Name: investigating the effects of probiotics on pneumococcal colonization using an in vitro adherence assay
Uploaded: 2014-04-28T13:45:00
Description: Watch this Scientific Journal Video about Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay at JoVE.com

इस काम मर्डोक लड़कों की अनुसंधान संस्थान और विक्टोरियन सरकार का परिचालन बुनियादी सुविधाओं सहायता कार्यक्रम से धन के द्वारा समर्थित किया गया.

1. उपकला की तैयारी और बैक्टीरियल कोशिकाओं <ol><li> सीसीएल -23 उपकला कोशिकाओं का विगलन <ol><li> ~ 30 मिनट के लिए एक 37 डिग्री सेल्सियस पानी के स्नान में 10% भ्रूण गोजातीय सीरम (FBS) युक्त Prewarm न्यूनतम आवश्यक मीडिया (सदस्...

<ol>
	<li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> Lancet. 374, 893-902 (2009).</li><li>Bogaert, D., de Groot, R., Hermans, P. W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcus+pneumoniae+colonisation:+the+key+to+pneumococcal+disease.">Streptococcus pneumoniae colonisation: the key to pneumococcal disease.</a> Lancet Infect. Dis. 4 (04), 144-154 (2004).</li><li>Weinberger, D. M., Malley, R., Lipsitch, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+replacement+in+disease+after+pneumococcal+vaccination.">Serotype replacement in disease after pneumococcal vaccination.</a> Lancet. 378 (10), 1962-1973 (2011).</li><li>Jacoby, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+the+co-occurrence+of+Streptococcus+pneumoniae+with+other+bacterial+and+viral+pathogens+in+the+upper+respiratory+tract.">Modelling the co-occurrence of Streptococcus pneumoniae with other bacterial and viral pathogens in the upper respiratory tract.</a> Vaccine. 25, 2458-2464 (2007).</li><li>Kwambana, B., Barer, M., Bottomley, C., Adegbola, R., Antonio, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+acquisition+and+high+nasopharyngeal+co-colonisation+by+Streptococcus+pneumoniae+and+three+respiratory+pathogens+amongst+Gambian+new-borns+and+infants.">Early acquisition and high nasopharyngeal co-colonisation by Streptococcus pneumoniae and three respiratory pathogens amongst Gambian new-borns and infants.</a> BMC Infect. Dis. 11, (2011).</li><li>Licciardi, P. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protecting+against+pneumococcal+disease:+critical+interactions+between+probiotics+and+the+airway+microbiome.">Protecting against pneumococcal disease: critical interactions between probiotics and the airway microbiome.</a> PLoS Pathog. 8, (2012).</li><li>Popova, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beneficial+effects+of+probiotics+in+upper+respiratory+tract+infections+and+their+mechanical+actions+to+antagonize+pathogens.">Beneficial effects of probiotics in upper respiratory tract infections and their mechanical actions to antagonize pathogens.</a> J. Appl. Microbiol. 113 (6), 1305-1318 (2012).</li><li>Pracht, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PavA+of+Streptococcus+pneumoniae+modulates+adherence,+invasion,+and+meningeal+inflammation.">PavA of Streptococcus pneumoniae modulates adherence, invasion, and meningeal inflammation.</a> Infect. Immun. 73, 2680-2689 (2005).</li><li>Adamou, J. E., Wizemann, T. M., Barren, P., Langermann, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adherence+of+Streptococcus+pneumoniae+to+human+bronchial+epithelial+cells+(BEAS-2B).">Adherence of Streptococcus pneumoniae to human bronchial epithelial cells (BEAS-2B).</a> Infect. Immun. 66, 820-822 (1998).</li><li>Wong, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Streptococcus+pneumoniae+adherence+to+human+epithelial+cells+in+vitro+by+the+probiotic+Lactobacillus+rhamnosus+GG.">Inhibition of Streptococcus pneumoniae adherence to human epithelial cells in vitro by the probiotic Lactobacillus rhamnosus GG.</a> BMC Res. Notes. 6 (1), 135 (2013).</li><li>Wescombe, P. A., Heng, N. C. K., Burton, J. P., Chilcott, C. N., Tagg, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcal+bacteriocins+and+the+case+for+Streptococcus+salivarius+as+model+oral+probiotics.">Streptococcal bacteriocins and the case for Streptococcus salivarius as model oral probiotics.</a> Future Microbiol. 4, 819-835 (2009).</li><li>Di Pierro, F., Adami, T., Rapacioli, G., Giardini, N., Streitberger, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+evaluation+of+the+oral+probiotic+Streptococcus+salivarius+K12+in+the+prevention+of+recurrent+pharyngitis+and/or+tonsillitis+caused+by+Streptococcus+pyogenes+in+adults.">Clinical evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes in adults.</a> Expert. Opin. Biol. Ther. 13 (3), 339-343 (2013).</li><li>Fiedler, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+mechanisms+of+respiratory+tract+streptococci+against+Streptococcus+pyogenes+biofilm+formation+and+epithelial+cell+infection.">Protective mechanisms of respiratory tract streptococci against Streptococcus pyogenes biofilm formation and epithelial cell infection.</a> Appl. Environ. Microbiol. 79, 1265-1276 (2013).</li><li>Slotved, H. C., Satzke, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+growth+of+pneumococcal+isolates+representing+23+different+serotypes.">In vitro growth of pneumococcal isolates representing 23 different serotypes.</a> BMC Res. Notes. 6, 10-1186 (2013).</li><li>Carvalho, M. d. G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+and+improvement+of+real-time+PCR+assays+targeting+lytA,+ply,+and+psaA+genes+for+detection+of+pneumococcal+DNA.">Evaluation and improvement of real-time PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA.</a> J. Clin. Microbiol. 45, 2460-2466 (2007).</li><li>Tonnaer, E. L. G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+glycosaminoglycans+in+the+attachment+of+pneumococci+to+nasopharyngeal+epithelial+cells.">Involvement of glycosaminoglycans in the attachment of pneumococci to nasopharyngeal epithelial cells.</a> Microbes Infect. 8, 316-322 (2006).</li><li>Smith-Vaughan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+nasal+bacterial+load+and+its+association+with+otitis+media.">Measuring nasal bacterial load and its association with otitis media.</a> BMC Ear Nose Throat Disord. 6, (2006).</li><li>Letourneau, J., Levesque, C., Berthiaume, F., Jacques, M., Mourez, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+assay+of+bacterial+adhesion+onto+mammalian+epithelial+cells.">In vitro assay of bacterial adhesion onto mammalian epithelial cells.</a> J. Vis. Exp. , (2011).</li></ol>

इस परख की एक महत्वपूर्ण भाग एस की उचित मात्रा जोड़ना है वर्गों 3.1.7 और 3.1.12 में salivarius और pneumococci. सांद्रता आयुध डिपो रीडिंग का उपयोग कर रहे हैं अनुमान है लेकिन प्लेटों अगले दिन गिने जाते हैं जब तक सटीक inocula न?...

स्ट्रैपटोकोकस निमोनिया (pneumococcus) निमोनिया, ओटिटिस मीडिया, और मैनिंजाइटिस सहित संक्रमण पैदा कर सकता है कि एक ग्राम पॉजिटिव जीवाणु है. यह कम आय वाले देशों में बच्चों और सालाना 1 पांच साल की उम्र के तहत बच्चों के एक अनुमान के अनुसार 800,000 लोगों की मृत्यु के लिए जिम्मेदार में बीमारी का एक प्रमुख कारण है. Pneumococci अक्सर छोटे बच्चों की nasopharynx में किया जाता है. इस बसाना आम तौर पर स्पर्शोन्मुख माना जाता है, यह न्यूमोकोकल संक्रमण पछाड़ दिया और मानव आबादी 2 में बैक्टीरिया के लिए एक जलाशय के रूप में कार्य करता है. न्यूमोकोकल संयुग्म टीकाकरण को प्रभावी ढंग से वैक्सीन के भीतर निहित सीरमप्रकारों की ढुलाई कम कर देता है. हालांकि, वहाँ 90 न्यूमोकोकल सीरमप्रकारों खत्म हो गई हैं, और टीकाकरण वैक्सीन सीरमप्रकारों के उन्मूलन nonvaccine सीरमप्रकारों 3 की वजह से गाड़ी और रोग में वृद्धि के बाद है जिसके तहत सीरोटाइप प्रतिस्थापन, करने के लिए नेतृत्व कर सकते हैं. इसके अलावा, कुछ उच्च जोखिम आबादी में, न्यूमोकोकलउपनिवेशन अक्सर पूर्व प्रथम टीका खुराक 4,5 के प्रशासन के लिए बहुत जल्दी जीवन में होता है. हाल ही में, प्रोबायोटिक्स का उपयोग न्यूमोकोकल बसाना 6,7 बाधित करने के लिए एक अतिरिक्त रणनीति के रूप में प्रस्तावित किया गया है. इन विट्रो पालन assays न्यूमोकोकल पालन 8,9 जांच करने के लिए इस्तेमाल किया गया है. ये assays न्यूमोकोकल पालन 10 पर प्रोबायोटिक लैक्टोबैसिलस rhamnosus GG (LGG) के प्रभाव की जांच करने के लिए अनुकूलित किया गया है. LGG और अन्य लैक्टिक एसिड बैक्टीरिया के अलावा, स्ट्रेप्टोकोकस salivarius, मौखिक गुहा का एक आम निवासी होने के कारण संभावित और इन विट्रो 11 में pneumococci और अन्य सांस रोगजनकों को बाधित करने की क्षमता अपनी बसाना को श्वसन तंत्र के लिए एक संभावित प्रोबायोटिक के रूप में जांच की गई है - 13. यहाँ प्रस्तुत प्रोटोकॉल एस के प्रभाव की जांच करने के लिए इस्तेमाल एक पालन परख का वर्णन न्यूमोकोकल पालन पर salivarius K12मानव उपकला कोशिका लाइन सीसीएल-23 के लिए. विकास और पालन गुणों आइसोलेट्स 10,14 के बीच काफी भिन्न हो सकती हैं परख में उपयोग करने से पहले, न्यूमोकोकल वियोजन, पालन क्षमताओं लिए मूल्यांकन किया गया. Pneumococci और एस के विकास घटता salivarius (आयुध डिपो, चित्रा 1) ऑप्टिकल घनत्व द्वारा मध्य लॉग चरण और अनुमान एकाग्रता (कॉलोनी बनाने इकाइयों या CFU / एमएल) निर्धारित करने के लिए प्रदर्शन किया गया. यह प्रत्येक परख में उपयोग करने के लिए पहले अलग के लिए व्यवहार्य गिनती और आयुध डिपो द्वारा वृद्धि की जांच की सिफारिश की है. यह परख मानक टिशू कल्चर सुविधाओं और उपकरणों के साथ किसी भी प्रयोगशाला में किया जा सकता है. इस प्रोटोकॉल में, एस के तीन खुराक का प्रभाव salivarius पूर्व एस के पालन पर pneumococci के अलावा करने के लिए 1 घंटे प्रशासित निमोनिया PMP843, एक nasopharyngeal झाड़ू से व्युत्पन्न एक सीरोटाइप 19F गाड़ी अलग, जांच कर रहे हैं. पक्षपाती pneumococci यों के लिए दो अलग अलग तरीके प्रस्तुत कर रहे हैं: रोकते रक्त अगर पर चढ़ानामेरा व्यवहार्य मायने रखता है, और डीएनए निष्कर्षण और qPCR 15 से न्यूमोकोकल lytA जीन का पता लगाने. बुनियादी पालन परख प्रोटोकॉल आसानी से विभिन्न खुराक या प्रोबायोटिक्स के प्रशासन के समय का परीक्षण करने के लिए संशोधित किया जा सकता है और भी अन्य जीवाणु उपभेदों या प्रजातियों के साथ इस्तेमाल किया जा सकता है.

<table border="0" cellpadding="0" cellspacing="0" width="1318">
	<colgroup>
		<col />
		<col />
		<col />
		<col span="2" />
	</colgroup>
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Minimum Essential Media (MEM)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">SH30244.01</td>
			<td style="width:377px;"> </td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Fetal Bovine Serum (FBS)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td>SH30084.03</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">T-75 Flask</td>
			<td style="width:155px;">Nunc</td>
			<td>156472</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">CCL-23 cells</td>
			<td style="width:155px;">ATCC</td>
			<td style="width:147px;">CCL-23</td>
			<td style="width:377px;"> </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Trypsin</td>
			<td>Life Technologies</td>
			<td>15090046</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:264px;">24-well cell culture plate</td>
			<td style="width:155px;">Nunc</td>
			<td style="width:147px;">142475</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Horse blood agar (HBA) plates</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">PP2001</td>
			<td>Sheep blood agar plates also acceptable</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Todd-Hewitt Broth</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">CM0189</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Yeast Extract</td>
			<td style="width:155px;">Beckton Dickinson</td>
			<td style="width:147px;">212750</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Digitonin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:147px;">D141-100MG</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Disposable cuvettes</td>
			<td style="width:155px;">Kartell</td>
			<td>1938</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Heparin</td>
			<td style="width:155px;">Pfizer</td>
			<td style="width:147px;">2112105</td>
			<td>comes in sterile ampules at 5,000IU/5mL </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">sterile spreader</td>
			<td style="width:155px;">Technoplas</td>
			<td style="width:147px;">S10805050</td>
			<td style="width:377px;">alternatively, a glass spreader can be dipped in 96% ethanol and flame sterilized before each use</td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">L6876</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mutanolysin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">M9901</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Proteinase K</td>
			<td>Qiagen</td>
			<td>19133</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">SDS 20% solution</td>
			<td>Ambion </td>
			<td style="width:147px;">AM9820</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">RNase A</td>
			<td>Qiagen</td>
			<td style="width:147px;">19101</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">QIAamp DNA mini-kit (250)</td>
			<td>Qiagen</td>
			<td style="width:147px;">51306</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA F primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence ACGCAATCTAGCAGATGAAGCA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA R primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence TCGTGCGTTTTAATTCCAGCT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA probe</td>
			<td>Eurogentec</td>
			<td style="width:147px;">Custom made</td>
			<td colspan="2">5&#39; -&#62; 3&#39; sequence Cy5-TGCCGAAAACGCTTGATACAGGGAG-BHQ3, alternative fluorophores can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Nuclease free water</td>
			<td>Ambion</td>
			<td style="width:147px;">AM9906</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Brilliant III Ultra Fast QPCR mastermix</td>
			<td>Agilent Technologies </td>
			<td style="width:147px;">600880</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Thermo-Fast 96 Detection plate </td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-1100</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Ultra clear qPCR cap strips</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-0866</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mx3005 QPCR System</td>
			<td style="width:155px;">Agilent Technologies </td>
			<td style="width:147px;">401449</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;"> </td>
			<td style="width:155px;"> </td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">* alternative sources are available for most/all products listed</td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

investigating the effects of probiotics on pneumococcal colonization using an in vitro adherence assay

Nasopharynx के उपकला अस्तर को स्ट्रैपटोकोकस निमोनिया (pneumococcus) के पालन उपनिवेशन में परिणाम कर सकते हैं और. इन विट्रो पालन assays सेल उपकला को pneumococci की कुर्की का अध्ययन करने के लिए इस्तेमाल किया जा सकता है इस तरह के निमोनिया और ओटिटिस मीडिया के रूप में न्यूमोकोकल संक्रमण के लिए एक शर्त माना जाता है monolayers और, इस तरह प्रोबायोटिक्स के उपयोग के रूप में संभावित उपायों की जांच के लिए न्यूमोकोकल बसाना को बाधित करने के लिए. यहाँ वर्णित प्रोटोकॉल (कभी कभी एचईपी-2 कोशिकाओं के रूप में) मानव उपकला कोशिका लाइन सीसीएल-23 के लिए pneumococci के पालन पर प्रोबायोटिक स्ट्रेप्टोकोकस salivarius के प्रभाव की जांच करने के लिए प्रयोग किया जाता है. परख तीन मुख्य चरण शामिल हैं: उपकला और बैक्टीरियल कोशिकाओं का 1) की तैयारी, सेल monolayers उपकला बैक्टीरिया के 2) इसके अलावा, और व्यवहार्य मायने रखता है (धारावाहिक कमजोर पड़ने और चढ़ाना) या मात्रात्मक वास्तविक समय पीसीआर (qPCR द्वारा पक्षपाती pneumococci 3) जांच ). इस टीईसीhnique अपेक्षाकृत सरल है और एक टिशू कल्चर सेटअप के अलावा अन्य विशेष उपकरण की आवश्यकता नहीं है. परख अन्य प्रोबायोटिक प्रजातियों और / या न्यूमोकोकल उपनिवेशवाद के संभावित inhibitors परीक्षण करने के लिए इस्तेमाल किया जा सकता है और आसानी से न्यूमोकोकल पालन और आक्रमण के बारे में अन्य वैज्ञानिक सवालों का पता करने के लिए संशोधित किया जा सकता है.

एक प्रतिनिधि प्रयोग से जो परिणाम pneumococci में (एस निमोनिया PMP843, एक बस्तियां 19F अलग) 1 घंटा एस के अलावा के बाद सीसीएल -23 कोशिकाओं को जोड़ा गया salivarius, और न्यूमोकोकल पालन व्यवहार्य गिनती और lytA qPCR दोनों के ?...

Watch this Scientific Journal Video about Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay at JoVE.com

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

इन विट्रो में पालन assays सेल monolayers उपकला के लिए और इस तरह के न्यूमोकोकल बसाना बाधा के लिए प्रोबायोटिक्स के उपयोग के रूप में संभावित उपायों की जांच के लिए स्ट्रैपटोकोकस निमोनिया की कुर्की का अध्ययन करने के लिए इस्तेमाल किया जा सकता है.

एक का प्रयोग न्यूमोकोकल औपनिवेशीकरण पर प्रोबायोटिक्स के प्रभाव की जांच<em&gt; इन विट्रो</em&gt; पालन परख

Adherence of Streptococcus pneumoniae (the pneumococcus) to the epithelial lining of the nasopharynx can result in colonization and is considered a ...

Research

JoVE Journal

Immunology and Infection

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

In vitro Biofilm Formation in an 8-well Chamber Slide

In vitro Biofilm Formation in an 8-well Chamber Slide

इन विट्रो biofilm गठन में एक चैंबर 8 अच्छी तरह से स्लाइड में

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. ...

A Microplate Assay to Assess Chemical Effects on RBL-2H3 Mast Cell Degranulation: Effects of Triclosan without Use of an Organic Solvent

एक कार्बनिक विलायक के इस्तेमाल के बिना Triclosan का प्रभाव: आरबीएल-2H3 मस्त सेल degranulation पर रासायनिक प्रभाव का आकलन करने के लिए एक microplate परख

Mast cells play important roles in allergic disease and immune defense against parasites. Once activated (e.g. by an allergen), they degranulate, a ...

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

इन विट्रो परख में एचआईवी विशिष्ट सीडी 4 टी सेल effector समारोह पर immunoregulatory रास्ते के प्रभाव का मूल्यांकन करने के लिए

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Bioluminescent बैक्टीरिया का उपयोग रीयल टाइम में एक तीव्र माउस निमोनिया मॉडल में न्यूमोकोकल विषैलापन कारकों के प्रभाव के बाद

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

के सम्पुटी सीरोवर्गनिर्धारण<em&gt; स्ट्रैपटोकोकस निमोनिया</em&gt; Quellung प्रतिक्रिया का उपयोग

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

के सम्पुटी सीरोवर्गनिर्धारण<em&gt; स्ट्रैपटोकोकस निमोनिया</em&gt; लेटेक्स समूहन द्वारा

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

Using the Overlay Assay to Qualitatively Measure Bacterial Production of and Sensitivity to Pneumococcal Bacteriocins

ओवरले परख का उपयोग गुणात्मक न्यूमोकोकल बैक्टीरियोसिन्स को बैक्टीरियल के उत्पादन और संवेदनशीलता उपाय

Streptococcus pneumoniae colonizes the highly diverse polymicrobial community of the nasopharynx where it must compete with resident organisms.  We have ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

एक<em&gt; इन विट्रो</em&gt; रक्त मस्तिष्क बाधा मुक़ाबला स्पेक्ट्रोस्कोपी का उपयोग कर के आदर्श: टी सेल endothelial सेल बातचीत पर ध्यान देने के

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Flow Cytometric Analysis of Particle-bound Bet v 1 Allergen in PM10

कण-बाउंड बेट वी PM10 में 1 allergen के प्रवाह cytometric विश्लेषण

Flow cytometry is a method widely used to quantify suspended solids such as cells or bacteria in a size range from 0.5 to several tens of micrometers in ...

Visualizing the Effects of Sputum on Biofilm Development Using a Chambered Coverglass Model

Biofilm विकास पर थूक के प्रभाव Visualizing एक संभाग coverglass मॉडल का उपयोग

Biofilms consist of groups of bacteria encased in a self-secreted matrix. They play an important role in industrial contamination as well as in the ...