Name: dissecting innate immune signaling in viral evasion of cytokine production
Uploaded: 2014-03-02T14:00:00
Description: Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Wild-type (Mavs + / +) en knockout (Mavs - / -) muizen, Wildtype (Mavs + / +) en knockout (Mavs - / -) werden MEF vriendelijk verschaft door Dr Zhijian J. Chen (Universiteit van Texas Southwestern Medical Center) 13. Deze publicatie is gebaseerd op het werk gefinancierd door subsidies van de NIH (R01 CA134241 en R01 DE021445) en American Cancer Society (RSG-11-162-01-MPC).

Ethiek Verklaring: Al het dierlijke werk werd uitgevoerd onder strikte overeenstemming met de aanbevelingen in de gids voor de zorg en het gebruik van proefdieren van de National Institutes of Health. Het protocol werd goedgekeurd door de Institutional Animal Care en gebruik Comite (IACUC) van de University of Southern California. 1. Cytokine genexpressie door kwantitatieve real-time PCR en secretie door ELISA in γHV68-geïnfecteerde muizen <ol><li> Verdoven geslacht gema...

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

Virale immuun ontduiking is een van de meest dynamische en boeiende interacties interfacing virale aanval en afweer 9. De gastheer aangeboren immuunsysteem componenten zijn zodanig dat signaaltransductie effectief wordt geïnitieerd en getrouw doorgegeven gestructureerd. Afbakening van de hiërarchie en de regulering van signaleringscascades is een vooraanstaande onderwerp van aangeboren immuniteit. Hier introduceren we een protocol bij de regulerende rol van een aangeboren immuun component, MAVS, in virale o...

Recente studies hebben de algemene signalisatie cascades die in de montage gastheer aangeboren immuunrespons. Wonende in verschillende compartimenten, receptoren patroonherkenning (PRRS) detecteren pathogeen-geassocieerde moleculaire patronen (PAMPs) van diverse oorsprong aangeboren immuunsysteem signalering activeren 1. De retinoic zuur-geïnduceerde gen I (RIG-I) en melanoom differentiatie antigeen 5 (MDA5) eiwitten zijn cytosole sensoren die RNA soorten herkennen met specifieke structurele kenmerken 2. Na activatie RIG-I reageert met de stroomafwaartse MAVS (ook bekend als IPS-1, VISA en CARDIF) adapter die op zijn beurt activeert het IKK (IKKαβγ) en IKK-gerelateerde kinase (TBK1 en IKKε, ook bekend als IKKI ) complexen 3-6. Geactiveerde aangeboren immuunsysteem kinases fosforileren belangrijke regulatoren van genexpressie, waaronder transcriptiefactoren en remmers daarvan, en maken transcriptionele activering van gastheer antivirale genen (bijv. IL6, TNF &amp; #945;, CCL5 en IFNβ). Deze signaleringscascades vormen krachtige intrinsieke aangeboren immuunrespons dat een anti-microbiële staat te vestigen om pathogeen propagatie tijdens de vroege stadia van de infectie te beperken. Muizen γHV68 is nauw verwant aan de menselijke oncogene KSHV en EBV. Aldus γHV68 infectie van muizen verschaft een handelbaar klein diermodel om de gastheer immuunrespons op gamma herpes virusinfectie in vivo onderzoeken 7. Met behulp γHV68, heeft ons lab een ingewikkelde strategie blootgelegd waarbij γHV68 kaapt hosten aangeboren immuunsysteem signalering naar virale infectie mogelijk te maken. Enerzijds γHV68 activeert de MAVS-IKKβ weg van virale transcriptionele activatie promoten via leiding geactiveerd IKKβ replicatie transactivator (RTA), het virale transcriptiefactor pijl op γHV68 replicatie 8 fosforyleren. Aan de andere kant, de IKKβ-gemedieerde fosforylering priemgetallen RelA voor degradatie en termijninates NFKB activering 9. Als zodanig γHV68 infectie vermijdt effectief antiviraal cytokine productie. Interessant is dat een screening met behulp van een expressie bibliotheek van γHV68 geïdentificeerd RTA als een E3 ligase aan RelA afbraak veroorzaken en trekt NFKB activering 10. Deze bevindingen ontrafel een ingewikkelde immuun ontduiking strategie waarbij de upstream immuun signalering evenementen worden benut door γHV68 om de ultieme antivirale cytokine productie ontkrachten. Hier beschrijven we een protocol bij de antivirale cytokines in muizen geïnfecteerd met γHV68 zowel in vivo als ex viv o meten. In het protocol verder we de &quot;gereconstitueerde&quot; expressie van aangeboren immuunrespons componenten staand in de knockout embryonale fibroblasten door lentivirale transductie, die de functie van de specifieke aangeboren immuunrespons moleculen reguleren van de antivirale cytokine productie lokaliseert. Dit protocol kan gemakkelijk worden aangepast aan andere viruses en signaalwegen.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

In antwoord op een virale infectie, is de gastheer immuunreactie geactiveerd up-reguleren genexpressie en productie van antivirale cytokines. Omgekeerd hebben virussen ingewikkelde strategieën te ontwijken en te exploiteren gastheerimmuunsysteem signalering voor overleving en voortplanting geëvolueerd. Virale immuun ontduiking keuring, waarbij de afweer en virale fraude, biedt een van de meest fascinerende en dynamische interfaces naar de host-virus interactie onderscheiden. Deze studies ons begrip in aangeboren immuniteit en effenen de weg naar nieuwe antivirale therapieën te ontwikkelen. Muizen γHV68 is een natuurlijke ziekteverwekker van muizen knaagdieren. γHV68 infectie van muizen geeft een handelbaar klein diermodel om de antivirale respons op menselijke KSHV en EBV waarvan verstoring van in vivo virus-gastheer interacties is niet van toepassing te onderzoeken. Hier beschrijven we een protocol bij de antivirale cytokine productie te bepalen. Dit protocol kan worden aangepast aan andere virgebruikt en signaalwegen. Onlangs hebben we ontdekt dat γHV68 kaapt MAVS en IKKβ, belangrijke aangeboren immuunsysteem signaleringscomponenten stroomafwaarts van de cytosolische RIG-I en MDA5 te NFKB activering en antivirale cytokine productie teniet. Concreet γHV68 infectie activeert IKKβ en dat geactiveerd IKKβ phosphorylates RelA om RelA afbraak versnellen. Als zodanig, γ HV68 ontkoppelt efficiënt NFKP activering van zijn upstream geactiveerd IKKβ, ontkennen antivirale cytokine genexpressie. Deze studie belicht een ingewikkelde strategie waarbij de upstream aangeboren immuunsysteem activering wordt onderschept door een virale ziekteverwekker aan de onmiddellijke downstream transcriptieactiveringsdomein teniet te doen en ontwijk antivirale cytokine productie.

Drie representatieve cijfers worden hier getoond, met inbegrip van cytokines in de long van γHV68-geïnfecteerde Mavs + / + en Mavs-/ - muis, cytokine secretie en genexpressie niveau van γHV68-geïnfecteerde Mavs + / + en Mavs - / - MEF, en cytokine mRNA niveaus van γHV68 geïnfecteerde Mavs - / - MEF &quot;opgelost&quot; met MAVS. Deze representatieve experimenten benutten knockout muizen antivirale cytokine productie...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

We beschrijven een protocol bij de antivirale cytokine productie in muizen geïnfecteerd met een model herpesvirus, muizen gamma herpesvirus 68 (γ HV68) die nauw verwant aan humane Kaposi-sarcoom geassocieerde herpesvirus (KSHV) en Epstein-Barr virus (EBV) te meten. Gebruik makend van genetisch gemodificeerde muizen en muis embryonale fibroblasten (MEF) hebben we de antivirale cytokine productie zowel in vivo als ex vivo. &quot;Bereiding&quot; de uitdrukking van aangeboren immuunsysteem componenten in knockout embryonale fibroblasten door lentivirale transductie, we verder lokaliseren specifieke aangeboren immuunsysteem moleculen en ontleden de belangrijkste signalering gebeurtenissen die differentieel reguleren van de antivirale cytokine productie.

Ontleden Innate Immune Signalering in Viral Evasion van cytokine productie

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Research

JoVE Journal

Immunology and Infection

Production and Titering of Recombinant Adeno-associated Viral Vectors

Productie en Titering van recombinant adeno-geassocieerde virale vectoren

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

Kwantificering van de Respiratory Burst Response als een indicator van het aangeboren immuunsysteem Gezondheid in zebravis

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Met behulp van RNA-interferentie te onderzoeken de aangeboren immuunrespons in muizenmacrofagen

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Niet-invasieve beeldvorming van de aangeboren immuunrespons in een zebravis larven Model van<em&gt; Streptococcus iniae</em&gt; Infectie

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Inductie van Maternal Immune Activering in Muizen bij Mid-dracht Podium met Viral Mimic Poly (I: C)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

Ontleden multi signalering eiwitcomplexen door Bimolecular complementatie affiniteit zuivering (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Eencellige analyse van Immunophenotype en Cytokine productie in perifere bloed via massale Cytometry

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Een muismodel te beoordelen ingeboren immuunreactie op Staphylococcus aureus -infectie

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Een mondelinge beheermodel voor wasmot te Study Commensal-Induced aangeboren immuunresponsen

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Isolatie van tonsillaire mononucleaire cellen om ex vivo ingeboren immuunreacties te bestuderen in een menselijk mucosale lymfoïde weefsel

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...