Name: dissecting innate immune signaling in viral evasion of cytokine production
Uploaded: 2014-03-02T14:00:00
Description: Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

עכברים, wild-type (Mavs + / +) ונוקאאוט (Mavs - / -) wild-type (Mavs + / +) ונוקאאוט (Mavs - - /) MEFs סופקו באדיבות על ידי ד&quot;ר ג &#39;יי Zhijian חן (אוניברסיטת מרכז טקסס Southwestern Medical) 13. פרסום זה מבוסס על מומנה על ידי מענקים מ-NIH (R01 CA134241 וR01 DE021445) ואגודה האמריקנית לסרטן (RSG-11-162-01-MPC) עבודה.

הצהרת אתיקה: כל העבודה בבעלי החיים בוצעה תחת בהתאם קפדן עם ההמלצות במדריך לטיפול והשימוש בחי מעבדה של המכון הלאומי לבריאות. הפרוטוקול אושר על ידי הוועדה המוסדית טיפול בבעלי חיים ושימוש (IACUC) מאוניברסיטת הדרום קליפורניה. 1....

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

התחמקות חיסונית נגיפית היא אחת האינטראקציות דינמיות ומרתקות ביותר התממשקות עבירה נגיפית ומארח הגנה 9. מרכיבי החיסון המולדים המארח בנויים כך שהולכים אותות הוא יזם ביעילות ובמועבר בנאמנות. המגדיר את ההיררכיה ופיקוח על איתות מפלים הוא נושא בולט של חסינות מולדת. ?...

מחקרים שנעשו לאחרונה תארו את מפלי איתות הכוללים בהרכבת מערכת חיסונית מולדת מארח. המתגורר בתוך תאים נפרדים, קולטני זיהוי תבניות (PRRs) לזהות דפוסים מולקולריים הקשורים הפתוגן (PAMPs) ממוצא המגוון כדי לעורר חיסון מולדים איתות 1. הגן רטינואית-Induced חומצתי (RIG-I) ואנטיגן בידול מלנומה 5 חלבונים (MDA5) הם חיישני cytosolic שיכירו מיני RNA עם תכונות מבניות ספציפיות 2. עם ההפעלה, RIG-I אינטראקציה עם Mavs ההמשך שלה (הידוע גם בIPS-1, ויזה, וCARDIF) מתאם זה, בתורו, מפעיל את IKK (IKKαβγ) וקינאז הקשורות IKK (TBK1 וIKKε, הידוע גם Ikki ) קומפלקסי 3-6. קינאזות חיסון המולדת מופעלת phosphorylate רגולטורים מפתח של ביטוי גנים, ובם גורמי שעתוק ומעכביהם, ולאפשר הפעלת תעתיק של גנים אנטי מארח (למשל IL6, TNF &amp; #945;, CCL5, וIFNβ). מפלי איתות אלה מהווים תגובות עוצמה פנימיות מולדת חיסונית שלהקים מדינה אנטי מיקרוביאליים להגביל את התפשטות הפתוגן במהלך של זיהום בשלבים מוקדמים. Murine γHV68 קשור קשר הדוק לKSHV שעור האדם וEBV. לכן, זיהום γHV68 של עכברים מספק מודל חיה קטן צייתן כדי לבחון את התגובה החיסונית המארחת לזיהום בנגיף הרפס גמא in vivo 7. שימוש γHV68, המעבדה שלנו חשפה אסטרטגיה מורכבת לפי γHV68 חטיפת לארח איתות חיסונית מולדת כדי לאפשר הדבקה בנגיף. מצד אחד, γHV68 מפעיל את מסלול Mavs-IKKβ לקדם הפעלת תעתיק ויראלי באמצעות בימוי IKKβ הופעל לphosphorylate transactivator שכפול (להרכבה עצמית), המפתח גורם שעתוק הנגיפי עבור שכפול γHV68 8. מצד השני, זירחון תיווך IKKβ מספרים ראשוני רלה לשפלה וטווחinates NFΚB הפעלת 9. ככזה, זיהום γHV68 יעיל ימנע ייצור ציטוקינים אנטי. מעניין, הקרנת ניצול ספריית ביטוי של γHV68 זיהתה הרכבה עצמית כאנזים E3 כדי לגרום השפלה רלה ולבטל NFΚB הפעלת 10. ממצאים אלה לחשוף אסטרטגיית התחמקות חיסונית מורכבת לפיה אירועי איתות חיסוניים נגד הזרם הם רתמו על ידי γHV68 לשלול את ייצור ציטוקינים אנטי האולטימטיבי. כאן אנו מתארים פרוטוקול למדוד את ייצור ציטוקינים אנטי בעכברים נגועים בγHV68 גם in vivo לשעבר ויו o. בפרוטוקול אנחנו עוד לחקור את הביטוי &quot;מחדש&quot; של רכיבים חיסוניים מולדים בfibroblasts העוברי בנוקאאוט על ידי התמרה lentiviral, אשר מאתרת את הפונקציה של מולקולות חיסון המולדים הספציפיות בויסות ייצור ציטוקינים אנטי. פרוטוקול זה ניתן להתאים בקלות לviru האחרses ומסלולי איתות.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

בתגובה לזיהום נגיפי, התגובה החיסונית המולדת המארח מופעלת כדי למעלה לווסת ביטוי גנים וייצור של ציטוקינים אנטי. לעומת זאת, וירוסים התפתחו אסטרטגיות מורכבות להתחמק ולנצל את איתות חיסונית מארחת להישרדות ולרבייה. התחמקות חיסונית נגיפית, כרוך הגנת מארחת והעלמת נגיפית, מספקת את אחד הממשקים המרתקים ודינמיים ביותר להבחין באינטראקציה מארח וירוס. מחקרים אלה מקדמים את ההבנה שלנו בויסות מערכת החיסונית מולדת ולסלול את הדרך שלנו לפתח טיפולים אנטי רומן. Murine γHV68 הוא הפתוגן טבעי של מכרסמים עכבריים. γHV68 זיהום של עכברים מספק מודל חיה קטן צייתן כדי לבחון את התגובה אנטי לKSHV אדם וEBV שהפרעות של in vivo אינטראקציות מארח וירוס אינה ישימות. כאן אנו מתארים פרוטוקול כדי לקבוע את ייצור ציטוקינים אנטי. פרוטוקול זה יכול להיות מותאם לvir האחרמשתמש ואיתות מסלולים. לאחרונה, גילו כי γHV68 חטיפת Mavs וIKKβ, רכיבי מפתח מולדים חיסוניים איתות במורד הזרם של RIG-I cytosolic וMDA5, כדי לבטל את הפעלת NFΚB וייצור ציטוקינים אנטי. באופן ספציפי, זיהום γHV68 מפעיל IKKβ ושIKKβ הופעל phosphorylates רלה להאיץ השפלה רלה. ככזה, HV68 γ יעילות uncouples הפעלת NFΚB מIKKβ הופעל במעלה הזרם שלו, שולל את ביטוי גני ציטוקינים אנטי. מחקר זה מבהיר אסטרטגיה מורכבת לפיה הפעלת מערכת החיסון המולדת במעלה הזרם הוא יורטה על ידי פתוגן ויראלי כדי לבטל את הפעלת תעתיק מורד הזרם המיידית ולהתחמק ייצור ציטוקינים אנטי.

שלוש דמויות נציג מוצגות כאן, כוללים ייצור ציטוקינים בריאות של Mavs נגוע γHV68 + / + וMavs-/ - רמת עכבר, הפרשת ציטוקינים וביטוי גנים של Mavs נגוע γHV68 + / + וMavs - / - MEFs, ו רמות ה-mRNA של ציטוקינים Mavs נגוע γHV68 - / - MEFs &quot;מחדש&quot; עם Mavs. ניסויי נצ...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

אנו מתארים פרוטוקול למדוד את ייצור ציטוקינים אנטי בעכברים נגועים בוירוס ההרפס מודל, וירוס ההרפס עכברי גמא 68 (γ HV68) הקשור-הדוק לההרפס של קפוסי האנושי הקשורים סרקומה (KSHV) ווירוס אפשטיין בר (EBV). ניצול זני עכבר מהונדס גנטי וfibroblasts העכבר העוברי (MEFs), אנחנו הערכנו את ייצור ציטוקינים אנטי גם in vivo לשעבר vivo. &quot;בנייה מחדש&quot; את הביטוי של מרכיבי חיסון מולדים בfibroblasts העוברי בנוקאאוט על ידי התמרה lentiviral, אנחנו עוד לאתר מולקולות חיסון מולדים ספציפיות ולנתח את אירועי איתות מפתח שדיפרנציאלי להסדיר את ייצור ציטוקינים אנטי.

הביתור מולדת איתות חיסון בהתחמקות ויראלי של ציטוקין ייצור

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Research

JoVE Journal

Immunology and Infection

Production and Titering of Recombinant Adeno-associated Viral Vectors

ייצור Titering של Adeno הקשורים ווקטורים רקומביננטי ויראלי

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

כימות תגובת Burst נשימה כאינדיקטור של החיסון מולדת בריאות בדג הזברה

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

באמצעות RNA-התערבות לחקר התגובה החיסונית המולדת בהמקרופאגים עכבר

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

הדמיה לא פולשנית של התגובה החיסונית המולדת בדגם דג הזברה הזחל של<em&gt; Streptococcus iniae</em&gt; זיהום

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

אינדוקציה של הפעלה האימהית חיסונית בעכברים בשלב אמצע הריון עם ויראלי לחקות פולי (אני: C)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

ויבתר חלבון רב מתחמי איתות על ידי טיהור זיקה קומפלמנטציה ריאקציה דו-מולקולרית (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

ניתוח מתא בודד של Immunophenotype וייצור ציטוקין בדם כל הפריפריה באמצעות Cytometry המונית

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

דגם העכבר כדי להעריך מולדת התגובה החיסונית לזיהום Staphylococcus aureus

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

גלרייה mellonella מודל הניהול אוראלי את תגובות מערכת החיסון מולדים Study Commensal-Induced

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

בידוד של התאים המוננובית מונמונומנט ללמוד Ex Vivo מולדת תגובות החיסונית ברקמת הלימפה של האדם Mucosal

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...