Name: reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists
Uploaded: 2013-11-15T18:30:00
Description: Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

Dit werk werd ondersteund door de National Institutes of Health (NIH) subsidies CA127231 en The Damon Runyon Stichting Clinical Investigator Award (CI 1502) (SM). Wij willen professor Zdenek Dvorak bedanken van Palacky Universiteit Olomouc, Tsjechië voor zijn nuttige inzichten in de bespreking van de overdraagbaarheid van deze techniek om hun instelling en standaardisatie van het protocol.

1. Bouw van PXR en SRC-1 Fusies in gistvectoren <ol><li> PCR-amplificatie van Human PXR LBD (107-434 aminozuren) en Human SRC-1 volledige lengte (1-1401 aminozuren). <ol><li> Gebruik pSG5-hPXR plasmide 8 als PXR LBD sjabloon, gebruiken pCMX-SRC1 plasmide als SRC-1-sjablonen. </li><li> Dooi PCR SuperMix, DNA templates en primers (zie materialen), bewaar ze op ijs. </li><li> Voeg 0,25 ug / ul DNA-matrijs 1 ui, 10 mM primerparen 2 pi elk PCR Supermix 45 ui en voeg H2O aan totale volume op 50 ui te b...

<ol>
	<li>Kliewer, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+orphan+nuclear+receptor+activated+by+pregnanes+defines+a+novel+steroid+signaling+pathway.">An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway.</a> Cell. 92 (1), 73-82 (1998).</li><li>Blumberg, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+novel+steroid+and+xenobiotic-sensing+nuclear+receptor.">a novel steroid and xenobiotic-sensing nuclear receptor.</a> Genes Dev. 12 (20), 3195-3205 (1998).</li><li>Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+the+'Jekyll+and+Hyde'+Nature+of+PXR:+The+Case+for+Discovering+Antagonists.">Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists.</a> Pharm. Res. 26 (8), 1807-1815 (2009).</li><li>Pondugula, S. R., Mani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pregnane+xenobiotic+receptor+in+cancer+pathogenesis+and+therapeutic+response.">Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response.</a> Cancer Lett. 328 (1), 1-9 (2013).</li><li>Mani, S., Dou, V., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PXR+antagonists+and+implications+for+drug+metabolism.">PXR antagonists and implications for drug metabolism.</a> Drug Metab. Rev. 45 (1), 60-72 (2013).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Yeast-Based+Strategy+Unveils+Antagonist+Binding+Regions+on+the+Nuclear+Xenobiotic+Receptor+PXR.">Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR.</a> J. Biol. Chem. 288 (19), 13655-13668 (2013).</li><li>Hollenberg, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+new+family+of+tissue-specific+basic+helix-loop-helix+proteins+with+a+two-hybrid+system.">Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.</a> Mol. Cell. Biol. 15 (7), 3813-3822 (1995).</li><li>Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+Ras+interacts+directly+with+the+serine/threonine+kinase+Raf.">Mammalian Ras interacts directly with the serine/threonine kinase Raf.</a> Cell. 74 (1), 205-214 (1993).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phytoestrogen+coumestrol+is+a+naturally+occurring+antagonist+of+the+human+pregnane+X+receptor.">The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor.</a> Mol. Endocrinol. 22 (4), 838-857 (2008).</li><li>Kalpana, G. V., Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+homomeric+interactions+of+human+immunodeficiency+virus+type+1+integrase+using+the+yeast+two-hybrid+system.">Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system.</a> Proc. Natl. Acad. Sci. U.S.A. 90 (22), 10593-10597 (1993).</li><li>Hamdi, A., Colas, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeast+two-hybrid+methods+and+their+applications+in+drug+discovery.">Yeast two-hybrid methods and their applications in drug discovery.</a> TiPS. 33 (2), 109-118 (2012).</li><li>Battesti, A., Bouveret, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bacterial+two-hybrid+system+based+on+adenylate+cyclase+reconstitution+in+Escherichia+coli.">The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli.</a> Methods. 58 (4), 325-334 (2012).</li><li>Caufield, J. H., Sakhawalkar, N., Uetz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+and+optimization+of+yeast+two-hybrid+systems.">A comparison and optimization of yeast two-hybrid systems.</a> Methods. 58 (4), 317-324 (2012).</li><li>Albers, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+yeast+two-hybrid+screening+for+nuclear+receptor-interacting+proteins.">Automated yeast two-hybrid screening for nuclear receptor-interacting proteins.</a> Mol. Cell Proteomics. 4 (2), 205-213 (2005).</li><li>Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+role+of+the+orphan+nuclear+receptor+SXR+(steroid+and+xenobiotic+receptor)+in+the+mechanism+of+CYP3A4+inhibition+by+xenobiotics.">Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics.</a> J. Biol. Chem. 277 (36), 32453-32458 (2002).</li><li>Huang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+drug+metabolism+by+blocking+the+activation+of+nuclear+receptors+by+ketoconazole.">Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole.</a> Oncogene. 26 (2), 258-268 (2007).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activated+pregnenolone+X-+receptor+is+a+target+for+ketoconazole+and+Its+analogs.">Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs.</a> Clin. Cancer Res. 13 (8), 2488-2495 (2007).</li><li>Ghannoum, M. A., Rice, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antifungal+agents:+mode+of+action,+mechanisms+of+resistance,+and+correlation+of+these+mechanisms+with+bacterial+resistance.">Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance.</a> Clin. Microbiol. Rev. 12 (4), 501-517 (1999).</li><li>Kaur, R., Bachhawat, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+yeast+multidrug+resistance+pump,+Pdr5p,+confers+reduced+drug+resistance+in+erg+mutants+of+Saccharomyces+cerevisiae.">The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae.</a> Microbiology. 145, 809-818 (1999).</li><li>White, T. C., Marr, K. A., Bowden, R. A., cellular, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical,+cellular,+and+molecular+factors+that+contribute+to+antifungal+drug+resistance.">Clinical, cellular, and molecular factors that contribute to antifungal drug resistance.</a> Clin. Microbiol. Rev. 11 (2), 382-402 (1998).</li><li>Serebriiskii, I. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+peptides,+proteins,+and+drugs+that+selectively+interact+with+protein+targets.">Detection of peptides, proteins, and drugs that selectively interact with protein targets.</a> Genome Res. 12, 1785-1791 (2002).</li><li>Yang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+role+for+PELP1+in+nonandrogenic+activation+of+the+androgen+receptor+in+prostate+cancer.">Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer.</a> Mol Endocrinol. 26 (4), 550-561 (2012).</li><li>Zhan, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+orphan+nuclear+receptor+Nur77+regulates+LKB1+localization+and+activates+AMPK.">The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK.</a> Nat Chem Biol. 8 (11), 897-904 (2012).</li></ol>

In onze gewijzigde Y2H test, hebben we belangrijke residuen voor ketoconazol interacties op PXR 6 geïdentificeerd. Omdat SRC-1 een coactivator (en werd gekloneerd in de vector pGADNot), hebben we ook getest of SRC-1 lacZ expressie kan activeren wanneer gekloneerd in de PSH vectorsysteem en of de activatie profiel zou veranderen en / of beïnvloeden van leakiness de gist two-hybrid. Met onze vernieuwde plasmiden voerden we twee-hybride assays erg3 Δ / ERG11 Δ gist. Zoals wordt aangetoond d...

De gist twee-hybride (Y2H) test wordt veel gebruikt om eiwit-eiwit interacties ontdekken en meer onlangs voor ontdekking van nieuwe kleine moleculen die eiwit-eiwit interactie complexen 7, 8, 9, 10, 11 verstoren. De conventionele benaderingen van deze test gebruikt voor drug discovery of &quot;hits&quot;, niet mogelijk voor de detectie van allosterische interactie residuen van chemische verbindingen in eiwit-eiwit oppervlak, dat bij nog veranderde interactie en zorgen voor ondervraging van de veranderde residuen 11 . Immers, een dergelijke methode (n), indien mogelijk ontwikkelen, zou een handelbaar gist voor hoge doorvoer beoordeling van allosterische interactie residuen essentieel voor eiwit-eiwit interactie verstoring mogelijk. In het kader van het geneesmiddelenonderzoek, zou de meest directe manier om wisselwerking van verbindingen vast eiwitten structuurbepaling (bv. kristallisatie eiwit-remmer complex) omvatten. Deze methoden zijn cumbersome, gebruik uitgebreide middelen en het technisch niet haalbaar is om structurele studies van elk eiwit uit te voeren. Tractable genetische drug screening systemen zijn in bacteriën 1, 2 en andere modelsystemen zoals zoogdier twee-hybride vastgesteld. Echter, deze systemen moeten optimalisatie en alternatieve systemen zoals Y2H zijn nog steeds de meest getest in drug discovery. Er zijn beperkingen die slechte gevoeligheid en betrouwbaarheid van interacties met bijzondere werkwijzen 13 omvatten echter een Y2H test kan worden aangepast aan specifieke vragen over interactie residuen beantwoorden. Op het gebied van nucleaire receptor onderzoek is Y2H gebruikt om interagerende eiwitten 14 definiëren, maar deze eiwitinteracties zelden gebruikt om de natuur waarin liganden / antagonisten interageren met nucleaire receptor-eiwitcomplexen definiëren. Aldus ons laboratorium gericht op pogingen het definiëren van een werkwijze, vooral voor receptoreiwitten die nietgemakkelijk vatbaar voor gebaseerde methoden proteomics, dat zou nieuwe ligand / antagonist interactie resten behulp van een omgekeerde Y2H gebaseerd discovery platform ontgraven. Op basis van onze eerdere bevinding dat ketoconazol verstoort PXR en de activator SRC-1, ontwikkelden we een nieuwe reverse Y2H systeem dat ons in staat stellen om ketoconazol interactie resten te definiëren en te ondervragen op PXR 6. Onze methode is gebaseerd op de eigenschappen van de gist GAL4 eiwit dat bestaat uit scheidbare domeinen die verantwoordelijk zijn voor DNA-binding en transcriptionele activatie. De PXR LBD proteïne wordt uitgedrukt als een fusie met het LexA DNA-bindingsdomein (DNA-BD), terwijl de volledige lengte co-activatoren SRC-1 (steroïdereceptor coactivator 1) zijn proteïnen tot expressie als fusies aan het GAL4 activeringsdomein (AD ). Interactie tussen PXR en SRC-1 fusie-eiwitten leidt tot de transcriptionele activering van GAL4-bindingsplaatsen bevattend reportergen β-Lac Z die is geïntegreerd in de gist genome. Ketoconazol, een PXR antagonist, verstoort PXR en SRC-1 interactie 15, 16, 17 en kunnen we de interactie van PXR detecteren en SRC-1 bij aanwezigheid of afwezigheid van ketoconazol na kleuren kolonies op filters voor X-gal activiteit. Het principe van Y2H wordt geïllustreerd in figuur 1 en de experimentele procedure wordt samengevat in figuur 2.

<table border="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Yeast Strain CTY10-5d erg3&#916;/erg11&#916;</td>
			<td>Our lab</td>
			<td></td>
			<td>CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3&#916;/erg11&#916;) genes6 .</td>
		</tr>
		<tr>
			<td>YPD Growth Medium</td>
			<td>BD Biosciences</td>
			<td>630409</td>
			<td></td>
		</tr>
		<tr>
			<td>Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate</td>
			<td>BD Biosciences</td>
			<td>233520</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacto Agar</td>
			<td>BD Biosciences</td>
			<td>214010</td>
			<td></td>
		</tr>
		<tr>
			<td>CSM-His/-Leu Complete Supplement Mixture</td>
			<td>MP Biomedicals</td>
			<td>4250-412</td>
			<td></td>
		</tr>
		<tr>
			<td>ONPG (o-Nitrophenyl &#914;-D- Galactopyranoside).</td>
			<td>Sigma-Aldrich</td>
			<td>N1127</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Luria Broth (LB)</td>
			<td>Sigma-Aldrich</td>
			<td>L3022</td>
			<td></td>
		</tr>
		<tr>
			<td>X-Gal</td>
			<td>Fisher</td>
			<td>BP-1615</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicated Salmon Sperm DNA boiled (10 mg/ml)</td>
			<td>Life Technology</td>
			<td>156-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Acros Organics</td>
			<td>61177</td>
			<td></td>
		</tr>
		<tr>
			<td>Ketoconazole</td>
			<td>Sigma-Aldrich</td>
			<td>K1003</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N-Dimethylformamide</td>
			<td>Acros Organics</td>
			<td>326871000</td>
			<td></td>
		</tr>
		<tr>
			<td>Lithium Acetate</td>
			<td>Sigma-Aldrich</td>
			<td>L4158</td>
			<td></td>
		</tr>
		<tr>
			<td>50% PEG-3350 solution, filter-sterilized</td>
			<td>Sigma-Aldrich</td>
			<td>P-3640</td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose Membrane</td>
			<td>Whatman</td>
			<td>10402091</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm Petri Dish</td>
			<td>Fisher</td>
			<td>875712</td>
			<td></td>
		</tr>
		<tr>
		</tr>
	</tbody>
</table>

<table border="1">
	<tbody>
		<tr>
			<td>5&#39;-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD forward primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-AGAGTCGACTCAGCTA CCTGTGATGCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD reverse primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 forward primer for pGADNOT</td>
		</tr>
		<tr>
			<td>5&#39;-GCGGTCGACTTATTCAGTCA GTAGCTG -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 reverse primer for pGADNOT</td>
		</tr>
		<tr>
			<td>Platinum PCR Supermix</td>
			<td>Invitrogen</td>
			<td>11306-016</td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>our lab</td>
			<td>R0136</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>our lab</td>
			<td>R0138</td>
			<td></td>
		</tr>
		<tr>
			<td>NotI</td>
			<td>our lab</td>
			<td>R0189</td>
			<td></td>
		</tr>
	</tbody>
</table>

reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists

Als een kritische regulator van metabolisme en ontsteking, pregnaan X receptor (PXR), speelt een belangrijke rol bij de ziekte pathofysiologie koppelen metabolisme en ontsteking (bijvoorbeeld hepatische steatose) 1,2. Er is veel vooruitgang geboekt in het identificeren van agonist liganden voor PXR, echter, zijn er weinig beschrijvingen van drug-als antagonisten en hun bindingsplaatsen op PXR 3,4,5. Een kritische barrière het onvermogen om efficiënt te zuiveren eiwit van volledige lengte voor structurele studies met antagonisten hoewel PXR werd gekloneerd en gekarakteriseerd in 1998. Ons laboratorium ontwikkelde een nieuwe high throughput op basis van gist two-hybrid is een antagonist, ketoconazol definiëren, bindend residuen op PXR 6. De werkwijze omvat het creëren mutatiepatronen bibliotheken die het effect van afzonderlijke mutaties op de AF-2 oppervlak van PXR interactie verwacht tussen ketoconazol zou redden. Reddings-of &#39;gain-of-function &quot;second mutaties kunnen zodat conclusies over de genetische interactie van ketoconazol en het oppervlak residu (en) op PXR haalbaar worden gemaakt. Zo, een high throughput two-hybrid gist scherm van PXR mutanten interactie met haar coactivator, SRC-1 ontwikkelden we. Met deze aanpak, waarbij de gist werd gewijzigd om de studie van het antimycoticum ketoconazol tegemoet kunnen we aantonen specifieke mutaties op PXR verrijkt klonen niet binden aan ketoconazol. Door omgekeerde logica, concluderen we dat de oorspronkelijke resten zijn directe interactie residuen met ketoconazol. Deze test is een roman, handelbaar genetische test voor het screenen op antagonist bindingsplaatsen op nucleaire receptor oppervlakken. Deze test kan worden toegepast op elk geneesmiddel ongeacht de cytotoxische gist en cellulaire eiwit (ten) die niet kunnen worden onderzocht met behulp van standaard structurele biologie of proteomics gebaseerde methoden. Mogelijke valkuilen onder de interpretatie van gegevens (complementaire methoden bruikbaar), reliAnce op enkele Y2H methode, deskundigheid in het omgaan met gist of het uitvoeren van gist twee-hybride assays, en test optimalisatie.

We voerden een test om te zien of we een colorimetrische uitlezing van de vereniging van PXR en steroïde receptor coactivator-1 (SRC-1) kunnen detecteren. Omdat gist aanzienlijke sterol productie is eerder aangetoond dat lacZ expressie in gist kan worden opgewekt zonder extra exogeen ligand. We vonden dat lacZ expressie (blauwe kolonies) ook wordt geïnduceerd in de giststam getransformeerd met PXR en SRC-1, maar er is geen inductie van LacZ expressie (witte kolonies) in gist getransformeerd met lege vectoren, PXR of S...

Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Ketoconazol bindt aan en antagoniseert pregnaan X Receptor (PXR) activering. Gist high throughput screens van PXR mutanten definiëren een unieke regio voor ketoconazol bindend. Dit op basis van gist genetische methode ontdekt nieuwe nucleaire receptor interacties met liganden die associëren met oppervlakte bindingsplaatsen.

Reverse Gist Twee-hybride systeem voor het identificeren van zoogdieren Nuclear Receptor Residuen die interageren met liganden en / of antagonisten

As a critical regulator of drug metabolism and inflammation, Pregnane X Receptor (PXR), plays an important role in disease pathophysiology linking ...

Research

JoVE Journal

Biology

Proteomics to Identify Proteins Interacting with P2X2 Ligand-Gated Cation Channels

Proteomics om eiwitten Interactie met P2X2 ligand-gated kationenkanalen identificeren

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys ...

Split-Ubiquitin Based Membrane Yeast Two-Hybrid (MYTH) System: A Powerful Tool For Identifying Protein-Protein Interactions

Split-Ubiquitin Based Membrane Yeast Two-Hybrid MYTH System: A Powerful Tool For Identifying Protein-Protein Interactions

Split-Ubiquitine membraanfilters op Yeast Two-Hybrid (mythe) Systeem: een krachtig hulpmiddel voor het identificeren van eiwit-eiwit interacties

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

Analyse van de mRNA Nuclear Export Kinetics in zoogdiercellen door micro-injectie

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

RNAi screening Postembryonic fenotypes Leg in C. elegans</em

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated ...

Modified Yeast-Two-Hybrid System to Identify Proteins Interacting with the Growth Factor Progranulin

Gemodificeerde gist-twee-hybride systeem aan eiwitten Interactie met de groeifactor progranuline identificeren

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

siRNA Screening naar Ubiquitin en Ubiquitin-achtig systeem regulatoren van biologische pathways identificeren in gekweekte zoogdiercellen

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Nanogold Labeling of the Yeast Endosomal System for Ultrastructural Analyses

Nanogold Labeling van de Gist endosomale systeem voor Ultrastructurele Analyses

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

Opsporen van oestrogene liganden in verzorgingsproducten met behulp van een gist oestrogeen scherm geoptimaliseerd voor het Undergraduate Onderwijs laboratorium

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine ...

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain (RTA) Trafficking in Yeast

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain RTA Trafficking in Yeast

Een eenvoudige fluorescentie gebaseerde verslaggever Assay identificatie van cellulaire bestanddelen die nodig zijn voor ricine toxine een keten (RTA) handel in gist

Bacterial and plant A/B toxins exploit the natural trafficking pathways in eukaryotic cells to reach their intracellular target(s) in the cytosol and to ...

A Flow Cytometry-based Assay to Identify Compounds That Disrupt Binding of Fluorescently-labeled CXC Chemokine Ligand 12 to CXC Chemokine Receptor 4

Een stroom Cytometry gebaseerde Assay te identificeren van verbindingen die Binding van Fluorescently-geëtiketteerden CXC Chemokine Ligand 12 aan CXC Chemokine Receptor 4 verstoren