Name: dissecting innate immune signaling in viral evasion of cytokine production
Uploaded: 2014-03-02T14:00:00
Description: Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

البرية من نوع (مافريكس + / +) وخروج المغلوب (مافريكس - / -) الفئران، وايلد من نوع (مافريكس + / +) وخروج المغلوب (مافريكس - / -) وMEFs المقدمة التفضل الدكتور تشي جيان تشن J. (جامعة تكساس جنوب غرب المركز الطبي) 13. ويستند هذا المنشور على العمل الممولة من المنح المقدمة من المعاهد الوطنية للصحة (R01 R01 CA134241 وDE021445) والجمعية الأميركية للسرطان (RSG-11-162-01-MPC).

تم تنفيذ جميع أعمال الحيوان تحت يتفق تماما مع التوصيات الواردة في دليل لرعاية واستخدام الحيوانات المختبرية من المعاهد الوطنية للصحة: ​​بيان الأخلاق. تمت الموافقة على البروتوكول من قبل اللجنة المؤسسية رعاية الحيوان واستخدام (IACUC) من جامعة جنوب كاليفورنيا. <...

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

التهرب المناعة الفيروسية هي واحدة من التفاعلات الأكثر ديناميكية ومثيرة تفاعل جريمة الفيروسية والدفاع المضيف 9. وتنظم المضيف المكونات المناعية الفطرية بحيث يتم نقل الإشارة بدأت تنتقل بفعالية وإخلاص. ترسيم وتنظيم التسلسل الهرمي يشير شلالات هو موضوع بارز الحصا?...

وقد أوجز الدراسات الحديثة على شلالات إشارات الشاملة في تصاعد المضيف الاستجابات المناعية الفطرية. المقيمين داخل مقصورات مميزة، والمستقبلات التعرف على الأنماط (خنازير) كشف أنماط الجزيئية المرتبطة الممرض (PAMPs) المنشأ متنوعة لتحريك المناعة الفطرية يشير 1. التي يسببها حمض الريتينويك الجين الأول (RIG-I) وسرطان الجلد التمايز مستضد 5 (MDA5) البروتينات هي أجهزة الاستشعار التي تعترف عصاري خلوي الأنواع RNA مع سمات هيكلية محددة 2. عند التنشيط، RIG-I يتفاعل مع مافريكس في المصب (المعروف أيضا باسم IPS-1، فيزا، وCARDIF) المحول الذي، بدوره، ينشط IKK (IKKαβγ) وكيناز المتعلقة IKK (TBK1 وIKKε، المعروف أيضا باسم IKKI ) مجمعات 3-6. تنشيط المناعة الفطرية تحركات الفوسفات المنظمين الرئيسيين في التعبير الجيني، بما في ذلك عوامل النسخ ومثبطات منها، وتمكين تفعيل الجينات المضادة للفيروسات النسخي المضيف (على سبيل المثال IL6، TNF &amp; #945؛، CCL5، وIFNβ). هذه الشلالات يشير تشكل الاستجابات الفطرية المتأصلة قوية المناعي أن إقامة دولة المضادة للميكروبات لتقييد انتشار مسببات المرض خلال المراحل المبكرة من العدوى. ويرتبط ارتباطا وثيقا الفئران γHV68 أنكجنيك KSHV الإنسان وEBV. وهكذا، والعدوى من الفئران γHV68 نموذجا حيوان صغير الانقياد لدراسة استجابة المضيف المناعية لعدوى فيروس قوباء جاما في الجسم الحي 7. باستخدام γHV68، كشفت مختبرنا استراتيجية معقدة حيث يخطف γHV68 استضافة إشارات المناعية الفطرية لتمكين عدوى فيروسية. من جهة، γHV68 ينشط مسارا مافريكس-IKKβ لتعزيز تفعيل النسخي الفيروسية عن طريق توجيه تنشيط IKKβ لالفوسفات transactivator النسخ المتماثل (RTA)، والنسخ مفتاح عامل فيروسي للγHV68 تكرار 8. من ناحية أخرى، فإن الفسفرة IKKβ بوساطة يعبي RELA لتدهور والمدىinates تفعيل NFΚB 9. على هذا النحو، والعدوى γHV68 يتجنب إنتاج السيتوكينات المضادة للفيروسات بشكل فعال. ومن المثير للاهتمام، والفحص باستخدام مكتبة تعبير عن γHV68 حددت هيئة الطرق والمواصلات باعتبارها يغاز E3 للحث على تدهور العالقات وإلغاء تفعيل NFΚB 10. هذه النتائج تكشف عن استراتيجية التهرب المناعي معقدة حيث يتم تسخيرها المنبع الأحداث يشير المناعي عن طريق γHV68 لينفي في نهاية المطاف إنتاج السيتوكينات المضادة للفيروسات. نحن هنا وصف بروتوكول لقياس إنتاج السيتوكينات المضادة للفيروسات في الفئران المصابة مع γHV68 سواء في الجسم الحي وخارج فيف س. في البروتوكول ومواصلة استكشاف &quot;المعاد&quot; التعبير عن مكونات المناعة الفطرية في الخلايا الليفية الجنينية خروج المغلوب من قبل تنبيغ lentiviral، والذي يبرز وظيفة المناعة الفطرية جزيئات محددة في تنظيم إنتاج السيتوكينات المضادة للفيروسات. هذا البروتوكول يمكن تكييفها بسهولة إلى فيرو أخرىسيس ومسارات الإشارات.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

ردا على عدوى فيروسية، يتم تنشيط الاستجابة المناعية الفطرية المضيفة ليصل تنظيم التعبير الجيني وإنتاج السيتوكينات المضادة للفيروسات. على العكس، تطورت الفيروسات استراتيجيات معقدة للتهرب واستغلال المضيف يشير المناعي من أجل البقاء والانتشار. التهرب المناعة الفيروسية، تستتبع دفاع المضيف والتهرب الفيروسية، ويوفر واحدة من أروع واجهات وديناميكية لتبين التفاعل المضيفة للفيروسات. هذه الدراسات تقدم فهمنا في تنظيم المناعة الفطرية ويمهد طريقنا لتطوير علاجات مضادة للفيروسات الرواية. الفئران γHV68 هو الممرض الطبيعية من القوارض الفئران. الإصابة γHV68 الفئران تقدم نموذجا حيوان صغير الانقياد لدراسة الاستجابة المضادة للفيروسات لKSHV الإنسان وEBV منها اضطراب في الجسم الحي التفاعلات الفيروسات المضيف ليست قابلة للتطبيق. نحن هنا وصف بروتوكول لتحديد إنتاج السيتوكينات المضادة للفيروسات. هذا البروتوكول يمكن تكييفها لفير أخرىويستخدم مسارات الإشارات. مؤخرا، اكتشفنا أن يخطف γHV68 مافريكس وIKKβ، الفطرية مكونات إشارات المناعية الرئيسية المصب من عصاري خلوي RIG-I وMDA5، لإلغاء تفعيل NFΚB وإنتاج السيتوكينات المضادة للفيروسات. على وجه التحديد، والعدوى γHV68 ينشط IKKβ وأن تنشيط IKKβ phosphorylates RELA لتسريع تدهور العالقات. على هذا النحو، γ HV68 uncouples بكفاءة تفعيل NFΚB من المنبع لها IKKβ تفعيلها، يلغي المضادة للفيروسات التعبير خلوى الجينات. يلقي ضوءا هذه الدراسة استراتيجية معقدة حيث يتم اعتراضها تفعيل المناعة الفطرية المنبع من قبل الممرض الفيروسية لإلغاء تفعيل النسخي المصب الفوري والتهرب من إنتاج السيتوكينات المضادة للفيروسات.

وتظهر ثلاث شخصيات ممثلة هنا، بما في ذلك الإنتاج خلوى في الرئة من مافريكس γHV68 المصابة + / + ودالاس / - الماوس، إفراز السيتوكينات والتعبير الجيني مستوى مافريكس γHV68 المصابة + / + ومافريكس - / - MEFs، و مستويات خلوى مرنا من مافري?...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

وصفنا بروتوكول لقياس إنتاج السيتوكينات المضادة للفيروسات في الفئران المصابة مع هربس النموذج، الفئران غاما هربس 68 (γ HV68) التي هي ذات الصلة ارتباطا وثيقا المرتبطة ساركوما هربس الإنسان كابوزي (KSHV) وفيروس ابشتاين بار (EBV). استخدام سلالات الفئران المعدلة وراثيا والخلايا الليفية الماوس الجنينية (MEFs)، قمنا بتقييم إنتاج السيتوكينات المضادة للفيروسات سواء في الجسم الحي وخارج الحي. &quot;اعادة تشكيل&quot; التعبير عن مكونات المناعة الفطرية في الخلايا الليفية الجنينية خروج المغلوب من قبل تنبيغ lentiviral، ونحن كذلك تحديد جزيئات محددة المناعة الفطرية وتشريح الأحداث الإشارات الرئيسية التي تنظم بشكل مختلف في إنتاج السيتوكينات المضادة للفيروسات.

تشريح الفطري اشارة المناعة في التهرب الفيروسية من الإنتاج خلوى

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Research

JoVE Journal

Immunology and Infection

Production and Titering of Recombinant Adeno-associated Viral Vectors

إنتاج وناقلات Titering الغدة المؤتلف المرتبطة الفيروسية

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

الكمي للاستجابة انفجر الجهاز التنفسي باعتبارها مؤشر الفطري المناعي الصحة في الزرد

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

باستخدام الحمض النووي الريبي التدخل للتحقيق في الاستجابة المناعية الفطرية في الفأر الضامة

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

التصوير غير الغازية من الاستجابة المناعية الفطرية في نموذج الزرد يرقات<em&gt; العقدية iniae</em&gt; العدوى

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

تحريض الأم المناعي التنشيط في الفئران في مرحلة منتصف الحمل مع الفيروسية تقليد بولي (I: C)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

تشريح مجمعات البروتين متعدد الإشارات بالتكامل Bimolecular انجذاب تطهير (بيكاب)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

تحليل خلية واحدة من إيمونوفينوتيبي وإنتاج سيتوكين في الدم كله الطرفية عبر الخلوي الشامل

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

نموذج الماوس لتقييم الفطرية الاستجابة المناعية للعدوى المكوّرات العنقودية الذهبية

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

نموذج الإدارة عن طريق الفم Galleria mellonella للاستجابات المناعية الفطرية Study Commensal-Induced

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

عزل الخلايا أحادية النوى اللوزتين لدراسة استجابات المناعة الفطرية Ex Vivo في الأنسجة اللمفاوية المخاطية البشرية

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...