Name: reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists
Uploaded: 2013-11-15T18:30:00
Description: Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

Diese Arbeit wurde vom National Institutes of Health (NIH) unterstützt Grants CA127231 und The Damon Runyon Stiftung Clinical Investigator Award (CI 1502) (SM). Wir möchten Professor Zdenek Dvorak danken von Palacky Universität Olomouc, Tschechische Republik für seine hilfreiche Einblicke in Diskussion Tragbarkeit dieser Technik auf ihre Institution und Standardisierung von Protokoll.

1. Bau von PXR und SRC-1-Fusionen in Hefe-Vektoren <ol><li> PCR-Amplifikation der Menschen PXR LBD (107-434 Aminosäuren) und Menschen SRC-1 voller Länge (1 bis 1401 Aminosäuren). <ol><li> Verwenden pSG5-hPXR Plasmid 8 als PXR LBD-Vorlage, verwenden Sie pCMX SRC1-Plasmid als SRC-1-Vorlagen. </li><li> Tauwetter SuperMix PCR, DNA-Template und Primer (siehe Materialien), halten Sie sie auf Eis. </li><li> In 0,25 ug / ul ul DNA-Vorlage 1, 10 mM Primerpaare jeweils 2 ul, 45 ul PCR SuperMix und fügen H 2<...

<ol>
	<li>Kliewer, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+orphan+nuclear+receptor+activated+by+pregnanes+defines+a+novel+steroid+signaling+pathway.">An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway.</a> Cell. 92 (1), 73-82 (1998).</li><li>Blumberg, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+novel+steroid+and+xenobiotic-sensing+nuclear+receptor.">a novel steroid and xenobiotic-sensing nuclear receptor.</a> Genes Dev. 12 (20), 3195-3205 (1998).</li><li>Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+the+'Jekyll+and+Hyde'+Nature+of+PXR:+The+Case+for+Discovering+Antagonists.">Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists.</a> Pharm. Res. 26 (8), 1807-1815 (2009).</li><li>Pondugula, S. R., Mani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pregnane+xenobiotic+receptor+in+cancer+pathogenesis+and+therapeutic+response.">Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response.</a> Cancer Lett. 328 (1), 1-9 (2013).</li><li>Mani, S., Dou, V., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PXR+antagonists+and+implications+for+drug+metabolism.">PXR antagonists and implications for drug metabolism.</a> Drug Metab. Rev. 45 (1), 60-72 (2013).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Yeast-Based+Strategy+Unveils+Antagonist+Binding+Regions+on+the+Nuclear+Xenobiotic+Receptor+PXR.">Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR.</a> J. Biol. Chem. 288 (19), 13655-13668 (2013).</li><li>Hollenberg, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+new+family+of+tissue-specific+basic+helix-loop-helix+proteins+with+a+two-hybrid+system.">Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.</a> Mol. Cell. Biol. 15 (7), 3813-3822 (1995).</li><li>Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+Ras+interacts+directly+with+the+serine/threonine+kinase+Raf.">Mammalian Ras interacts directly with the serine/threonine kinase Raf.</a> Cell. 74 (1), 205-214 (1993).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phytoestrogen+coumestrol+is+a+naturally+occurring+antagonist+of+the+human+pregnane+X+receptor.">The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor.</a> Mol. Endocrinol. 22 (4), 838-857 (2008).</li><li>Kalpana, G. V., Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+homomeric+interactions+of+human+immunodeficiency+virus+type+1+integrase+using+the+yeast+two-hybrid+system.">Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system.</a> Proc. Natl. Acad. Sci. U.S.A. 90 (22), 10593-10597 (1993).</li><li>Hamdi, A., Colas, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeast+two-hybrid+methods+and+their+applications+in+drug+discovery.">Yeast two-hybrid methods and their applications in drug discovery.</a> TiPS. 33 (2), 109-118 (2012).</li><li>Battesti, A., Bouveret, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bacterial+two-hybrid+system+based+on+adenylate+cyclase+reconstitution+in+Escherichia+coli.">The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli.</a> Methods. 58 (4), 325-334 (2012).</li><li>Caufield, J. H., Sakhawalkar, N., Uetz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+and+optimization+of+yeast+two-hybrid+systems.">A comparison and optimization of yeast two-hybrid systems.</a> Methods. 58 (4), 317-324 (2012).</li><li>Albers, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+yeast+two-hybrid+screening+for+nuclear+receptor-interacting+proteins.">Automated yeast two-hybrid screening for nuclear receptor-interacting proteins.</a> Mol. Cell Proteomics. 4 (2), 205-213 (2005).</li><li>Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+role+of+the+orphan+nuclear+receptor+SXR+(steroid+and+xenobiotic+receptor)+in+the+mechanism+of+CYP3A4+inhibition+by+xenobiotics.">Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics.</a> J. Biol. Chem. 277 (36), 32453-32458 (2002).</li><li>Huang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+drug+metabolism+by+blocking+the+activation+of+nuclear+receptors+by+ketoconazole.">Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole.</a> Oncogene. 26 (2), 258-268 (2007).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activated+pregnenolone+X-+receptor+is+a+target+for+ketoconazole+and+Its+analogs.">Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs.</a> Clin. Cancer Res. 13 (8), 2488-2495 (2007).</li><li>Ghannoum, M. A., Rice, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antifungal+agents:+mode+of+action,+mechanisms+of+resistance,+and+correlation+of+these+mechanisms+with+bacterial+resistance.">Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance.</a> Clin. Microbiol. Rev. 12 (4), 501-517 (1999).</li><li>Kaur, R., Bachhawat, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+yeast+multidrug+resistance+pump,+Pdr5p,+confers+reduced+drug+resistance+in+erg+mutants+of+Saccharomyces+cerevisiae.">The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae.</a> Microbiology. 145, 809-818 (1999).</li><li>White, T. C., Marr, K. A., Bowden, R. A., cellular, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical,+cellular,+and+molecular+factors+that+contribute+to+antifungal+drug+resistance.">Clinical, cellular, and molecular factors that contribute to antifungal drug resistance.</a> Clin. Microbiol. Rev. 11 (2), 382-402 (1998).</li><li>Serebriiskii, I. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+peptides,+proteins,+and+drugs+that+selectively+interact+with+protein+targets.">Detection of peptides, proteins, and drugs that selectively interact with protein targets.</a> Genome Res. 12, 1785-1791 (2002).</li><li>Yang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+role+for+PELP1+in+nonandrogenic+activation+of+the+androgen+receptor+in+prostate+cancer.">Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer.</a> Mol Endocrinol. 26 (4), 550-561 (2012).</li><li>Zhan, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+orphan+nuclear+receptor+Nur77+regulates+LKB1+localization+and+activates+AMPK.">The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK.</a> Nat Chem Biol. 8 (11), 897-904 (2012).</li></ol>

In unserer modifizierten Y2H-Assay haben wir wichtige Reste für Ketoconazol Interaktionen auf PXR 6 identifiziert. Seit SRC-1 ist ein Co-Aktivator (und wurde in die pGADNot kloniert), haben wir auch getestet, ob SRC-1 könnte lacZ-Expression, wenn sie in der PSH-Vektorsystem kloniert aktivieren und ob dies die Aktivierungsprofil ändern und / oder auf die Undichtigkeit die Hefe-Zwei-Hybrid-Assay. Mit unserem neu gestalteten Plasmide wir in ERG3 Δ / Δ ERG11 Hefe-Zwei-Hybrid-geführt Assays...

Das Hefe-Zwei-Hybrid (Y2H) Assay wird häufig verwendet, um Protein-Protein-Wechselwirkungen zu entdecken und vor kurzem zur Entdeckung von neuen kleinen Molekülen, die Protein-Protein-Wechselwirkung Komplexe 7, 8, 9, 10, 11 zu stören. Die herkömmlichen Ansätze dieses Tests, für die Wirkstoffforschung oder &quot;Treffer&quot; verwendet werden, nicht für die Detektion von allosterischen Interaktion Rückstände von Chemikalien, Verbindungen, die in Protein-Protein-Oberflächen, ermöglichen, dass, wenn noch verändert interagieren und ermöglichen eine Abfrage der geänderten Reste 11 . Tatsächlich ist ein solches Verfahren (e), wenn möglich, zu entwickeln, würde eine lenkbar Hefe-System für die Bewertung der allosterische Wechselwirkung Reste kritisch für die Protein-Protein-Wechselwirkung Unterbrechung zu ermöglichen. Im Rahmen der Wirkstoffentwicklung, würde der direkteste Weg zur Wechselwirkung der Verbindungen mit Proteinen herzustellen beinhalten Strukturbestimmung (z. B. Kristallisation von Protein-Inhibitor-Komplexes). Diese Methoden sind cumbersome verwenden aufwendigen Ressourcen und es technisch nicht möglich, Strukturuntersuchungen an jedem Protein durchzuführen. Tractable genetische Wirkstoff-Screening-Systeme in Bakterien 1, 2 und andere Modellsysteme wie Säugetier-Zwei-Hybrid etabliert. Allerdings müssen diese Systeme Optimierung und alternative Systeme wie Y2H sind immer noch die am meisten in der Wirkstoffforschung getestet. Es gibt Grenzen, die geringe Empfindlichkeit und Zuverlässigkeit der Wechselwirkungen mit singulären Methoden 13 enthalten, auf eine einzige Y2H-Assay modifiziert werden, um spezielle Fragen zu beantworten Interaktion Rückstände. Im Bereich der Kernrezeptorforschung Y2H wurde verwendet, um interagierende Proteine ​​14 definieren, jedoch sind diese Protein-Wechselwirkungen wurden selten verwendet worden, um die Art, in der die Liganden / Antagonisten die Interaktion mit nukleären Rezeptor-Protein-Komplexe bilden. Somit unserem Labor konzentriert Bemühungen auf eine Methode zu definieren, vor allem für Rezeptorproteine, die nichtleicht zu einer Proteom-basierte Verfahren, das wäre neuartige Ligand / Antagonist Interaktion Rückstände mit einem Reverse-Discovery-Plattform basierend Y2H auszugraben. Aufgrund unserer bisherigen Erkenntnis, dass Ketoconazol stört PXR und seine Aktivator SRC-1, entwickelten wir eine neuartige Umkehr Y2H System, das uns ermöglichen, auf PXR 6 zu definieren und zu verhören Ketoconazol Interaktion Rückstände. Unser Verfahren basiert auf den Eigenschaften des Hefe-GAL4-Protein, das von trennbaren Domänen für die DNA-Bindung und Transkriptionsaktivierung verantwortlich besteht basiert. PXR LBD-Protein als Fusion mit dem LexA-DNA-Bindungsdomäne (DNA-BD) ausgedrückt, während die volle Länge Coaktivatoren SRC-1 (Steroid-Rezeptor-Coaktivator 1) Proteine ​​als Fusionen mit der GAL4-Aktivierungsdomäne exprimiert (AD ). Die Interaktion zwischen PXR und SRC-1-Fusionsproteinen führt zur Transkriptionsaktivierung von GAL4-Bindungsstellen enthält Reportergen β-Lac Z, die in den Hefe-Genom integriert istE. Ketoconazol, ein PXR-Antagonisten, stört PXR und SRC-1-Wechselwirkung 15, 16, 17, und wir können die Wechselwirkung von PXR in Gegenwart oder Abwesenheit von Ketoconazol nach Färbung Kolonien auf den Filtern für die X-gal-Aktivität nachzuweisen und SRC-1. Das Prinzip der Y2H ist in Fig. 1 dargestellt und das experimentelle Verfahren ist in Fig. 2 zusammengefaßt.

<table border="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Yeast Strain CTY10-5d erg3&#916;/erg11&#916;</td>
			<td>Our lab</td>
			<td></td>
			<td>CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3&#916;/erg11&#916;) genes6 .</td>
		</tr>
		<tr>
			<td>YPD Growth Medium</td>
			<td>BD Biosciences</td>
			<td>630409</td>
			<td></td>
		</tr>
		<tr>
			<td>Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate</td>
			<td>BD Biosciences</td>
			<td>233520</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacto Agar</td>
			<td>BD Biosciences</td>
			<td>214010</td>
			<td></td>
		</tr>
		<tr>
			<td>CSM-His/-Leu Complete Supplement Mixture</td>
			<td>MP Biomedicals</td>
			<td>4250-412</td>
			<td></td>
		</tr>
		<tr>
			<td>ONPG (o-Nitrophenyl &#914;-D- Galactopyranoside).</td>
			<td>Sigma-Aldrich</td>
			<td>N1127</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Luria Broth (LB)</td>
			<td>Sigma-Aldrich</td>
			<td>L3022</td>
			<td></td>
		</tr>
		<tr>
			<td>X-Gal</td>
			<td>Fisher</td>
			<td>BP-1615</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicated Salmon Sperm DNA boiled (10 mg/ml)</td>
			<td>Life Technology</td>
			<td>156-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Acros Organics</td>
			<td>61177</td>
			<td></td>
		</tr>
		<tr>
			<td>Ketoconazole</td>
			<td>Sigma-Aldrich</td>
			<td>K1003</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N-Dimethylformamide</td>
			<td>Acros Organics</td>
			<td>326871000</td>
			<td></td>
		</tr>
		<tr>
			<td>Lithium Acetate</td>
			<td>Sigma-Aldrich</td>
			<td>L4158</td>
			<td></td>
		</tr>
		<tr>
			<td>50% PEG-3350 solution, filter-sterilized</td>
			<td>Sigma-Aldrich</td>
			<td>P-3640</td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose Membrane</td>
			<td>Whatman</td>
			<td>10402091</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm Petri Dish</td>
			<td>Fisher</td>
			<td>875712</td>
			<td></td>
		</tr>
		<tr>
		</tr>
	</tbody>
</table>

<table border="1">
	<tbody>
		<tr>
			<td>5&#39;-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD forward primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-AGAGTCGACTCAGCTA CCTGTGATGCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD reverse primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 forward primer for pGADNOT</td>
		</tr>
		<tr>
			<td>5&#39;-GCGGTCGACTTATTCAGTCA GTAGCTG -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 reverse primer for pGADNOT</td>
		</tr>
		<tr>
			<td>Platinum PCR Supermix</td>
			<td>Invitrogen</td>
			<td>11306-016</td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>our lab</td>
			<td>R0136</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>our lab</td>
			<td>R0138</td>
			<td></td>
		</tr>
		<tr>
			<td>NotI</td>
			<td>our lab</td>
			<td>R0189</td>
			<td></td>
		</tr>
	</tbody>
</table>

reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists

Als ein entscheidender Regulator des Arzneimittelstoffwechsel und Entzündung, Pregnane X-Rezeptor (PXR), spielt eine wichtige Rolle in der Pathophysiologie Krankheit Verknüpfung Stoffwechsel und Entzündungen (z. B. Fettleber) 1,2. Es hat viele Fortschritte bei der Identifizierung von Liganden für PXR-Agonisten, jedoch gibt es begrenzte Beschreibungen arzneimittelähnlichen Antagonisten und ihre Bindungsstellen auf PXR 3,4,5. Ein kritisches Hindernis war die Unfähigkeit, effizient reinigen Protein voller Länge für Strukturuntersuchungen mit Antagonisten obwohl PXR wurde 1998 kloniert und charakterisiert. Unser Labor entwickelt einen neuartigen Hochdurchsatz-Hefe-basierten Zwei-Hybrid-, ein Antagonist, Ketoconazol definieren, Bindungsreste auf PXR 6. Unsere Methode umfasst das Erstellen Mutations Bibliotheken, die die Wirkung der einzelnen Mutationen auf die AF-2 Oberfläche des PXR erwartet, dass mit Ketoconazol interagieren zu retten wäre. Rettung oder &quot;Gain-of-function&quot; second Mutationen vorgenommen, so daß Rückschlüsse auf die genetische Interaktion von Ketoconazol und der Oberflächenrest (e) auf PXR realisierbar werden. So entwickelten wir einen hohen Durchsatz Hefe-Zwei-Hybrid-Bildschirm des PXR Mutanten die Interaktion mit seinen Co-Aktivator, SRC-1. Mit diesem Ansatz, bei dem die Hefe wurde modifiziert, um die Untersuchung des Antimykotikums, Ketoconazol aufnehmen, könnten wir bestimmte Mutationen auf PXR in Klonen nicht auf Ketoconazol binden angereichert demonstrieren. Durch die umgekehrte Logik schließen wir, dass die Original-Reste sind direkte Interaktion Reste mit Ketoconazol. Dieser Test stellt eine neuartige, gefügig genetischen Test zum Screening auf-Antagonist-Bindungsstellen auf Kernrezeptor-Oberflächen. Dieser Assay kann zu jedem Medikament unabhängig von seiner zytotoxischen Potential, Hefe sowie zur zellulären Protein (e), die unter Verwendung von Standardstrukturbiologie oder Proteom-basierte Verfahren nicht untersucht werden können, angewendet werden. Mögliche Fallstricke beinhalten Interpretation der Daten (komplementäre Methoden sinnvoll), Zuverlässigkeitrung auf einzelne Y2H Verfahren, Know-how im Umgang mit Hefe-oder Durchführen Hefe-Zwei-Hybrid-Assays und Assay-Optimierung.

Wir führten einen Test, um zu sehen, ob wir ein farbmetrische Auslesen der Vereinigung von PXR und Steroid-Rezeptor Co-Aktivator-1 (SRC-1) zu erkennen. Da Hefe signifikante Sterol-Produktion, ist früher gezeigt worden, dass die lacZ-Expression in Hefe kann ohne die Notwendigkeit für zusätzliche exogene Liganden induziert werden. Wir fanden, dass lacZ-Expression (blaue Kolonien) ist auch in den Hefestamm mit PXR und SRC-1 transformiert induziert, jedoch gibt es keine Induktion des LacZ-Expression (weiße Kolonien) in...

Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Ketoconazol bindet und antagonisiert Pregnane X-Rezeptor (PXR) Aktivierung. Hefe-Hochdurchsatz-Screening von Mutanten PXR definieren eine einzigartige Region für Ketoconazol verbindlich. Diese Hefe-basierten genetischen Methode entdeckt neue Kernrezeptor-Interaktionen mit Liganden, die mit Oberflächenbindungsstellen zuordnen.

Reverse-Hefe-Zwei-Hybrid-System an Säugetier Nuclear Receptor Rückstände Identifizieren Sie, dass Interagieren Sie mit Liganden und / oder Antagonisten

As a critical regulator of drug metabolism and inflammation, Pregnane X Receptor (PXR), plays an important role in disease pathophysiology linking ...

Research

JoVE Journal

Biology

Proteomics to Identify Proteins Interacting with P2X2 Ligand-Gated Cation Channels

Proteomics, um Proteine ​​interagieren mit P2X2 Ligand-Gated Kationenkanäle Identifizieren

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys ...

Forschung

Biologie

Split-Ubiquitin Based Membrane Yeast Two-Hybrid (MYTH) System: A Powerful Tool For Identifying Protein-Protein Interactions

Split-Ubiquitin Based Membrane Yeast Two-Hybrid MYTH System: A Powerful Tool For Identifying Protein-Protein Interactions

Split-Ubiquitin Basierend Membrane Yeast Two-Hybrid (Mythos) System: Ein wirksames Instrument zur Ermittlung von Protein-Protein-Wechselwirkungen

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

Die Analyse der mRNA Nuclear Export Kinetics in Säugerzellen durch Mikroinjektion

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

RNAi-Screening auf postembryonalen Phänotypen in Identifizieren C elegans</em

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated ...

Modified Yeast-Two-Hybrid System to Identify Proteins Interacting with the Growth Factor Progranulin

Modifizierten Hefe-Zwei-Hybrid-System, um Proteine ​​interagieren mit dem Growth Factor Progranulin Identifizieren

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

siRNA Screening zu Ubiquitin und Ubiquitin-ähnlichen System Regler der biologischen Stoffwechselwege in kultivierten Säugerzellen identifizieren

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Nanogold Labeling of the Yeast Endosomal System for Ultrastructural Analyses

Nanogold Markierung der Hefe Endosomale System für Ultrastrukturanalysen

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

Nachweis Estrogenic Liganden in Körperpflege-Produkte mit einer Hefe Östrogen Bildschirm optimiert für Undergraduate Teaching Labor

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine ...

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain (RTA) Trafficking in Yeast

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain RTA Trafficking in Yeast

Ein einfache Fluoreszenz basierende Reporter Assay zelluläre Komponenten identifizieren erforderlich für Ricin Toxin eine Kette (RTA) Handel mit Hefe

Bacterial and plant A/B toxins exploit the natural trafficking pathways in eukaryotic cells to reach their intracellular target(s) in the cytosol and to ...

A Flow Cytometry-based Assay to Identify Compounds That Disrupt Binding of Fluorescently-labeled CXC Chemokine Ligand 12 to CXC Chemokine Receptor 4

Ein Flow Cytometry-basierte Assay, Verbindungen zu identifizieren, die Bindung von Eindringmittel beschriftet CXC-Chemokin-Liganden 12 an CXC-Chemokin-Rezeptor 4 stören