Name: vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance
Uploaded: 2013-08-23T13:00:00
Description: Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

Dit project werd gefinancierd door The Samuel Roberts Noble Foundation. Auteurs bedanken Mss. Janie Gallaway en Colleen Elles voor een uitstekende verzorging van planten, en mevrouw Katie Brown voor kunstwerk. We zouden ook graag Mss bedanken. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda en de heer Isaac Greenhut voor technische hulp tijdens de totstandkoming van dit protocol.

1. Plant Groei en Target gen silencing <ol><li> Plantengroei voorwaarden: <ol><li> Sow N. benthamiana zaden op bodem-minder potgrond, Metro-Mix 350 en ontkiemen de zaden in een kweekkamer. Elk ander bodem of aardeloos medium kan ook worden gebruikt in plaats van Metro-Mix. </li><li> Transplant drie weken oude zaailingen in individuele potten en ze groeien in een broeikas bij 21 ± 2 ° C, samen met andere groeiomstandigheden zoals beschreven in eerdere literatuur 12. Twee tot drie dagen na het uitp...

<ol>
	<li>Heath, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+and+nonspecific+plant+defenses.">Nonhost resistance and nonspecific plant defenses.</a> Currrent Opinion in Plant Biology. 3, 315-319 (2000).</li><li>Mysore, K. S., Ryu, C. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance:+how+much+do+we+know.">Nonhost resistance: how much do we know.</a> Trends in Plant Science. 9, 97-104 (2004).</li><li>Ellis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+nonhost+disease+resistance:+can+they+assist+disease+control+in+agriculture.">Insights into nonhost disease resistance: can they assist disease control in agriculture.</a> The Plant Cell. 18, 523-528 (2006).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+against+bacterial+pathogens:+retrospects+and+prospects.">Nonhost resistance against bacterial pathogens: retrospects and prospects.</a> Annual Review of Phytopathology. 51, (2013).</li><li>Lu, M., Tang, X., Zhou, J. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+NHO1+is+required+for+general+resistance+against+Pseudomonas+bacteria.">Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.</a> The Plant Cell. 13, 437-447 (2001).</li><li>Rojas, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycolate+oxidase+plays+a+major+role+during+nonhost+resistance+responses+by+modulating+reactive+oxygen+species+mediated+signal+transduction+pathways.">Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways.</a> The Plant Cell. 24, 336-352 (2012).</li><li>Daurelio, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+reveals+novel+genes+involved+in+nonhost+response+to+bacterial+infection+in+tobacco.">Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco.</a> Journal of Plant Physiology. 168, 382-391 (2011).</li><li>Moreau, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EDS1+contributes+to+nonhost+resistance+of+Arabidopsis+thaliana+against+Erwinia+amylovora.">EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora.</a> Molecular Plant-Microbe Interactions. 25, 421-430 (2012).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ornithine-delta-aminotransferase+and+proline+dehydrogenase+genes+play+a+role+in+non-host+disease+resistance+by+regulating+pyrroline-5-carboxylate+metabolism-induced+hypersensitive+response.">Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response.</a> Plant, Cell &amp; Environment. 35, 1329-1343 (2012).</li><li>Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+and+advantages+of+virus-induced+gene+silencing+for+gene+function+studies+in+plants.">Applications and advantages of virus-induced gene silencing for gene function studies in plants.</a> The Plant Journal. 39, 734-746 (2004).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+for+VIGS+in+plant+functional+genomics.">New dimensions for VIGS in plant functional genomics.</a> Trends in Plant Science. 16, 656-665 (2011).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+can+persist+for+more+than+2+years+and+also+be+transmitted+to+progeny+seedlings+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato.</a> Plant Biotechnology Journal. 9, 797-806 (2011).</li><li>Bombarely, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+draft+genome+sequence+of+Nicotiana+benthamiana+to+enhance+molecular+plant-microbe+biology+research.">A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research.</a> Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).</li><li>Sharma, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+silencing+of+WIPK+and+SIPK+genes+reduces+resistance+to+a+bacterial+pathogen,+but+has+no+effect+on+the+INF1-induced+hypersensitive+response+(HR)+in+Nicotiana+benthamiana.">Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana.</a> Mol Gen Genomics. 269, 583-591 (2003).</li><li>Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+forward+genetics+based+on+virus-induced+gene+silencing.">Fast forward genetics based on virus-induced gene silencing.</a> Current Opinion in Plant Biology. 2, 109-113 (1999).</li><li>Lu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+virus-induced+gene+silencing+implicates+heat+shock+protein+90+in+plant+disease+resistance.">High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance.</a> EMBO Journal. 22, 5690-5699 (2003).</li><li>Pozo, O., Pedley, K. F., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MAPKKK[alpha]+is+a+positive+regulator+of+cell+death+associated+with+both+plant+immunity+and+disease.">MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease.</a> EMBO Journal. 23, 3072-3082 (2004).</li><li>Wang, K., Senthil-Kumar, M., Ryu, C. -. M., Kang, L., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phytosterols+play+a+key+role+in+plant+innate+immunity+against+bacterial+pathogens+by+regulating+nutrient+efflux+into+the+apoplast.">Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast.</a> Plant Physiology. 158, 1789-1802 (2012).</li><li>Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+in+planta+bacterial+infection+at+both+cellular+and+whole-plant+levels+using+the+green+fluorescent+protein+variant+GFPuv.">Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv.</a> New Phytologist. 174, 212-223 (2007).</li><li>Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+Advance:+Tobacco+rattle+virus+as+a+vector+for+analysis+of+gene+function+by+silencing.">Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing.</a> The Plant Journal. 25, 237-245 (2001).</li><li>MacFarlane, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+biology+of+the+tobraviruses.">Molecular biology of the tobraviruses.</a> Journal of General Virology. 80, 2799-2807 (1999).</li><li>Anand, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+plant+genes+involved+in+Agrobacterium-mediated+plant+transformation+by+virus-induced+gene+silencing.">Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing.</a> Molecular Plant-Microbe Interactions. 20, 41-52 (2007).</li><li>Liu, E., Page, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+cDNA+libraries+for+virus-induced+gene+silencing+(VIGS)+using+tobacco+rattle+virus.">Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus.</a> Plant Methods. 4, 5 (2008).</li><li>Vel&#225;squez, A. C., Chakravarthy, S., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+(VIGS)+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato.</a> J. Vis. Exp. (28), e1292 (2009).</li><li>Peart, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitin+ligase-associated+protein+SGT1+is+required+for+host+and+nonhost+disease+resistance+in+plants.">Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants.</a> Proceedings of the National Academy of Sciences. 99. , 99-10869 (2002).</li><li>Oh, S. -. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insight+into+Types+I+and+II+nonhost+resistance+using+expression+patterns+of+defense-related+genes+in+tobacco.">Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco.</a> Planta. 223, 1101-1107 (2006).</li><li>Senthil-Kumar, M., Mysore, K., Kodama, H., Komamine, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+and+Plant+Gene+Function+Analysis.">RNAi and Plant Gene Function Analysis.</a> Methods in Molecular Biology. 744, 13-25 (2011).</li></ol>

Plant immuniteit beperkt de groei van nonhost ziekteverwekkers en dus weinig of geen groene fluorescentie wordt uitgezonden van vector-controle bladeren van de planten geënt met nonhost ziekte onder lange golflengte UV-licht (Figuur 3D). Wanneer een gen voor nonhost weerstand zwijgen, het gen tot zwijgen planten bevorderen de groei van nonhost pathogeen en groene fluorescentie wordt waargenomen (figuur 3E). Dit is het uitgangspunt bij de in dit manuscript beschreven werkwijze. Deze met...

Nonhost weerstand is de weerstand van alle plantensoorten tegen rassen van een bepaalde ziekteverwekker 1,2. Dit zorgt voor breed spectrum en duurzame ziekte resistentie in planten 2,3. Echter, het mechanisme, met name tegen bacteriële pathogenen, niet goed begrepen 4. Screening voor mutanten of zwijgen planten die compromis nonhost weerstand, en hoge doorvoer transcriptprofilering voor de identificatie van differentieel tot expressie genen tijdens nonhost weerstand 5-9 zijn twee belangrijke benaderingen eerder gebruikt voor het ontleden van bacteriële nonhost weerstand. Omdat nonhost weerstand wordt geregeld door een complex mechanisme (s) 4 met betrokkenheid van vele genen, een high throughput functionele genomics benadering voor genidentificatie is cruciaal voor een beter begrip van de nonhost weerstandsmechanisme (s). Virus-geïnduceerde genuitschakeling (VIGS) is met succes gebruikt om endogene planten zwijgengenen in veel plantensoorten 10,11. Nicotiana benthamiana is een van de meest geschikte planten voor VIGS 10,12 en zijn ontwerp-genoom sequentie is nu verkrijgbaar 13. Tobacco rattle virus (TRV) gebaseerde VIGS is op grote schaal gebruikt als reverse genetics hulpmiddel om genen die betrokken zijn bij nonhost weerstand 2,4,14 karakteriseren. Dit VIGS vectoren en derivaten zijn nu beschikbaar via Arabidopsis Biological Resource Center (ABRC, <a href="http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html" target="_blank">http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html</a> ). VIGS is ook gebruikt als een forward genetics hulpmiddel voor het identificeren van genen betrokken bij planten immuniteit 15-17, vooral nonhost weerstand 6,18. Beoordelen van overgevoeligheidsreactie (HR)-gemedieerde celdood geïnduceerd door planten tegen een specifiek nonhost ziekteverwekker en de beoordeling van de ziekte geïnduceerde celdood zijn twee belangrijke tests voornamelijk gebruikt voor identifying gevoelige gen zwijgen planten. Echter, wordt HR celdood geïnduceerd alleen tegen type-II nonhost pathogenen en niet tegen het type-I nonhost ziekteverwekkers 2. Vandaar, HR testen kunnen niet worden universeel gebruikt voor nonhost weerstand strategieën gebruikt door planten te identificeren, met name tegen de brede waaier van het type-I nonhost ziekteverwekkers. Ook, gedeeltelijk verlies van nonhost resistentie in een gen zwijgen installatie niet altijd tot ziekteverschijnselen 6 en derhalve ziekte puntentelling niet worden gebruikt voor het identificeren van planten compromitteren nonhost weerstand. In tegenstelling, de beoordeling van de groei van pathogenen in de nonhost gen zwijgen planten is een betere methode voor het bestuderen van het verlies van nonhost resistentie gen in planten zwijgen. Vergeleken met conventionele groei assay 6,19, een snellere methode om nonhost bacteriegroei het gen zwijgen planten kan de tijd die forward genetics screening verkorten. We eerder gemeld een werkwijze voor het observeren van bacteriënl pathogeen groei op bladeren met het blote oog onder ultraviolet (UV) licht met behulp van bacteriën uiten van groen fluorescerend eiwit (GFP) 19. In dit manuscript demonstreren we de bruikbaarheid van GFPuv expressie nonhost bacteriële pathogenen voor gemakkelijke identificatie van gen tot zwijgen planten die worden gecompromitteerd nonhost resistentie. Deze methode is nauwkeurig voor de identificatie van gevoelige planten en vatbaar voor high throughput screening.

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent/equipment</td>
 <td>Company</td>
 <td>Catalogue number</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>96-well U-bottom plates</td>
 <td> Becton Dickinson Labware (Franklin Lakes, NJ, USA)</td>
 <td> 35-3077</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>96-pin replicator stainless steel</td>
 <td> Nalge Nunc International (Naperville, IL, USA)</td>
 <td> 250520</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> High Intensity UV Inspection Lamps, Model B-100ap</td>
 <td> Thomas scientific (Swedesboro, NJ, USA)</td>
 <td> 6283K50</td>
 <td> Manufacturer ID 95-0127-01</td>
 </tr>
 <tr>
 <td> Stuart SC6 colony counter</td>
 <td> Bibby Scientific Limited, Staffordshire, UK</td>
 <td> SC6PLUS</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Soil-less potting mixture, Metro-Mix 350</td>
 <td> SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)</td>
 <td>&nbsp;</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Primers: 
 attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT) 
 attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)</td>
 <td> Integrated DNA Technologies, Inc (Coralville, IA, USA)</td>
 <td> Custom synthesized</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> MES, Monohydrate</td>
 <td> VWR international (Radnor, PA, USA)</td>
 <td> CAS No. 145224-94-8</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Acetosyringone (Dimethoxy-4'-hydroxyacetophenone)</td>
 <td> Sigma Aldrich (St. Louis, MO, USA)</td>
 <td> D134406</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Vac-In-Stuff (Silwet L-77)</td>
 <td> Lehle Seeds (Round Rock, TX, USA)</td>
 <td> VIS-30</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
</table>

vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance

Nonhost ziekte resistentie van planten tegen bacteriële ziekteverwekkers wordt bestuurd door complexe verdedigingsmechanismen. Inzicht in dit mechanisme is van belang voor het ontwikkelen van duurzame ziekte-resistente planten tegen brede waaier van ziekteverwekkers. Virus-geïnduceerde gen silencing (VIGS) gebaseerde forward genetics screening is een nuttige aanpak voor de identificatie van het verdedigingsmechanisme van planten genen meegeven nonhost weerstand. Tobacco rattle virus (TRV) gebaseerde VIGS vector is de meest efficiënte VIGS vector to-date en is efficiënt gebruikt om endogene doelwitgenen zwijgen in Nicotiana benthamiana. In dit manuscript, demonstreren we een forward genetics screening aanpak voor het tot zwijgen brengen van de individuele klonen uit een cDNA-bibliotheek in N. benthamiana en de beoordeling van de respons van gen tot zwijgen planten voor gecompromitteerde nonhost verzet tegen nonhost pathogenen, Pseudomonas syringae pv. tomaat T1, P. syringae pv. glycINEA, en X. campestris pv. vesicatoria. Deze bacteriële pathogenen zijn ontworpen om express GFPuv eiwitten en hun groene fluorescerende kolonies zichtbaar met het blote oog onder UV-licht in de nonhost pathogeen geënte planten als draaid doelgen is betrokken in het meegeven nonhost weerstand. Dit vergemakkelijkt betrouwbare en snellere identificatie van gen tot zwijgen planten vatbaar voor nonhost pathogenen. Verder kan veelbelovende kandidaat-gen gegevens worden gekend door sequencing de plant geninsert in TRV vector. Hier laten we de high throughput capaciteit van VIGS gemedieerde forward genetics genen betrokken bij nonhost weerstand identificeren. Ongeveer, kan 100 cDNA individueel tot zwijgen worden gebracht in ongeveer twee tot drie weken en hun relevantie in nonhost weerstand tegen verscheidene nonhost bacteriële pathogenen kan worden bestudeerd in een week daarna. In dit manuscript, sommen we de gedetailleerde stappen die betrokken zijn bij deze screening. VIGS-gemedieerde forward genetics screening aanpak kan worden uitgebreid niet alleen om de identificatie van genen die betrokken zijn bij nonhost verzet, maar ook aan het bestuderen van genen meegeven van verschillende biotische en abiotische stress tolerantie in verschillende plantensoorten.

Belangrijkste doel van deze studie is om een methode aan te tonen voor een eenvoudige en nauwkeurige identificatie van gen tot zwijgen N. benthamiana planten die worden aangetast voor nonhost weerstand. Er zijn vier belangrijke stappen in deze methode. Eerste stap is om individueel zwijgen groot aantal genen met behulp van TRV-VIGS. We hadden ongeveer 5.000 genen 6,18 zwijgen over een periode van ongeveer 1,5 jaar gebruik van het protocol in figuur 1. Sommige genen tot zwijgen plante...

Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Virus-geïnduceerde gene silencing is een nuttig hulpmiddel voor het identificeren van genen betrokken bij nonhost resistentie van planten. We demonstreren het gebruik van bacteriële pathogenen tot expressie GFPuv het identificeren gen zwijgen planten vatbaar voor nonhost pathogenen. Deze benadering is eenvoudig, snel en faciliteert grootschalige screening en soortgelijk protocol kan worden toegepast op het bestuderen van verschillende andere planten-microbe interacties.

VIGS-Mediated Forward Genetics Screening voor de identificatie van genen betrokken bij Nonhost Resistance


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

Research

JoVE Journal

Immunology and Infection

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

RNAi Screening voor Host factoren die betrokken zijn in Vaccinia Virus infectie met behulp van Drosophila Cellen

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Menselijk In Vitro Onderdrukking als Screening Tool voor de erkenning van een vroege staat van Immune Imbalance

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response ...

Reverse Genetics Mediated Recovery of Infectious Murine Norovirus

Reverse genetics Mediated Herstel van infectieuze Murine Norovirus

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close ...

Forward Genetic Approaches in Chlamydia trachomatis

Forward Genetic Approaches in Chlamydia trachomatis

Forward Genetische technieken in<em&gt; Chlamydia trachomatis</em

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Met behulp van RNA-interferentie te onderzoeken de aangeboren immuunrespons in muizenmacrofagen

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Identificatie van nieuwe genen geassocieerd met alginaat Productie in<em&gt; Pseudomonas aeruginosa</em&gt; Het gebruik van mini-<em&gt; Himar1</em&gt; Mariner transposon-gemedieerde mutagenese

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

Snelle screening van HIV reverse transcriptase en integrase-remmers

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify ...

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-ÃƒÅ½Ã‚Â³-Dependent Cell Autonomous Immunity

Forward Genetica Schermen Met behulp van macrofagen te identificeren<em&gt; Toxoplasma gondii</em&gt; Genen Belangrijk voor Weerstand tegen IFN-γ-Dependent Cell Autonome Immuniteit

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within ...

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

-Microscopie gebaseerde testen voor high-throughput screening van Host factoren die betrokken zijn in<em&gt; Brucella</em&gt; Infectie van Hela cellen

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...