Name: dissecting innate immune signaling in viral evasion of cytokine production
Uploaded: 2014-03-02T14:00:00
Description: Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Wild-type (Mavs + / +) og knockout (Mavs - / -)-mus, Wild-type (Mavs + / +) og knockout (Mavs - / -), blev MEF&#39;er venligst leveret af Dr. Zhijian J. Chen (University of Texas Southwestern Medical Center) 13.. Denne publikation er baseret på arbejde finansieret af tilskud fra NIH (R01 CA134241 og R01 DE021445) og American Cancer Society (RSG-11-162-01-MPC).

Etik Statement: Alle dyr blev udført under nøje overensstemmelse med anbefalingerne i vejledning til pleje og anvendelse af forsøgsdyr af National Institutes of Health. Protokollen blev godkendt af Institutional Animal Care og brug Udvalg (IACUC) fra University of Southern California. 1.. Cytokine Gene Expression af kvantitativ real-time PCR og sekretion ved hjælp af ELISA i γHV68-inficerede mus <ol><li> Bedøver kønsmatchede, 6-8 uger gamle C57BL / 6 (B6) søskende ...

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

Viral immun unddragelse er en af de mest dynamiske og fascinerende samspil interface viral lovovertrædelse og vært forsvar 9. Værten medfødte immunforsvar komponenter er struktureret sådan, at signaltransduktion effektivt initieres og trofast videregivet. Afgrænse hierarkiet og regulering af signalering kaskader er en fremtrædende emne for medfødte immunitet. Her introducerer vi en protokol til at identificere de regulatoriske roller en medfødt immun komponent, Mavs, i viral unddragelse af cytokin pr...

Nylige undersøgelser har skitseret de overordnede signalleringskaskader i montering vært medfødte immunrespons. Bosat i særskilte rum, mønstergenkendelse receptorer (PRRS) opdage patogen-associerede molekylære mønstre (PAMPs) af forskellig oprindelse til at udløse medfødte immunforsvar signalering 1. Den retinsyre-induceret gen I (RIG-I) og modermærkekræft differentiering antigen 5 (MDA5) proteiner er cytosoliske sensorer, der genkender RNA arter med særlige strukturelle træk 2. Ved aktivering RIG-I interagerer med sine downstream Mavs (også kendt som IPS-1, VISA, og Cardif) adapter, der til gengæld aktiverer IKK (IKKαβγ) og IKK-relateret kinase (TBK1 og IKKε, også kendt som IKKI )-komplekser 3-6. Aktiveret medfødte immunforsvar kinaser phosphorylerer vigtige regulatorer af genekspression, herunder transkriptionsfaktorer og inhibitorer deraf og muliggøre transkriptionsaktivering vært antivirale gener (f.eks IL6, TNF &amp; #945,, CCL5 og IFNp). Disse signaleringskaskader udgør potente iboende medfødte immunrespons, der etablerer en anti-mikrobiel tilstand for at begrænse patogen udbredelse i de tidlige stadier af infektionen. Murine γHV68 er nært beslægtet med den menneskelige onkogene KSHV og EBV. Således γHV68 infektion af mus giver en medgørlige lille dyremodel til at undersøge værtens immunrespons gamma herpes virus infektion in vivo 7. Brug γHV68 har vores laboratorium afsløret en indviklet strategi, hvorved γHV68 kaprer vært medfødte immunforsvar signalering at aktivere virusinfektion. På den ene side γHV68 aktiverer Mavs-IKKβ vej til fremme viral transkriptionel aktivering via dirigere aktiveret IKKβ phosphorylere replikation transaktivator (RTA), den virale transkriptionsfaktor nøgle til γHV68 replikation 8. På den anden side IKKβ-medieret phosphorylering primer RelA for nedbrydning og sigtinates NFkB aktivering 9. Som sådan γHV68 infektion effektivt undgår antiviral cytokinproduktion. Interessant, en screening udnytte et udtryk bibliotek af γHV68 identificerede RTA som en E3 ligase at fremkalde RelA nedbrydning og ophæver NFkB aktivering 10. Disse resultater afdække en indviklet immun unddragelse strategi, hvor upstream immun signalering begivenheder er udnyttet af γHV68 at negere den ultimative antivirale cytokin produktion. Her beskriver vi en protokol til at måle det antivirale cytokin produktion i mus inficeret med γHV68 både in vivo og ex viv o. I protokollen vi yderligere at udforske &quot;rekonstitueret&quot; ekspression af medfødte immun komponenter knockout embryofibroblaster af lentiviral transduktion, som belyser funktionen af ​​de specifikke medfødte immunmolekyler regulere antivirale cytokinproduktion. Denne protokol kan let tilpasses til andre ViruSES og signalveje.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

Som svar på en viral infektion, er svartiden værten medfødte immunsystem aktiveres til at opregulere genekspression og produktion af antivirale cytokiner. Omvendt har vira udviklet indviklede strategier til at unddrage sig og udnytte vært immun signalering for overlevelse og formering. Viral immun unddragelse, medfører vært forsvar og viral svig, giver en af ​​de mest fascinerende og dynamiske grænseflader at skelne samspillet host-virus. Disse undersøgelser fremme vores forståelse medfødte immunsystem regulering og bane vores måde at udvikle nye antivirale behandlinger. Murine γHV68 er en naturlig patogen af ​​murine gnavere. γHV68 infektion af mus giver en medgørlig lille dyremodel til at undersøge det antivirale respons på menneskelig KSHV og EBV som forstyrrelse af in vivo virus-værts interaktioner er ikke relevant. Her beskriver vi en protokol til at bestemme det antivirale cytokin produktion. Denne protokol kan tilpasses til andre virbruger og signalveje. For nylig har vi opdaget, at γHV68 kaprer Mavs og IKKβ, centrale medfødte immun signalering komponenter nedstrøms for den cytosoliske RIG-I og MDA5 at ophæve NFkB aktivering og antivirale cytokin produktion. Specifikt γHV68 infektion aktiverer IKKβ og aktiveret IKKβ phosphorylerer RelA at fremskynde RelA nedbrydning. Som sådan γ HV68 effektivt afkobler NFkB aktivering fra sin upstream aktiveret IKKβ, at bevirke antivirale cytokin genekspression. Denne undersøgelse belyser en indviklet strategi, hvorved det opstrøms medfødte immun aktivering opfanges af en viral patogen at ophæve den umiddelbare downstream transkriptionsaktivering og unddrage antiviral cytokinproduktion.

Tre repræsentative tal er vist her, herunder cytokinproduktion i lungen af γHV68-inficerede Mavs + / + og Mavs-/ - mus, cytokinsekretion og genekspression niveau γHV68-inficerede Mavs + / + og Mavs - / - MEF&#39;er, og cytokin mRNA niveauer af γHV68-inficerede Mavs - / - MEF&#39;er &quot;rekonstitueret&quot; med Mavs. Disse repræsentative eksperimenter udnytter gen knockout-mus til at undersøge antivirale cytokin pr...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Vi beskriver en protokol til måling af den antivirale cytokinproduktion i mus inficeret med en model herpesvirus murin gamma herpesvirus 68 (γ HV68), som er nært beslægtet med human Kaposis sarkom-associeret herpesvirus (KSHV) og Epstein-Barr virus (EBV). Ved hjælp af genetisk modificerede mus stammer og muse embryonale fibroblaster (MEF), vurderede vi det antivirale cytokinproduktion både in vivo og ex vivo. &quot;Tilberedning&quot; udtryk for medfødte immunforsvar komponenter i knockout embryofibroblaster ved lentiviral transduktion, vi yderligere lokalisere specifikke medfødte immunforsvar molekyler og dissekere de centrale signalsystemer begivenheder, der differentielt regulerer det antivirale cytokin produktion.

Dissekere medfødte immunforsvar signalering i Viral Evasion af cytokinproduktion

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Research

JoVE Journal

Immunology and Infection

Production and Titering of Recombinant Adeno-associated Viral Vectors

Produktion og Titering af rekombinant adeno-associeret virale vektorer

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

Kvantificering af den Respiratory burstrespons som en indikator for medfødte immunforsvar Sundhed i zebrafisk

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Brug af RNA-interferens Undersøge Innate immunresponset i musemakrofager

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Ikke-invasiv billeddannelse af Innate immunrespons i en zebrafisk Larve Model af<em&gt; Streptococcus iniae</em&gt; Infektion

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Induktion af Maternal immun aktivering i mus ved Mid-drægtighed Stage med Viral Mimic Poly (I: C)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

Dissekere multi protein Signaling komplekser af Bimolecular komplementering affinitet rensning (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Enkelt-celle analyse af Immunophenotype og cytokin produktion i perifere blod via masse flowcytometri

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

En musemodel at vurdere medfødte immunrespons for Staphylococcus aureus infektioner

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

En barciak Oral Administration Model til Study Commensal-Induced medfødte immunrespons

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Isolering af tonsillar mononukleare celler til at studere Ex Vivo medfødte immunrespons i en human slimhinde lymfoide væv

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...