Name: dissecting innate immune signaling in viral evasion of cytokine production
Uploaded: 2014-03-02T14:00:00
Description: Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Wildtyp (Mavs + / +) und Knockout (Mavs - / -)-Mäusen, Wildtyp (Mavs + / +) und Knockout (Mavs - / -) MEFs wurden freundlicherweise von Dr. J. Chen Zhijian (Universität bereitgestellt Texas Southwestern Medical Center) 13. Diese Veröffentlichung basiert auf der Arbeit durch Zuschüsse aus NIH (R01 und R01 CA134241 DE021445) und American Cancer Society (RSG-11-162-01-MPC) finanziert basiert.

Ethikerklärung: Alle Tier Arbeit wurde unter strikter Übereinstimmung mit den Empfehlungen in der Bedienungsanleitung für die Pflege und Verwendung von Labortieren der National Institutes of Health durchgeführt. Das Protokoll wurde von der Institutional Animal Care und Verwenden Committee (IACUC) der Universität von Süd-Kalifornien genehmigt. 1. Zytokin-Genexpression durch quantitative Echtzeit-PCR und Sekretion mittels ELISA in γHV68-infizierte Mäuse <ol><li> Anes...

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

Viral Immunevasion ist einer der dynamischsten und faszinierende Wechselwirkungen Anbindung viralen Angriff und Abwehr 9. Die Wirts angeborenen Immunkomponenten werden so strukturiert, dass die Signaltransduktion wirksam initiiert und originalgetreu übertragen. Absteckung der Hierarchie und Regulierung von Signalkaskaden ist eine herausragende Thema der angeborenen Immunität. Hier stellen wir ein Protokoll, um die regulatorischen Rolle der angeborenen Immunkomponente, MAVS, der Virushinterziehung von Zytoki...

Jüngste Studien haben die gesamten Signalkaskaden bei der Montage Host angeborenen Immunantwort beschrieben. Wohnen in unterschiedlichen Fächern, pattern recognition receptors (PRR) erkennen pathogen-associated molecular patterns (PAMPs) unterschiedlicher Herkunft zu angeborenen Immunsignal 1 auslösen. Die Retinsäure-induzierte Gen I (RIG-I) und Melanom-Differenzierungsantigen 5 (MDA5) cytosolische Proteine ​​sind Sensoren, die RNA-Spezies mit spezifischen Strukturmerkmale 2 zu erkennen. Nach der Aktivierung, RIG-I interagiert mit seinem stromabwärts gelegenen MAVS Adapter, der wiederum aktiviert die IKK (IKKαβγ) und IKK-verwandten Kinase (TBK1 und IKKε, auch IKKi bekannt (auch als IPS-1, VISA, und CARDIF bekannt) )-Komplexe 3-6. Aktiviert angeborenen Immun Kinasen phosphoryliert Schlüsselregulatoren der Genexpression, darunter Transkriptionsfaktoren und deren Inhibitoren und aktivieren Transkriptionsaktivierung von Host-antivirale Gene (z. B. IL-6, TNF &amp; #945;, CCL5 und IFN &amp;bgr;). Diese Signalkaskaden bilden starke intrinsische angeborenen Immunantwort, die eine anti-mikrobielle Staat zu errichten, um Krankheitserreger Ausbreitung während der frühen Stadien der Infektion zu beschränken. Murine γHV68 ist eng mit der menschlichen onkogenen KSHV und EBV zusammen. Somit γHV68 Infektion von Mäusen eine lenkbar Kleintiermodell, um die Immunantwort des Wirts gegenüber Gammaherpesvirus-Infektion in vivo 7 zu prüfen. Mit γHV68 hat unser Labor eine komplizierte Strategie aufgedeckt, wobei γHV68 entführt Gastgeber angeborenen Immun Signalisierung an Virusinfektion zu ermöglichen. Auf der einen Seite aktiviert γHV68 die Mavs-IKK Weg zum viralen Transkriptionsaktivierung über die Leitung aktiviert IKK Replikation Transaktivator (RTA), die virale Transkriptionsfaktor Schlüssel für γHV68 Replikation 8 phosphorylieren fördern. Auf der anderen Seite, Primzahlen die IKK-vermittelte Phosphorylierung RelA für Abbau-und Zeitinates NFkB-Aktivierung 9. Als solche γHV68 Infektion vermeidet effektiv antivirale Zytokin-Produktion. Interessant ist, dass ein Screening unter Verwendung einer Expressionsbibliothek von γHV68 identifiziert RTA als E3-Ligase RelA Abbau zu induzieren, und hebt NFkB-Aktivierung 10. Diese Ergebnisse enthüllen ein kompliziertes Immunevasion Strategie, bei der die vor-Immunsignalereignisse werden durch γHV68 genutzt, um den ultimativen antivirale Zytokin-Produktion zu negieren. Hier beschreiben wir ein Protokoll, um die antivirale Zytokin-Produktion in Mäusen mit γHV68 sowohl in vivo und ex viv o infiziert zu messen. In dem Protokoll weiter wir die &quot;wiederhergestellten&quot; Ausdruck der angeborenen Immunkomponenten in der Ko-embryonale Fibroblasten erkunden lentiviralen Transduktion, die die Funktion der spezifischen angeborenen Immunmoleküle in der Regulation des antivirale Zytokin-Produktion lokalisiert. Dieses Protokoll kann leicht auf andere Viru angepasst werdenses und Signalwege.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

In Reaktion auf eine virale Infektion ist der Host angeborenen Immunantwort zu hoch zu regulieren die Genexpression und die Produktion antiviraler Cytokine aktiviert. Umgekehrt haben Viren komplizierte Strategien, um für das Überleben und die Fortpflanzung zu entziehen und zu nutzen Immun Signalisierung entwickelt. Viral Immunevasion und beinhaltet Abwehr und virale Steuerhinterziehung, bietet eine der faszinierendsten und dynamischen Schnittstellen, um die Wirt-Virus-Interaktion zu erkennen. Diese Studien unser Verständnis der angeborenen Immunregulation und ebnen den Weg zu neuen antiviralen Therapien zu entwickeln. Murine γHV68 ist eine natürliche Erreger der murinen Nagetiere. γHV68 Infektion von Mäusen eine gefügig Kleintiermodell, um die antivirale Antwort auf menschliche KSHV und EBV, von denen Störung der in-vivo-Virus-Wirt-Wechselwirkungen ist nicht anwendbar zu untersuchen. Hier beschreiben wir ein Protokoll, um die antivirale Zytokin-Produktion zu bestimmen. Dieses Protokoll kann auch auf andere vir angepasst werdenverwendet und Signalwege. Vor kurzem haben wir entdeckt, dass γHV68 entführt MAVS und IKK, Schlüssel angeborenen Immunsignalkomponenten hinter der cytosolischen RIG-I und MDA5, um NFkB-Aktivierung und antivirale Zytokin-Produktion aufzuheben. Insbesondere γHV68 Infektion aktiviert IKK und die IKK phosphoryliert aktiviert RelA zu RelA Abbau beschleunigen. Als solche γ HV68 effizient entkoppelt NFkB-Aktivierung bei den vorgelagerten aktiviert IKK, negiert antivirale Zytokin-Genexpression. Diese Studie verdeutlicht eine komplizierte Strategie, bei der die vorgeschaltete angeborenen Immunaktivierung wird durch eine virale Erreger abgefangen, die unmittelbar nachgeschalteten Transkriptionsaktivierung zunichte machen und entziehen antivirale Zytokin-Produktion.

Drei repräsentative Zahlen werden hier gezeigt, darunter Zytokin-Produktion in der Lunge von γHV68-infizierten Mavs + / + und Mavs-/ - Maus, Zytokinsekretion und Gen-Expression von γHV68-infizierten Mavs + / + und Mavs - / - MEFs und Zytokin-mRNA-Spiegel von γHV68-infizierten Mavs - / - MEFs &quot;wiederhergestellt&quot; mit MAVS. Diese repräsentativen Experimenten nutzen Gen-Knockout-Mäusen, die antivirale Zytokin-...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Wir beschreiben ein Protokoll, um die antivirale Zytokin-Produktion in Mäusen mit einem Modell-Herpesvirus, murinen Gammaherpesvirus-68 (γ HV68) infiziert, die für die menschliche Kaposi-Sarkom-assoziierten Herpesvirus (KSHV) und Epstein-Barr-Virus (EBV) eng verwandt ist, zu messen. Mit Hilfe genetisch veränderter Mausstämme und embryonalen Maus-Fibroblasten (MEF), untersuchten wir die antivirale Zytokin-Produktion in vivo und ex vivo. &quot;Reconstituting&quot; den Ausdruck der angeborenen Immunkomponenten in Knockout embryonale Fibroblasten von lentiviralen Transduktion, weiter wir spezifische angeborene Immunmoleküle erkennen und sezieren die wichtigsten Signalwege, die unterschiedlich regeln die antivirale Zytokin-Produktion.

Zergliedern Angeborene Immunsystem Signaling in Viral Evasion von Zytokin-Produktion

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Research

JoVE Journal

Immunology and Infection

Production and Titering of Recombinant Adeno-associated Viral Vectors

Produktion und Titrierung von rekombinanten Adeno-assoziierte virale Vektoren

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Forschung

Immunologie und Infektion

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

Die Quantifizierung der Atem Burst Antwort als Indikator für Angeborene Immunsystem Gesundheit in Zebrafisch

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Mit RNA-Interferenz, um die angeborene Immunantwort in Makrophagen der Maus Untersuchen

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Nicht-invasive Bildgebung von der angeborenen Immunantwort in einem Zebrafisch-Larven Modell<em&gt; Streptococcus iniae</em&gt; Infektions

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Die Induktion der mütterliche Immunaktivierung bei Mäusen in der Mitte der Schwangerschaft Bühne mit Viral Mimic Poly (I: C)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

Sezieren Signalisierung Multi-Protein-komplexe durch eine Bimolekulare Ergänzung Affinitätsreinigung (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Einzellige Analyse der Immunophenotype und Produktion von Zytokinen im peripheren Blut über Masse Zytometrie

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Ein Mausmodell zu beurteilen, angeborene Immunantwort auf Staphylococcus Aureus -Infektion

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Ein Galleria Mellonella mündliche Administrationsmodell zu Study Commensal-Induced angeborene Immunantwort

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Isolierung von Tonsillar Mononukleären Zellen zur Untersuchung von Ex-Vivo-angeborenen Immunantworten in einem menschlichen Mukosal-Lymphgewebe

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...