Name: vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance
Uploaded: 2013-08-23T13:00:00
Description: Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

פרויקט זה מומן על ידי קרן נובל סמואל רוברטס. מחברים מודים למיז. Elles ג&#39;ייני Gallaway וקולין לטיפול בצמח מצוין, והגב &#39;קייטי בראון ליצירות אמנות. כמו כן, אנו רוצים להודות למיז. טרינה קוטרל, פוג&#39;ה Uppalapati, Moumita סאהה, Swetha Vinukonda ומר יצחק גרינהוט לעזרה טכנית בהקמתה של פרוטוקול זה.

1. גידול צמחים והשתקת גני יעד <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תנאי גידול צמחים: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> נ &#39;תזרע זרעי benthamiana על אדמה פחות תערובת שתילה, מטרו-Mix 350 ואת הזרעים לנבוט בתא גידול. כל אדמה אחרת או אדמה פחות בי...

<ol>
	<li>Heath, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+and+nonspecific+plant+defenses.">Nonhost resistance and nonspecific plant defenses.</a> Currrent Opinion in Plant Biology. 3, 315-319 (2000).</li><li>Mysore, K. S., Ryu, C. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance:+how+much+do+we+know.">Nonhost resistance: how much do we know.</a> Trends in Plant Science. 9, 97-104 (2004).</li><li>Ellis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+nonhost+disease+resistance:+can+they+assist+disease+control+in+agriculture.">Insights into nonhost disease resistance: can they assist disease control in agriculture.</a> The Plant Cell. 18, 523-528 (2006).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+against+bacterial+pathogens:+retrospects+and+prospects.">Nonhost resistance against bacterial pathogens: retrospects and prospects.</a> Annual Review of Phytopathology. 51, (2013).</li><li>Lu, M., Tang, X., Zhou, J. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+NHO1+is+required+for+general+resistance+against+Pseudomonas+bacteria.">Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.</a> The Plant Cell. 13, 437-447 (2001).</li><li>Rojas, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycolate+oxidase+plays+a+major+role+during+nonhost+resistance+responses+by+modulating+reactive+oxygen+species+mediated+signal+transduction+pathways.">Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways.</a> The Plant Cell. 24, 336-352 (2012).</li><li>Daurelio, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+reveals+novel+genes+involved+in+nonhost+response+to+bacterial+infection+in+tobacco.">Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco.</a> Journal of Plant Physiology. 168, 382-391 (2011).</li><li>Moreau, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EDS1+contributes+to+nonhost+resistance+of+Arabidopsis+thaliana+against+Erwinia+amylovora.">EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora.</a> Molecular Plant-Microbe Interactions. 25, 421-430 (2012).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ornithine-delta-aminotransferase+and+proline+dehydrogenase+genes+play+a+role+in+non-host+disease+resistance+by+regulating+pyrroline-5-carboxylate+metabolism-induced+hypersensitive+response.">Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response.</a> Plant, Cell &amp; Environment. 35, 1329-1343 (2012).</li><li>Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+and+advantages+of+virus-induced+gene+silencing+for+gene+function+studies+in+plants.">Applications and advantages of virus-induced gene silencing for gene function studies in plants.</a> The Plant Journal. 39, 734-746 (2004).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+for+VIGS+in+plant+functional+genomics.">New dimensions for VIGS in plant functional genomics.</a> Trends in Plant Science. 16, 656-665 (2011).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+can+persist+for+more+than+2+years+and+also+be+transmitted+to+progeny+seedlings+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato.</a> Plant Biotechnology Journal. 9, 797-806 (2011).</li><li>Bombarely, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+draft+genome+sequence+of+Nicotiana+benthamiana+to+enhance+molecular+plant-microbe+biology+research.">A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research.</a> Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).</li><li>Sharma, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+silencing+of+WIPK+and+SIPK+genes+reduces+resistance+to+a+bacterial+pathogen,+but+has+no+effect+on+the+INF1-induced+hypersensitive+response+(HR)+in+Nicotiana+benthamiana.">Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana.</a> Mol Gen Genomics. 269, 583-591 (2003).</li><li>Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+forward+genetics+based+on+virus-induced+gene+silencing.">Fast forward genetics based on virus-induced gene silencing.</a> Current Opinion in Plant Biology. 2, 109-113 (1999).</li><li>Lu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+virus-induced+gene+silencing+implicates+heat+shock+protein+90+in+plant+disease+resistance.">High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance.</a> EMBO Journal. 22, 5690-5699 (2003).</li><li>Pozo, O., Pedley, K. F., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MAPKKK[alpha]+is+a+positive+regulator+of+cell+death+associated+with+both+plant+immunity+and+disease.">MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease.</a> EMBO Journal. 23, 3072-3082 (2004).</li><li>Wang, K., Senthil-Kumar, M., Ryu, C. -. M., Kang, L., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phytosterols+play+a+key+role+in+plant+innate+immunity+against+bacterial+pathogens+by+regulating+nutrient+efflux+into+the+apoplast.">Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast.</a> Plant Physiology. 158, 1789-1802 (2012).</li><li>Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+in+planta+bacterial+infection+at+both+cellular+and+whole-plant+levels+using+the+green+fluorescent+protein+variant+GFPuv.">Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv.</a> New Phytologist. 174, 212-223 (2007).</li><li>Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+Advance:+Tobacco+rattle+virus+as+a+vector+for+analysis+of+gene+function+by+silencing.">Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing.</a> The Plant Journal. 25, 237-245 (2001).</li><li>MacFarlane, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+biology+of+the+tobraviruses.">Molecular biology of the tobraviruses.</a> Journal of General Virology. 80, 2799-2807 (1999).</li><li>Anand, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+plant+genes+involved+in+Agrobacterium-mediated+plant+transformation+by+virus-induced+gene+silencing.">Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing.</a> Molecular Plant-Microbe Interactions. 20, 41-52 (2007).</li><li>Liu, E., Page, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+cDNA+libraries+for+virus-induced+gene+silencing+(VIGS)+using+tobacco+rattle+virus.">Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus.</a> Plant Methods. 4, 5 (2008).</li><li>Vel&#225;squez, A. C., Chakravarthy, S., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+(VIGS)+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato.</a> J. Vis. Exp. (28), e1292 (2009).</li><li>Peart, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitin+ligase-associated+protein+SGT1+is+required+for+host+and+nonhost+disease+resistance+in+plants.">Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants.</a> Proceedings of the National Academy of Sciences. 99. , 99-10869 (2002).</li><li>Oh, S. -. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insight+into+Types+I+and+II+nonhost+resistance+using+expression+patterns+of+defense-related+genes+in+tobacco.">Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco.</a> Planta. 223, 1101-1107 (2006).</li><li>Senthil-Kumar, M., Mysore, K., Kodama, H., Komamine, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+and+Plant+Gene+Function+Analysis.">RNAi and Plant Gene Function Analysis.</a> Methods in Molecular Biology. 744, 13-25 (2011).</li></ol>

חסינות צמח מגבילה את הצמיחה של פתוגנים nonhost ולכן, מעט או ללא הקרינה ירוקה נפלט ממפעל בקרת וקטור משאיר מחוסן עם הפתוגן nonhost תחת אור UV אורך גל ארוך (איור 3D). עם זאת, כאשר גן המעורב בהתנגדות nonhost מושתק, הצמחים השתיקו גנים להעדיף הצמיחה של הקרינה הפתוגן והירוקה nonhost ?...

התנגדות Nonhost היא ההתנגדות של כל מיני צמחים נגד גזעים של 1,2 הפתוגן מסוים. זה מקנה קשת רחבה ועמידות למחלות בצמחים עמידים 2,3. עם זאת, המנגנון שלה, במיוחד נגד חיידקים פתוגנים, אינו מובן היטב 4. הקרנה למוטציות או צמחים השתיקו כי התנגדות nonhost פשרה, ואפיון תמליל תפוקה גבוהה לזיהוי של גנים באופן דיפרנציאלי לידי ביטוי במהלך nonhost התנגדות 5-9 שתי גישות עיקריות המשמשות בעבר להתנגדות לנתח nonhost חיידקים. בגלל התנגדות nonhost נשלטת על ידי מנגנון מורכב (ים) 4 עם המעורבות של גנים רבים, גישה פונקציונלי תפוקה גבוהה גנומי לזיהוי גן הוא קריטי להבנת מנגנון התנגדות nonhost (ים) טובה יותר. וירוס-Induced השתקת גן (VIGS) שימש בהצלחה להשתיק צמח אנדוגניהגנים במיני צמחים רבים 10,11. ניקוטיאנה benthamiana הוא אחד הצמחים המתאימים ביותר עבור VIGS 10,12 וטיוטת רצף הגנום שלו זמין כעת 13. וירוס רעשן טבק (TRV) מבוסס VIGS כבר בשימוש נרחב ככלי גנטיקה הפוך כדי לאפיין את הגנים מעורבים בnonhost התנגדות 2,4,14. וקטורים ונגזרים VIGS זה זמינים כעת דרך מרכז משאבים ביולוגי ארבידופסיס (ABRC, <a href="http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html" target="_blank">http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html).</a> VIGS שימש גם ככלי לזיהוי גנטיקה קדימה גני המעורבים בחסינות צמח 15-17, התנגדות nonhost במיוחד 6,18. הערכת תגובת רגישות יתר (HR) בתיווך מוות של תאים הנגרם על ידי צמחים נגד הפתוגן nonhost ספציפי והערכת המוות של תאים הנגרם המחלה הן שני מבחני עיקריים המשמשים בעיקר לidentifyinגן רגיש גרם השתיק צמחים. עם זאת, המוות של תאי HR מושרה רק נגד פתוגנים nonhost מסוג II ולא נגד סוג I-nonhost פתוגנים 2. לפיכך, מבחני HR לא ניתן להשתמש באופן אוניברסלי לזהות אסטרטגיות התנגדות nonhost בשימוש על ידי צמחים, במיוחד נגד מגוון רחב של סוג I-פתוגנים nonhost. כמו כן, אובדן חלקי של התנגדות nonhost במפעל הושתק גן לא תמיד להוביל למחלות סימפטומים 6 ולכן ניקוד מחלה לא יכול לשמש לזיהוי צמחים להתפשר התנגדות nonhost. בניגוד, בהערכת הצמיחה של פתוגנים nonhost במפעלי גנים המושתקים היא שיטה טובה יותר ללימוד הפסד של התנגדות nonhost בצמחי גנים מושתקים. בהשוואה לגידול קונבנציונלי assay 6,19, שיטה מהירה יותר להערכת התפתחות חיידקי nonhost על צמחי הגן המושתקים יכול לקצר את הזמן הנדרש להקרנת גנטיקה קדימה. מוקדם יותר דיווחו לנו שיטה להתבוננות חיידקיםצמיחת הפתוגן לשמאל על ידי עלים עין בלתי מזוינת באולטרה סגול (UV) אור באמצעות חיידקים לבטא חלבון (GFP) 19 ניאון ירוק. בכתב היד הזה אנחנו מדגימים את השימושיות של GFPuv להביע חיידקים פתוגנים nonhost לזיהוי קל של צמחי גנים מושתקים שנפרצו להתנגדות nonhost. מתודולוגיה זו היא מדויקת לזיהוי של צמחים רגישים ונוחה להקרנת תפוקה גבוהה.

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent/equipment</td>
 <td>Company</td>
 <td>Catalogue number</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>96-well U-bottom plates</td>
 <td> Becton Dickinson Labware (Franklin Lakes, NJ, USA)</td>
 <td> 35-3077</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>96-pin replicator stainless steel</td>
 <td> Nalge Nunc International (Naperville, IL, USA)</td>
 <td> 250520</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> High Intensity UV Inspection Lamps, Model B-100ap</td>
 <td> Thomas scientific (Swedesboro, NJ, USA)</td>
 <td> 6283K50</td>
 <td> Manufacturer ID 95-0127-01</td>
 </tr>
 <tr>
 <td> Stuart SC6 colony counter</td>
 <td> Bibby Scientific Limited, Staffordshire, UK</td>
 <td> SC6PLUS</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Soil-less potting mixture, Metro-Mix 350</td>
 <td> SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)</td>
 <td>&nbsp;</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Primers: 
 attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT) 
 attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)</td>
 <td> Integrated DNA Technologies, Inc (Coralville, IA, USA)</td>
 <td> Custom synthesized</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> MES, Monohydrate</td>
 <td> VWR international (Radnor, PA, USA)</td>
 <td> CAS No. 145224-94-8</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Acetosyringone (Dimethoxy-4'-hydroxyacetophenone)</td>
 <td> Sigma Aldrich (St. Louis, MO, USA)</td>
 <td> D134406</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Vac-In-Stuff (Silwet L-77)</td>
 <td> Lehle Seeds (Round Rock, TX, USA)</td>
 <td> VIS-30</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
</table>

vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance

עמידות למחלות של צמחי Nonhost נגד חיידקים פתוגנים נשלטת על ידי מסלולים הבטחוני מורכבים. הבנת מנגנון זה היא חשובה לפיתוח צמחים עמידים למחלה עמידות כנגד מגוון רחב של פתוגנים. וירוס-Induced השתקת גן (VIGS) הקרנה מבוססת קדימה גנטיקה היא גישה שימושית לזיהוי של גנים להגנת צמחים הקניית התנגדות nonhost. וירוס רעשן טבק (TRV) וקטור VIGS הוא וקטור VIGS יעיל ביותר עד כה, וכבר בשימוש על בסיס יעילות כדי להשתיק גני המטרה אנדוגניים בניקוטיאנה benthamiana. בכתב היד הזה, אנחנו מדגימים את גישת הקרנת גנטיקה קדימה להשתקה של שיבוטים בודדים מספריית cDNA בנ benthamiana והערכת התגובה של צמחים הושתקו גן לנפרץ התנגדות nonhost נגד פתוגנים nonhost, Pseudomonas syringae PV. עגבניות T1, פ syringae PV. glycinea, וX. campestris PV. סיקטור. חיידקים פתוגנים אלה מהונדסים לחלבון GFPuv המפורש וניתן לראות על ידי עין בלתי מזוינת מושבות fluorescing הירוקות שלהם תחת אור UV בצמחים מחוסן הפתוגן nonhost אם גן היעד השתיק מעורבת בהקניית עמידות nonhost. זה מאפשר זיהוי אמין ומהיר של גנים מושתקים צמחים רגישים לפתוגנים nonhost. יתר על כן, מידע גן המועמד מבטיח יכול להיות מוכר על ידי הוספת רצף גן הצמח בTRV וקטור. כאן אנו מדגימים את יכולת התפוקה הגבוהה של גנטיקה קדימה VIGS בתיווך לזהות גני המעורבים בהתנגדות nonhost. כ, 100 cDNAs יכול להיות מושתק באופן אישי בכ שבועות עד שלושה שבועות ואת הרלוונטיות שלהם בהתנגדות nonhost נגד מספר חיידקים פתוגנים nonhost ניתן ללמוד בשבוע שלאחר מכן. בכתב היד הזה, אנו למנות מעורבים בהקרנה זו את הצעדים המפורטים. VIGS בתיווך קדימה הגנטיקה screeniגישת ng ניתן להרחיב לא רק לגנים מעורבים בזיהוי התנגדות nonhost אלא גם כדי ללמוד כמה גני הקניית העמידות מתח יוטיים ואביוטי במינים צמחים שונים.

מטרה העיקרית של מחקר זה היא להדגים שיטה לזיהוי קל ומדויק של הגן השתיק נ צמחי benthamiana שנפרצו להתנגדות nonhost. ישנם ארבעה שלבים עיקריים בשיטה זו. צעד הראשון הוא בנפרד כדי להשתיק מספר רב של גנים באמצעות TRV-VIGS. אנחנו השתקנו כ -5,000 גנים 6,18 על פני תקופה של כ -1.5 שנים ...

Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

וירוס-Induced השתקת הגן היא כלי שימושי לזיהוי גני המעורבים בהתנגדות nonhost של צמחים. אנו מדגימים את השימוש בחיידקים פתוגנים המבטאים GFPuv בזיהוי גנים מושתקים צמחים רגישים לפתוגנים nonhost. גישה זו היא קלה, מהירה ומאפשרת הקרנה בקנה מידה גדולה ופרוטוקול דומה ניתן ליישם בחקר אינטראקציות צמח חיידק אחרים שונות.

הקרנת גנטיקה קדימה VIGS בתיווך לזיהוי גני המעורבים בהתנגדות Nonhost


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

Research

JoVE Journal

Immunology and Infection

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

RNAi הקרנת עבור גורמים מארח מעורב Vaccinia וירוס זיהום באמצעות תסיסנית תאים

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

אנושי במבחנה דיכוי ככלי מיון עבור הכרה של מדינת מוקדם של חוסר איזון החיסון

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response ...

Reverse Genetics Mediated Recovery of Infectious Murine Norovirus

שחזור הפוך גנטיקה מתווכת של norovirus Murine זיהומיות

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close ...

Forward Genetic Approaches in Chlamydia trachomatis

Forward Genetic Approaches in Chlamydia trachomatis

גישות גנטיות בקדימה<em&gt; כלמידיה trachomatis</em

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

באמצעות RNA-התערבות לחקר התגובה החיסונית המולדת בהמקרופאגים עכבר

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

זיהוי גנים הקשורים לרומן אלגינט ייצור ב<em&gt; Pseudomonas aeruginosa</em&gt; שימוש מיני<em&gt; Himar1</em&gt; Mutagenesis תיווך transposon מרינר

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

הקרנה מהירה של HIV ההפוך טרנסקריפטאז וintegrase המעכבים

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify ...

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-ÃƒÅ½Ã‚Â³-Dependent Cell Autonomous Immunity

קדימה גנטיקה מסכי שימוש המקרופאגים לזיהוי<em&gt; Toxoplasma gondii</emחסינות אוטונומית נייד להתנגדות לIFN-γ-Dependent&gt; גנים חשובים

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within ...

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

מיקרוסקופי מבוססת מבחנים עבור הקרנת תפוקה גבוהה של גורמי מארח המעורבים<em&gt; Brucella</em&gt; זיהום של תאים הלה

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...