Name: investigating the effects of probiotics on pneumococcal colonization using an in vitro adherence assay
Uploaded: 2014-04-28T13:45:00
Description: Watch this Scientific Journal Video about Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay Video at JoVE.com

Dette arbejde blev støttet med midler fra Murdoch Childrens Research Institute og Victorias regerings operationelle infrastruktur Support Program.

1.. Udarbejdelse af Epithelial og bakterieceller <ol><li> Optøning af CCL-23 epitelceller <ol><li> Forvarm Minimum Essential Media (MEM) indeholdende 10% føtalt bovint serum (FBS) i et 37 ° C vandbad i ~ 30 minutter. </li><li> Steriliser vævskultur godkendt biosikkerhed kabinet med UV-lys i mindst 10 minutter før brug, og tør ned arbejdsområde med 70% ethanol. Tør varmede medier flaske med 70% ethanol og plads i biosikkerhed kabinet. </li><li> Anvendelse af en 25 ml pipette 14 ml medium i en T...

<ol>
	<li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> Lancet. 374, 893-902 (2009).</li><li>Bogaert, D., de Groot, R., Hermans, P. W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcus+pneumoniae+colonisation:+the+key+to+pneumococcal+disease.">Streptococcus pneumoniae colonisation: the key to pneumococcal disease.</a> Lancet Infect. Dis. 4 (04), 144-154 (2004).</li><li>Weinberger, D. M., Malley, R., Lipsitch, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+replacement+in+disease+after+pneumococcal+vaccination.">Serotype replacement in disease after pneumococcal vaccination.</a> Lancet. 378 (10), 1962-1973 (2011).</li><li>Jacoby, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+the+co-occurrence+of+Streptococcus+pneumoniae+with+other+bacterial+and+viral+pathogens+in+the+upper+respiratory+tract.">Modelling the co-occurrence of Streptococcus pneumoniae with other bacterial and viral pathogens in the upper respiratory tract.</a> Vaccine. 25, 2458-2464 (2007).</li><li>Kwambana, B., Barer, M., Bottomley, C., Adegbola, R., Antonio, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+acquisition+and+high+nasopharyngeal+co-colonisation+by+Streptococcus+pneumoniae+and+three+respiratory+pathogens+amongst+Gambian+new-borns+and+infants.">Early acquisition and high nasopharyngeal co-colonisation by Streptococcus pneumoniae and three respiratory pathogens amongst Gambian new-borns and infants.</a> BMC Infect. Dis. 11, (2011).</li><li>Licciardi, P. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protecting+against+pneumococcal+disease:+critical+interactions+between+probiotics+and+the+airway+microbiome.">Protecting against pneumococcal disease: critical interactions between probiotics and the airway microbiome.</a> PLoS Pathog. 8, (2012).</li><li>Popova, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beneficial+effects+of+probiotics+in+upper+respiratory+tract+infections+and+their+mechanical+actions+to+antagonize+pathogens.">Beneficial effects of probiotics in upper respiratory tract infections and their mechanical actions to antagonize pathogens.</a> J. Appl. Microbiol. 113 (6), 1305-1318 (2012).</li><li>Pracht, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PavA+of+Streptococcus+pneumoniae+modulates+adherence,+invasion,+and+meningeal+inflammation.">PavA of Streptococcus pneumoniae modulates adherence, invasion, and meningeal inflammation.</a> Infect. Immun. 73, 2680-2689 (2005).</li><li>Adamou, J. E., Wizemann, T. M., Barren, P., Langermann, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adherence+of+Streptococcus+pneumoniae+to+human+bronchial+epithelial+cells+(BEAS-2B).">Adherence of Streptococcus pneumoniae to human bronchial epithelial cells (BEAS-2B).</a> Infect. Immun. 66, 820-822 (1998).</li><li>Wong, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Streptococcus+pneumoniae+adherence+to+human+epithelial+cells+in+vitro+by+the+probiotic+Lactobacillus+rhamnosus+GG.">Inhibition of Streptococcus pneumoniae adherence to human epithelial cells in vitro by the probiotic Lactobacillus rhamnosus GG.</a> BMC Res. Notes. 6 (1), 135 (2013).</li><li>Wescombe, P. A., Heng, N. C. K., Burton, J. P., Chilcott, C. N., Tagg, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcal+bacteriocins+and+the+case+for+Streptococcus+salivarius+as+model+oral+probiotics.">Streptococcal bacteriocins and the case for Streptococcus salivarius as model oral probiotics.</a> Future Microbiol. 4, 819-835 (2009).</li><li>Di Pierro, F., Adami, T., Rapacioli, G., Giardini, N., Streitberger, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+evaluation+of+the+oral+probiotic+Streptococcus+salivarius+K12+in+the+prevention+of+recurrent+pharyngitis+and/or+tonsillitis+caused+by+Streptococcus+pyogenes+in+adults.">Clinical evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes in adults.</a> Expert. Opin. Biol. Ther. 13 (3), 339-343 (2013).</li><li>Fiedler, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+mechanisms+of+respiratory+tract+streptococci+against+Streptococcus+pyogenes+biofilm+formation+and+epithelial+cell+infection.">Protective mechanisms of respiratory tract streptococci against Streptococcus pyogenes biofilm formation and epithelial cell infection.</a> Appl. Environ. Microbiol. 79, 1265-1276 (2013).</li><li>Slotved, H. C., Satzke, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+growth+of+pneumococcal+isolates+representing+23+different+serotypes.">In vitro growth of pneumococcal isolates representing 23 different serotypes.</a> BMC Res. Notes. 6, 10-1186 (2013).</li><li>Carvalho, M. d. G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+and+improvement+of+real-time+PCR+assays+targeting+lytA,+ply,+and+psaA+genes+for+detection+of+pneumococcal+DNA.">Evaluation and improvement of real-time PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA.</a> J. Clin. Microbiol. 45, 2460-2466 (2007).</li><li>Tonnaer, E. L. G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+glycosaminoglycans+in+the+attachment+of+pneumococci+to+nasopharyngeal+epithelial+cells.">Involvement of glycosaminoglycans in the attachment of pneumococci to nasopharyngeal epithelial cells.</a> Microbes Infect. 8, 316-322 (2006).</li><li>Smith-Vaughan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+nasal+bacterial+load+and+its+association+with+otitis+media.">Measuring nasal bacterial load and its association with otitis media.</a> BMC Ear Nose Throat Disord. 6, (2006).</li><li>Letourneau, J., Levesque, C., Berthiaume, F., Jacques, M., Mourez, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+assay+of+bacterial+adhesion+onto+mammalian+epithelial+cells.">In vitro assay of bacterial adhesion onto mammalian epithelial cells.</a> J. Vis. Exp. , (2011).</li></ol>

En kritisk del af dette assay er at tilføje de passende koncentrationer af S. salivarius og pneumokokker i afsnit 3.1.7 og 3.1.12. Koncentrationerne estimeres ved brug OD aflæsninger men den nøjagtige inocula er ikke fastsat indtil pladerne tælles den følgende dag. Af denne grund anbefaler vi udfører vækstkurver at måle OD og kimtal (CFU / ml) over tid for alle anvendte bakteriestammer i analysen at identificere de midt-log-fase og hjælpe med at estimere koncentrationen af ​​OD. Derudover kan pneum...

Streptococcus pneumoniae (pneumococcus) er en grampositiv bakterie, der kan forårsage infektioner, herunder lungebetændelse, otitis media, og meningitis. Det er en væsentlig årsag til sygdom hos børn i lavindkomstlande og ansvarlig for anslået 800.000 dødsfald blandt børn under fem år hvert år 1. Pneumokokker foregår ofte i nasopharynx af unge børn. Selv om denne kolonisering generelt betragtes asymptomatisk det forud pneumokokinfektion og tjener som et reservoir for bakterier i humane populationer 2. Pneumokok konjugat vaccination effektivt reducerer transporten af ​​serotyper indeholdt i vaccinen. Men der er over 90 pneumokok serotyper, og vaccination kan føre til serotype udskiftning, hvorved fjernelsen af vaccine serotyper er efterfulgt af en stigning i vogn og sygdom forårsaget af nonvaccine serotyper 3. Også i nogle høj-risiko populationer, pneumokokkolonisering ofte forekommer meget tidligt i livet, før indgivelse af den første vaccinedosis 4,5. For nylig er der foreslået anvendelsen af probiotika som en yderligere strategi til at inhibere pneumokok kolonisering 6,7. In vitro adhærens assays er blevet anvendt til at undersøge pneumokok vedhæftning 8,9. Disse analyser er blevet tilpasset for at undersøge effekten af den probiotiske Lactobacillus rhamnosus GG (LGG) på pneumokok vedhæftning 10.. Ud over LGG og andre mælkesyrebakterier, Streptococcus salivarius, en fælles hjemmehørende i mundhulen, er blevet undersøgt som en potentiel probiotisk til luftvejene på grund af sin kolonisering potentiale og evne til at inhibere pneumokokker og andre respiratoriske patogener in vitro 11 - 13.. Protokollen præsenteres her beskriver en adhærenceprøve anvendes til at undersøge virkningerne af S. salivarius K12 om pneumokok vedhæftningtil det humane epiteliale cellelinje CCL-23. Inden brug i analysen, blev pneumokokisolater evalueret for compliance kapaciteter, som vækst og overholdelse egenskaber kan variere betydeligt blandt isolater 10,14. Vækstkurver pneumokokker og S. salivarius blev udført for at bestemme mid-log-fase og koncentration estimatet (kolonidannende enheder eller CFU / ml) ved optisk tæthed (OD, figur 1). Det anbefales at undersøge vækst ved kimtal og OD for hvert isolat inden anvendelse i assayet. Dette assay kan udføres i alle laboratorier med standard vævskultur faciliteter og udstyr. I denne protokol, effekten af tre doser af S. salivarius administreret 1 time før tilsætningen af pneumokokker på vedhæftningen af S. pneumoniae PMP843 en serotype 19F transport isolat afledt fra en nasopharyngeal podepind, er undersøgt. To forskellige måder at kvantificere klæbende pneumokokker præsenteres: plating på blodagar at afskrækkemine levedygtighedstællinger, og DNA-ekstraktion og afsløring af pneumokok LytA genet ved qPCR 15. Den grundlæggende adhærenceprøve protokol kan let modificeres til at teste forskellige doser eller tidspunktet for indgivelse af probiotika og kan også anvendes sammen med andre bakterielle stammer eller arter.

<table border="0" cellpadding="0" cellspacing="0" width="1318">
	<colgroup>
		<col />
		<col />
		<col />
		<col span="2" />
	</colgroup>
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Minimum Essential Media (MEM)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">SH30244.01</td>
			<td style="width:377px;"> </td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Fetal Bovine Serum (FBS)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td>SH30084.03</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">T-75 Flask</td>
			<td style="width:155px;">Nunc</td>
			<td>156472</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">CCL-23 cells</td>
			<td style="width:155px;">ATCC</td>
			<td style="width:147px;">CCL-23</td>
			<td style="width:377px;"> </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Trypsin</td>
			<td>Life Technologies</td>
			<td>15090046</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:264px;">24-well cell culture plate</td>
			<td style="width:155px;">Nunc</td>
			<td style="width:147px;">142475</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Horse blood agar (HBA) plates</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">PP2001</td>
			<td>Sheep blood agar plates also acceptable</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Todd-Hewitt Broth</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">CM0189</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Yeast Extract</td>
			<td style="width:155px;">Beckton Dickinson</td>
			<td style="width:147px;">212750</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Digitonin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:147px;">D141-100MG</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Disposable cuvettes</td>
			<td style="width:155px;">Kartell</td>
			<td>1938</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Heparin</td>
			<td style="width:155px;">Pfizer</td>
			<td style="width:147px;">2112105</td>
			<td>comes in sterile ampules at 5,000IU/5mL </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">sterile spreader</td>
			<td style="width:155px;">Technoplas</td>
			<td style="width:147px;">S10805050</td>
			<td style="width:377px;">alternatively, a glass spreader can be dipped in 96% ethanol and flame sterilized before each use</td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">L6876</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mutanolysin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">M9901</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Proteinase K</td>
			<td>Qiagen</td>
			<td>19133</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">SDS 20% solution</td>
			<td>Ambion </td>
			<td style="width:147px;">AM9820</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">RNase A</td>
			<td>Qiagen</td>
			<td style="width:147px;">19101</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">QIAamp DNA mini-kit (250)</td>
			<td>Qiagen</td>
			<td style="width:147px;">51306</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA F primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence ACGCAATCTAGCAGATGAAGCA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA R primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence TCGTGCGTTTTAATTCCAGCT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA probe</td>
			<td>Eurogentec</td>
			<td style="width:147px;">Custom made</td>
			<td colspan="2">5&#39; -&#62; 3&#39; sequence Cy5-TGCCGAAAACGCTTGATACAGGGAG-BHQ3, alternative fluorophores can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Nuclease free water</td>
			<td>Ambion</td>
			<td style="width:147px;">AM9906</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Brilliant III Ultra Fast QPCR mastermix</td>
			<td>Agilent Technologies </td>
			<td style="width:147px;">600880</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Thermo-Fast 96 Detection plate </td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-1100</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Ultra clear qPCR cap strips</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-0866</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mx3005 QPCR System</td>
			<td style="width:155px;">Agilent Technologies </td>
			<td style="width:147px;">401449</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;"> </td>
			<td style="width:155px;"> </td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">* alternative sources are available for most/all products listed</td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

investigating the effects of probiotics on pneumococcal colonization using an in vitro adherence assay

Vedhæftning af Streptococcus pneumoniae (pneumococcus) til epitelforingen af nasopharynx kan resultere i kolonisering og betragtes som en forudsætning for pneumokokinfektioner såsom lungebetændelse og otitis media. In vitro adhærens assays kan anvendes til at undersøge bindingen af pneumokokker til epitelcelle monolag og undersøge potentielle interventioner, såsom anvendelse af probiotika, at inhibere pneumokok kolonisering. Protokollen beskrevet her anvendes til at undersøge virkningerne af den probiotiske Streptococcus salivarius på vedhæftningen af pneumokokker til den humane epiteliale cellelinje CCL-23 (undertiden benævnt HEp-2-celler). Analysen omfatter tre trin: 1) Fremstilling af epitel og bakterielle celler, 2) tilsætning af bakterier til epitelceller monolag, og 3) påvisning af klæbende pneumokokker ved kimtal (seriel fortynding og pletteringsudstyr) eller kvantitativ real-time PCR (qPCR ). Denne technique er forholdsvis enkel og ikke kræver specialiseret udstyr, bortset fra en vævskultur setup. Analysen kan anvendes til at teste andre probiotiske arter og / eller potentielle hæmmere af pneumokok kolonisering og kan let ændres til at løse andre videnskabelige spørgsmål vedrørende pneumokok vedhæftning og invasion.

Resultater fra et repræsentativt eksperiment, hvor pneumokokker (S. pneumoniae PMP843 en koloniserende 19F isolat) blev tilsat til CCL-23 celler i 1 time efter tilsætning af S. salivarius og pneumokok vedhæftning blev kvantificeret ved både kimtal og Lyta qPCR er vist i tabel 2.. Resultaterne var konsistent mellem de to metoder til både det absolutte antal af bakterier (præsenteret som CFU / ml), og% tilslutning, normaliseret til det antal for vedhængende pneumokokker i...

Watch this Scientific Journal Video about Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay Video at JoVE.com

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay Video (Video) | JoVE

In vitro kan anvendes adhærens assays for at undersøge binding af Streptococcus pneumoniae til epitel cellemonolag og undersøge potentielle indgreb såsom anvendelse af probiotika til inhibering af pneumokok-kolonisering.

Undersøge effekterne af probiotika på Pneumokok Colonization Brug af en<em&gt; In Vitro</em&gt; Adhærenceprøven

Adherence of Streptococcus pneumoniae (the pneumococcus) to the epithelial lining of the nasopharynx can result in colonization and is considered a ...

Research

JoVE Journal

Immunology and Infection

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

In vitro Biofilm Formation in an 8-well Chamber Slide

In vitro Biofilm Formation in an 8-well Chamber Slide Video (Video) | JoVE

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. ...

A Microplate Assay to Assess Chemical Effects on RBL-2H3 Mast Cell Degranulation: Effects of Triclosan without Use of an Organic Solvent

A Microplate Assay to Assess Chemical Effects on RBL-2H3 Mast Cell Degranulation: Effects of Triclosan without Use of an Organic Solvent Video (Video) | JoVE

En Microplade Assay til vurdering af kemiske Virkninger på RBL-2H3 mastcelledegranulering: Effekter af Triclosan uden brug af et organisk opløsningsmiddel

Mast cells play important roles in allergic disease and immune defense against parasites. Once activated (e.g. by an allergen), they degranulate, a ...

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function Video (Video) | JoVE

In vitro assay at evaluere virkningen af immunoregulerende Pathways på HIV-specifikke CD4 T-celle effektorfunktion

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria Video (Video) | JoVE

Efter i Real Time konsekvenserne af Pneumokok virulensfaktorer i en akut Mouse Lungebetændelse Model Brug Bioluminescent Bakterier

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction Video (Video) | JoVE

Kapsulær Serotypning af<em&gt; Streptococcus pneumoniae</em&gt; Brug af Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination Video (Video) | JoVE

Kapsulær Serotypning af<em&gt; Streptococcus pneumoniae</em&gt; Af latexagglutinering

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

Using the Overlay Assay to Qualitatively Measure Bacterial Production of and Sensitivity to Pneumococcal Bacteriocins

Using the Overlay Assay to Qualitatively Measure Bacterial Production of and Sensitivity to Pneumococcal Bacteriocins Video (Video) | JoVE

Brug Overlay Assay til Kvalitativt foranstaltning Bakteriel Produktion af og følsomhed til Pneumokok Bakteriociner

Streptococcus pneumoniae colonizes the highly diverse polymicrobial community of the nasopharynx where it must compete with resident organisms.  We have ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction Video (Video) | JoVE

en<em&gt; In vitro</em&gt; Model af blodhjernebarrieren Brug Impedans Spektroskopi: En Fokus på T-celle-endotel Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Flow Cytometric Analysis of Particle-bound Bet v 1 Allergen in PM10

Flow Cytometric Analysis of Particle-bound Bet v 1 Allergen in PM10 Video (Video) | JoVE

Flow cytometri af partikelbundet Bet v 1 Allergen i PM10

Flow cytometry is a method widely used to quantify suspended solids such as cells or bacteria in a size range from 0.5 to several tens of micrometers in ...

Visualizing the Effects of Sputum on Biofilm Development Using a Chambered Coverglass Model

Visualizing the Effects of Sputum on Biofilm Development Using a Chambered Coverglass Model Video (Video) | JoVE

Visualisere virkningerne af sputum på Biofilm Development Ved hjælp af en Chambered dækglas Model

Biofilms consist of groups of bacteria encased in a self-secreted matrix. They play an important role in industrial contamination as well as in the ...