي لhomodimers FokI وتعزيز النشاط الانقسام بالمقارنة مع الجيل الأول FokI heterodimers 25،29. ردود الفعل التجمع البوابة الذهبية رقم 1 ورقم 2 وعادة ما تكون فعالة جدا وكل مستعمرة بيضاء، عند تحليلها من قبل مستعمرة PCR، ويظهر النمط المتوقع لعدد معين من RVDs المستنسخة (الأرقام 1B و 1D). تحليل هلام في المختبر توليفها مرنا (الشكل 2) يجب أن تكشف عن وجود الفرقة مميزة واحدة مع مسحة ضئيلة أو معدومة لتحليل كل عينة. يجب أن يكون هناك تحول واضح بين حجم العينات L1/R1 وL2/R2، L3/R3، مما يدل على تذييل بعديد الأدينيلات ناجحة. مؤسس الحيوانات يمكن فرزهم لNHEJ التي يسببها الأليلات تحور باستخدام التنميط الجيني PCR تليها إما الهضم T7 نوكلياز داخلية (الشكل 3) أو تقييد هضم باستخدام الانزيم الذي يشق تسلسل نوع البرية في المنطقة فاصل من الزوج نوكلياز (الشكل 4). مقايسة T7 نوكلياز داخلية قابلة للتطبيق على أي نوع من الطفرة بغض النظر عن التسلسل الجيني محددة داخل المنطقة فاصل من الزوج نوكلياز حقن؛ ومع ذلك، فإنه يكشف عدم التطابق بين جدائل الحمض النووي فقط في المنتجات PCR مضاعف متغاير. وبالتالي، في حالة نادرة أن مؤسس يحمل اثنين من الأليلات تحور مماثل، ومنتجات PCR لن تظهر أي نمط T7 الهضم. مثل هذا التمييز هو، ومع ذلك، من الممكن دائما عندما يقع موقع قيود محددة داخل المنطقة الفاصل نوكلياز التي سيتم القضاء عليه من خلال NHEJالتي يسببها الإدراج / حذف (الشكل 5). هنا، والعصابات غير مهضوم تشير إلى وجود الطفرات، وعدم وجود أي منتجات هضمها يوحي بقوة مؤسس تحمل طفرات في كل من الأليلات من الجينات المستهدفة (التي تحمل العلامات النجمية في الشكل 4B). <img alt="الشكل 1" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig1highres.jpg" src="/files/ftp_upload/50930/50930fig1.jpg" width="600" /> الشكل 1. جولدن جيت استنساخ TALEN RVDs في heterodimeric pCAG-T7-الوجهة ناقلات ألف) جمعية صفائف RVD في ناقلات pFUS. هنا يظهر مثال لزوج TALEN مع صفائف حكاية فردية تضم 15 RVDs و 17 RVDs، على التوالي (للصفائف حكاية أطول من 21 RVDs، هناك حاجة إلى ثلاث pFUS-RVDs الجمعيات، لا تظهر). السهام تشير الاشعال لpFUS محددة تفاعلات مستعمرة PCR. ب) المنتجات PCRتضخيمه من التجميعات pFUS الصحيح عادة تظهر الفرقة المقابلة لطول مجتمعة من جميع RVDs المستنسخة (على سبيل المثال حوالي 1.1 كيلو بايت لمدة 10 RVDs) و &quot;سلم&quot; من العصابات أقل بروزا أصغر نظرا لطبيعة المتكررة من صفائف RVD. C) التجميع النهائي صفائف pFUS-RVD والبلازميد التي تحتوي على تكرار الماضي (بلر) في heterodimeric TALEN ناقلات تعبير وFokIELD وFokIKKR المتغيرات، على التوالي. العمود الفقري TALEN (المشروح في N و C) تمثل العمارة التي نشرتها ميلر وآخرون 23 CAG (CMV عنصر محسن المبكر / الدجاج بيتا الأكتين) مروج يضمن مستويات عالية التعبير في خلايا الثدييات transfected، في حين يسمح المروج T7 فج في المختبر مرنا التوليف (استخدام SACI عن الخطية من ناقلات المصب من نوكلياز إيقاف كودون). D) مستعمرة PCR باستخدام بادئات يتبين من السهام في C) يسمح تحديد تجميعها بشكل صحيح TALENs. كامل lengtح المنتجات PCR غالبا ما تكون أقل وضوحا في حين أن &quot;تأثير سلم&quot; يمثل مؤشرا قويا التجمع ناجحة. <a href="http://www.jove.com/files/ftp_upload/50930/50930fig1highres.jpg" target="_blank">اضغط هنا لمشاهدة صورة بشكل اكبر</a> . <img alt="الرقم 2" fo:content-width="3in" fo:src="/files/ftp_upload/50930/50930fig2highres.jpg" src="/files/ftp_upload/50930/50930fig2.jpg" width="300" /> الشكل 2. . مراقبة جودة نوكلياز مرنا في تركيب المختبر باستخدام الاغاروز الكهربائي للهلام ترد mRNAs وZFN كمثال (L، غادر ZFN؛ R، الحق ZFN). عينات L1/R1 تظهر مرنا قبل تذييل بعديد الأدينيلات، وعينات L2/R2 المعرض مذيل بعديد الأدينيلات مرنا وL3/R3 تظهر مرنا مذيل بعديد الأدينيلات المنقى. <a href="http://www.jove.com/files/ftp_upload/50930/50930fig2highres.jpg" target="_blank">اضغط هنا لمشاهدة صورة بشكل اكبر</a> . <img<html> بديل = &quot;الشكل 3&quot; FO: محتوى العرض = &quot;6in&quot; FO: SRC = &quot;/ files/ftp_upload/50930/50930fig3highres.jpg&quot; سرك = &quot;/ files/ftp_upload/50930/50930fig3.jpg&quot; العرض = &quot;600&quot; /&gt; الرقم 3. مثال على نوكلياز داخلية مقايسة T7 تستخدم لتحديد الحيوانات مؤسس تحمل الطفرات التي يسببها نوكلياز من موضع الهدف. A) وقد صمم زوج TALEN ليلتصق داخل المنطقة الترميز من الفأرة بروتين بريون الجين (Prnp، يمكن تقديم تسلسل الهدف TALEN عند الطلب). يتم إنشاء المنتج PCR باستخدام التمهيدي إلى الأمام (F) تقع 110 سنة مضت المنبع والتمهيدي العكسي (R) 250 سنة مضت المصب من موقع الانقسام TALEN. ب) يخضع المنتج PCR لاحقا إلى تشكيل مضاعف متغاير وT7 نوكلياز داخلية الهضم. C) وكشف الطفرات المستحثة TALEN داخل المنطقة الجيني المستهدفة من مؤسسي واحد عن طريق وجود كامل طول PCR المنتج مع منتجات الهضم من 250 و 110 نقطة أساس.50930/50930fig3highres.jpg &quot;الهدف =&quot; _blank &quot;&gt; اضغط هنا لمشاهدة صورة أكبر. <img alt="الرقم 4" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig4highres.jpg" src="/files/ftp_upload/50930/50930fig4.jpg" width="600" /> الشكل 4. مثال على تقييد هضم منتجات PCR تستخدم لتحديد الحيوانات مؤسس تحمل الطفرات التي يسببها نوكلياز من موضع الهدف. ZFN محددة للفأر Rosa26 موضع الهدف 29 موقع تقييد XbaI داخل إنترون 1. تم فحص A) من قبل المؤسسين التنميط الجيني PCR باستخدام التمهيدي إلى الأمام (F) يقع على بعد 500 سنة مضت المنبع والتمهيدي العكسي (R) 250 سنة مضت المصب من موقع الانقسام. ب) هضم منتجات PCR مع XbaI يكشف أنماط الهضم مما يدل الفئران مع الطفرات ثنائية أليلية (المشار إليها بعلامة النجمة)، مونو -أليلية الطفرات (العصابات هضمها وعسر الهضم، مثل الحيوان 2)والفئران وزن (الهضم كاملة، مثل الحيوان 21). C) تسلسل من الفئران مع تعديلات ثنائية أليلية المحتملة يظهر إلى 3 (الحيوانية 24) مميزة الإدراج / حذف. <a href="http://www.jove.com/files/ftp_upload/50930/50930fig4highres.jpg" target="_blank">اضغط هنا لمشاهدة صورة بشكل اكبر</a> . <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> اسم التمهيدي </td><td> تسلسل 5 &#39;إلى 3&#39; </td></tr><tr><td> pCR8_F1 </td><td> ttgatgcctggcagttccct </td></tr><tr><td> pCR8_R1 </td><td> cgaaccgaacaggcttatgt </td></tr><tr><td> TAL_F1 </td><td> ttggcgtcggcaaacagtgg </td></tr><tr><td> TAL_R2 </td><td> ggcgacgaggtggtcgttgg </td></tr><tr><td> TAL_Seq_5-1 </td><td> catcgcgcaatgcactgac </td></tr></tbody></table> الجدول 1. تسلسل الاشعال المستخدمة في تقارير إتمام المشروعات مستعمرة وتسلسلها داخل التجمع جولدن جيت TALENالبروتوكول. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> البلازميد / كوكتيل </td><td> مساهم </td><td> Addgene ID </td><td> تعليقات </td></tr><tr><td> جولدن جيت TALEN وTAL المستجيب كيت 2.0 </td><td> Voytas المختبر </td><td> 1000000024 </td><td> يحتوي على جميع البلازميدات اللازمة لجولدن جيت TALEN التجمع </td></tr><tr><td> pCAG-T7-TALEN -KKR/ELD ناقلات الوجهة </td><td> Pelczar المختبر </td><td> 40131، 40132 </td><td> إضافة على البلازميدات لTALEN التعبير في خلايا الثدييات والتوليف مرنا في المختبر </td></tr></tbody></table> الجدول 2. ويمكن الحصول على البلازميدات ومجموعات البلازميد اللازمة لجولدن جيت TALEN التجمع من Addgene ( <a href="http://www.addgene.org">www.addgene.org</a> ). <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> على الانترنتمورد </td><td> تعليقات </td></tr><tr><td> http://tale-nt.cac.cornell.edu </td><td> تصميم TALEN؛ TALEN التنبؤ خارج الهدف </td></tr><tr><td> http://zifit.partners.org/ZiFiT/ </td><td> تصميم TALEN، مفتوح ZFN، كودا ZFN، CRISPR/Cas9 </td></tr><tr><td> http://www.genome-engineering.org </td><td> تصميم TALEN، CRISPR/Cas9؛ CRISPR/Cas9 خارج الهدف التنبؤ </td></tr><tr><td> http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html </td><td> جمعية TALEN متواليات لتأكيد نتائج التسلسل </td></tr><tr><td> http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html </td><td> تصميم وحدات التجميع ZFN </td></tr><tr><td> www.genomecenter.ucdavis.edu/s egallab / segallabsoftware </td><td> تصميم وحدات التجميع ZFN </td></tr></tbody></table> الجدول 3. الموارد على الانترنت لتصميم ZFN، TALEN، وCRISPR/Cas9. </sترونج&gt;

Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

Mouse Genome Engineering Using Designer Nucleases

nucleases مصمم مثل nucleases إصبع الزنك (ZFNs) والنسخ مثل المنشط nucleases المستجيب (TALENs) يمكن استخدامها لتعديل جينوم الفأر الأجنة سابق للانغراس عن طريق إحداث كلا نهاية امتماثلان الانضمام (NHEJ) وإعادة التركيب مثلي (HR) مسارات. هذه التطورات تمكين جيل من الفئران السريع مع التعديلات الجينية دقيقة.

الماوس الجينوم الهندسية عن طريق Nucleases مصمم

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

Research

JoVE Journal

Biology

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

الجسيمة والجميلة تشريح الأذن الداخلية الظهارة الحسية في اسماك الزرد الكبار ( دانيو rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Engineering Cell-permeable Protein

هندسة الخلايا المنفذة للبروتين

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Genome-wide Analysis of Aminoacylation (Charging) Levels of tRNA Using Microarrays

Genome-wide Analysis of Aminoacylation Charging Levels of tRNA Using Microarrays

الجينوم على نطاق تحليل المستويات (شحن) من الحمض الريبي النووي النقال باستخدام Aminoacylation ميكروأرس]

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both ...

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

الجينوم على نطاق التحليل باستخدام رقاقة لتحديد أهداف محددة الجينات شكل الإسوي

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

في الجسم الحي التصوير والعلاجات العلاجية في الفأر نموذج مثلي من سرطان المبيض

Human cancer and response to therapy is better represented in orthotopic animal models.  This paper describes the development of an orthotopic mouse model ...

Flow Cytometry Purification of Mouse Meiotic Cells

تدفق تنقية الخلوي للخلايا الفأر الانتصافي

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

الجينوم على نطاق الشاشة لأهداف ميرنا باستخدام معرف الهدف المكتبة MISSION

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

الجينوم التحرير مع مخصص Nucleases CompoZr فنجر الزنك (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

جيل من الفئران المستمدة من الخلايا الجذعية المحفزة المستحثة

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

In Vivo Modeling of the Morbid Human Genome using Danio rerio

في النمذجة فيفو من المهووسين الجينوم البشري باستخدام دانيو rerio

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...