Name: dissecting innate immune signaling in viral evasion of cytokine production
Uploaded: 2014-03-02T14:00:00
Description: Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Wild-type (Mavs + / +) og knockout (Mavs - / -) mus, Wild-type (Mavs + / +) og knockout (Mavs - / -) MEFs ble vennlig levert av Dr. Zhijian J. Chen (University of Texas Southwestern Medical Center) 13. Denne publikasjonen er basert på arbeidet finansiert med tilskudd fra NIH (R01 CA134241 og R01 DE021445) og American Cancer Society (RSG-11-162-01-MPC).

Etikk Uttalelse: Alle dyr arbeidet ble utført under strengt samsvar med anbefalingene i Guide for omsorg og bruk av forsøksdyr av National Institutes of Health. Protokollen ble godkjent av Institutional Animal Care og bruk Committee (IACUC) ved University of Southern California. En. Cytokin Gene Expression av kvantitativ real-time PCR og sekresjon av ELISA i γHV68-infiserte mus <ol><li> Anesthetize kjønns matchet, 6-8 uker gamle C57BL / 6 (B6) kullsøsken (8-12 mus / g...

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

Viral immune evasion er en av de mest dynamiske og spennende interaksjoner grensesnitt viral krenkelser og vert forsvar ni. Verts medfødte immun komponenter er strukturert slik at signaltransduksjon er effektivt initiert og trofast overført. Opptegning av hierarki og regulering av signalanlegg kaskader er en fremragende tema av medfødt immunitet. Her introduserer vi en protokoll for å identifisere de regulatoriske roller en medfødt immun komponent, MAVS, i viral unndragelse av cytokin produksjon. Protoko...

Nyere studier har skissert den samlede signal kaskader i monterings vert medfødte immunresponser. Bosatt innenfor forskjellige avdelinger, mønstergjenkjenning reseptorer (PRRs) oppdage patogen-assosiert molekylære mønstre (PAMPs) av diverse opprinnelse å utløse medfødte immun signaliserer en. Den retinsyre-indusert gen I (RIG-I) og melanom differensiering antigen 5 (MDA5) proteiner er cytosoliske sensorer som gjenkjenner RNA arter med spesifikke strukturelle egenskaper to. Ved aktivering, samhandler RIG-I med sine nedstrøms MAVS (også kjent som IPS-en, VISA, og CARDIF) adapter som i sin tur aktiverer IKK (IKKαβγ) og IKK-relaterte kinase (TBK1 og IKKε, også kjent som Ikki ) komplekser 3-6. Aktivert medfødte immun kinaser phosphorylate viktige regulatorer av genuttrykk, inkludert transkripsjonsfaktorer og hemmere av dette, og gjøre det mulig transcriptional aktivering av vertsantivirale gener (f.eks IL6, TNF &amp; #945;, CCL5, og IFNβ). Disse signal kaskader utgjør potente iboende medfødte immunresponser som etablerer en anti-mikrobiell staten å begrense patogen forplantning i tidlige stadier av infeksjon. Murint γHV68 er nært knyttet til menneskelig onkogene KSHV og EBV. Således γHV68 infeksjon i mus gir en medgjørlig liten dyremodell for å undersøke vertens immunrespons til gamma herpesvirus-infeksjon in vivo 7.. Bruke γHV68, har vår lab avdekket et intrikat strategi der γHV68 kaprer vert medfødte immunsignalisering for å muliggjøre virusinfeksjon. På den ene siden, γHV68 aktiverer MAVS-IKKβ veien å fremme viral transcriptional aktivering via dirigere aktivert IKKβ å phosphorylate replikering transactivator (RTA), viral transkripsjonsfaktor nøkkel for γHV68 replikering åtte. På den annen side, klargjør IKKβ-mediert fosforylering rela for nedbrytning og terminates NFΚB aktivering ni. Som sådan, γHV68 infeksjon effektivt unngår viral cytokinproduksjon. Interessant, identifisert en screening utnytte et uttrykk bibliotek av γHV68 RTA som en E3 ligase å indusere forhold fornedrelse og oppheve NFΚB aktivering 10. Disse funnene avdekke en intrikat immune evasion strategi der oppstrøms immunsignal hendelser tøyles av γHV68 å negere den ultimate antiviral cytokin produksjon. Her beskriver vi en protokoll for å måle antiviral cytokin produksjon i mus infisert med γHV68 både in vivo og ex viv o. I protokollen vi videre utforske &quot;rekonstituert&quot; uttrykk for medfødte immun komponenter i knockout embryonale fibroblaster ved lentiviral transduksjon, som peikt funksjon av de spesifikke medfødte immun molekyler i å regulere den antivirale cytokin produksjon. Denne protokollen kan lett tilpasses andre Viruses og signalveier.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

Som reaksjon på en virusinfeksjon, er verten medfødte immunrespons aktiveres for å opp-regulerer genekspresjon og produksjon av antivirale cytokiner. Omvendt har virus utviklet intrikate strategier for å omgå og utnytte vertens immunsignalisering for overlevelse og formering. Viral immune evasion, innebærer host forsvar og viral unndragelser, gir en av de mest fascinerende og dynamiske grensesnitt for å skjelne verts-virus interaksjon. Disse studiene fremme vår forståelse i medfødte immunregulering og bane vei for å utvikle nye antivirale behandlingsformer. Murine γHV68 er et naturlig patogen av murine gnagere. γHV68 infeksjon i mus gir en medgjørlig liten dyremodell for å undersøke den antiviral respons på menneskelig KSHV og EBV som forstyrrelse av in vivo-virus-vert interaksjoner er ikke aktuelt. Her beskriver vi en protokoll for å bestemme den antivirale cytokinproduksjon. Denne protokollen kan tilpasses andre virbruker og signalveier. Nylig, har vi oppdaget at γHV68 kaprer MAVS og IKKβ, viktige medfødte immunsignalkomponenter nedstrøms cytosoliske RIG-I og MDA5, å oppheve NFΚB aktivering og antiviral cytokin produksjon. Spesielt γHV68 infeksjon aktiverer IKKβ og som aktiveres IKKβ phosphorylates forhold til å akselerere forhold degradering. Som sådan, γ HV68 effektivt kobler seg NFΚB aktivering fra sin oppstrøms aktivert IKKβ, benektende antiviral cytokin genuttrykk. Denne studien belyser en intrikat strategi der oppstrøms medfødte immunaktivering blir snappet opp av en viral patogen å oppheve den umiddelbare nedstrøms transcriptional aktivering og unngå antiviral cytokin produksjon.

Tre representative tallene er vist her, inkludert cytokin produksjon i lungene av γHV68-infiserte Mavs + / + og Mavs-/ - mus, cytokin sekresjon og genuttrykk nivå av γHV68-infiserte Mavs + / + og Mavs - / - MEFs, og cytokin mRNA nivåer av γHV68-infiserte Mavs - / - MEFs &quot;rekonstituert&quot; med MAVS. Disse representative eksperimentene utnytte genet knockout mus for å undersøke antiviral cytokin produksjon <em...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Vi beskriver en protokoll for å måle den antivirale cytokin produksjon i mus infisert med en modell herpesvirus, murine gamma herpesvirus 68 (γ HV68) som er nært beslektet med humant Kaposis sarkom assosiert herpesvirus (KSHV) og Epstein-Barr virus (EBV). Utnytte genmodifiserte mus stammer og mus embryonale fibroblaster (MEFs), vurderte vi de antivirale cytokin produksjon både in vivo og ex vivo. &quot;Rekonstitusjon&quot; uttrykk for medfødte immun komponenter i knockout embryonale fibroblaster ved lentiviral transduksjon, vi videre finne spesifikke medfødte immun molekyler og dissekere de viktigste signal hendelser som differentially regulerer antiviral cytokin produksjon.

Dissekere medfødte immunsignalisering i Viral Evasion av cytokinproduksion

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Research

JoVE Journal

Immunology and Infection

Production and Titering of Recombinant Adeno-associated Viral Vectors

Produksjon og Titering av rekombinant Adeno-assosiert virale vektorer

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

Kvantifisering av Respiratory Burst Response som en indikator på medfødte immun Health i sebrafisk

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Ved hjelp av RNA-interferens for å undersøke det medfødte immunrespons i Musemakrofager

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Non-invasiv Imaging av det medfødte immunrespons i en Sebrafisk Larve Modell av<em&gt; Streptococcus iniae</em&gt; Infeksjon

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Induksjon av Maternal immunaktivering hos mus ved Mid-svangerskap scenen med Viral Mimic Poly (I: C)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

Dissekere multi protein signalnettverk komplekser av resultatet av dette Complementation affinitet rensing (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Én celle analyse av Immunophenotype og cytokin produksjon i eksterne fullblod via masse cytometri

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

En musemodell å vurdere medfødte immunforsvaret til Staphylococcus aureus infeksjoner

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Galleria mellonella muntlig administrasjonsmodell til Study Commensal-Induced medfødte immunreaksjoner

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Isolering av tonsillar mononukleære celler for å studere ex vivo medfødte immunresponser i et humant slimhinnelymfoid vev

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...