Name: reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists
Uploaded: 2013-11-15T18:30:00
Description: Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

עבודה זו נתמכה על ידי המכונים הלאומיים לבריאות (NIH) מענקי CA127231 ופרס דיימון רניון קרן החוקר קליני (CI 1502) (לSM). ברצוננו להודות לפרופסור זדנק דבוז&#39;ק מPalacky אוניברסיטת אולומוץ, צ&#39;כיה לתובנה מועילות שלו לדיון בניידות של טכניקה זו למוסד וסטנדרטיזציה של פרוטוקול שלהם.

1. בניית PXR וSRC-1 Fusions בוקטורי שמרים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ההגברה PCR של אדם PXR LBD (107-434 חומצות אמינו) וSRC-1 אורך אנוש מלא (1-1,401 חומצות אמינו). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמש פלסמיד pSG5-hPXR 8 כתבנית PXR LBD, השתמש פלסמיד pCMX-src1 כS...

<ol>
	<li>Kliewer, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+orphan+nuclear+receptor+activated+by+pregnanes+defines+a+novel+steroid+signaling+pathway.">An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway.</a> Cell. 92 (1), 73-82 (1998).</li><li>Blumberg, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+novel+steroid+and+xenobiotic-sensing+nuclear+receptor.">a novel steroid and xenobiotic-sensing nuclear receptor.</a> Genes Dev. 12 (20), 3195-3205 (1998).</li><li>Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+the+'Jekyll+and+Hyde'+Nature+of+PXR:+The+Case+for+Discovering+Antagonists.">Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists.</a> Pharm. Res. 26 (8), 1807-1815 (2009).</li><li>Pondugula, S. R., Mani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pregnane+xenobiotic+receptor+in+cancer+pathogenesis+and+therapeutic+response.">Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response.</a> Cancer Lett. 328 (1), 1-9 (2013).</li><li>Mani, S., Dou, V., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PXR+antagonists+and+implications+for+drug+metabolism.">PXR antagonists and implications for drug metabolism.</a> Drug Metab. Rev. 45 (1), 60-72 (2013).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Yeast-Based+Strategy+Unveils+Antagonist+Binding+Regions+on+the+Nuclear+Xenobiotic+Receptor+PXR.">Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR.</a> J. Biol. Chem. 288 (19), 13655-13668 (2013).</li><li>Hollenberg, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+new+family+of+tissue-specific+basic+helix-loop-helix+proteins+with+a+two-hybrid+system.">Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.</a> Mol. Cell. Biol. 15 (7), 3813-3822 (1995).</li><li>Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+Ras+interacts+directly+with+the+serine/threonine+kinase+Raf.">Mammalian Ras interacts directly with the serine/threonine kinase Raf.</a> Cell. 74 (1), 205-214 (1993).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phytoestrogen+coumestrol+is+a+naturally+occurring+antagonist+of+the+human+pregnane+X+receptor.">The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor.</a> Mol. Endocrinol. 22 (4), 838-857 (2008).</li><li>Kalpana, G. V., Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+homomeric+interactions+of+human+immunodeficiency+virus+type+1+integrase+using+the+yeast+two-hybrid+system.">Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system.</a> Proc. Natl. Acad. Sci. U.S.A. 90 (22), 10593-10597 (1993).</li><li>Hamdi, A., Colas, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeast+two-hybrid+methods+and+their+applications+in+drug+discovery.">Yeast two-hybrid methods and their applications in drug discovery.</a> TiPS. 33 (2), 109-118 (2012).</li><li>Battesti, A., Bouveret, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bacterial+two-hybrid+system+based+on+adenylate+cyclase+reconstitution+in+Escherichia+coli.">The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli.</a> Methods. 58 (4), 325-334 (2012).</li><li>Caufield, J. H., Sakhawalkar, N., Uetz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+and+optimization+of+yeast+two-hybrid+systems.">A comparison and optimization of yeast two-hybrid systems.</a> Methods. 58 (4), 317-324 (2012).</li><li>Albers, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+yeast+two-hybrid+screening+for+nuclear+receptor-interacting+proteins.">Automated yeast two-hybrid screening for nuclear receptor-interacting proteins.</a> Mol. Cell Proteomics. 4 (2), 205-213 (2005).</li><li>Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+role+of+the+orphan+nuclear+receptor+SXR+(steroid+and+xenobiotic+receptor)+in+the+mechanism+of+CYP3A4+inhibition+by+xenobiotics.">Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics.</a> J. Biol. Chem. 277 (36), 32453-32458 (2002).</li><li>Huang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+drug+metabolism+by+blocking+the+activation+of+nuclear+receptors+by+ketoconazole.">Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole.</a> Oncogene. 26 (2), 258-268 (2007).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activated+pregnenolone+X-+receptor+is+a+target+for+ketoconazole+and+Its+analogs.">Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs.</a> Clin. Cancer Res. 13 (8), 2488-2495 (2007).</li><li>Ghannoum, M. A., Rice, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antifungal+agents:+mode+of+action,+mechanisms+of+resistance,+and+correlation+of+these+mechanisms+with+bacterial+resistance.">Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance.</a> Clin. Microbiol. Rev. 12 (4), 501-517 (1999).</li><li>Kaur, R., Bachhawat, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+yeast+multidrug+resistance+pump,+Pdr5p,+confers+reduced+drug+resistance+in+erg+mutants+of+Saccharomyces+cerevisiae.">The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae.</a> Microbiology. 145, 809-818 (1999).</li><li>White, T. C., Marr, K. A., Bowden, R. A., cellular, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical,+cellular,+and+molecular+factors+that+contribute+to+antifungal+drug+resistance.">Clinical, cellular, and molecular factors that contribute to antifungal drug resistance.</a> Clin. Microbiol. Rev. 11 (2), 382-402 (1998).</li><li>Serebriiskii, I. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+peptides,+proteins,+and+drugs+that+selectively+interact+with+protein+targets.">Detection of peptides, proteins, and drugs that selectively interact with protein targets.</a> Genome Res. 12, 1785-1791 (2002).</li><li>Yang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+role+for+PELP1+in+nonandrogenic+activation+of+the+androgen+receptor+in+prostate+cancer.">Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer.</a> Mol Endocrinol. 26 (4), 550-561 (2012).</li><li>Zhan, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+orphan+nuclear+receptor+Nur77+regulates+LKB1+localization+and+activates+AMPK.">The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK.</a> Nat Chem Biol. 8 (11), 897-904 (2012).</li></ol>

ב assay Y2H שונה שלנו, זיהינו שאריות חשובות לאינטראקציות ketoconazole על PXR 6. מאז SRC-1 הוא coactivator (ושובט לתוך וקטור pGADNot), אנחנו גם בדקנו האם SRC-1 יכול להפעיל ביטוי lacZ כאשר משובט למערכת הווקטור הפשה והאם זה הייתי משנה את פרופיל ההפעלה ו / או להשפיע על הדליפות של assay שני היברידי ה?...

Assay השמרים שני ההיברידי (Y2H) נעשה שימוש נרחב כדי לגלות אינטראקציות בין חלבונים ולאחרונה לגילוי של מולקולות קטנות, רומן המשבשות קומפלקסי חלבונים אינטראקציה 7, 8, 9, 10, 11. עם זאת, הגישות קונבנציונליות של assay זה, המשמש לגילוי סמים או &quot;להיטים&quot;, אינן מאפשרות זיהוי של שאריות allosteric אינטראקציה של תרכובות כימיקלים בתוך משטחי חלבונים, שכאשר שינו עדיין אינטראקציה ולאפשר לחקירה של השאריות שינו 11 . ואכן, שיטה (ים) כזה, אם אפשרי לפתח, תאפשר מערכת שמרים צייתנית להערכת תפוקה גבוהה של שאריות האינטראקציה allosteric קריטיות לשיבוש אינטראקציה בין חלבונים. בהקשר של גילוי תרופות, הדרך הישירה ביותר להקים אינטראקציה של תרכובות עם חלבונים תהיה כרוכה בקביעה מבנית (למשל התגבשות של קומפלקס חלבון מעכב). שיטות אלה הן בהצטיינותbersome, להשתמש במשאבים משוכללים וזה לא אפשרי מבחינה טכנית לבצע מחקרים מבניים על כל חלבון. מערכות הקרנת סמים גנטיות צייתניות הוקמו בחיידקים 1, 2 ומערכות מודל אחרות כמו שתי ההיברידי של יונקים. עם זאת, מערכות אלו זקוקות לאופטימיזציה ומערכות חלופיות כמו Y2H עדיין נבדקו ביותר בגילוי תרופות. ישנן מגבלות הכוללות רגישות ואמינות של אינטראקציות בשימוש בשיטות ייחודיות 13 עניים, לעומת זאת, assay Y2H אחד יכול להיות שונה כדי לענות על שאלות ספציפיות בנוגע לשאריות אינטראקציה. בתחום מחקר קולטן גרעיני, Y2H נעשה שימוש כדי להגדיר את חלבוני אינטראקציה 14, לעומת זאת, אינטראקציות חלבון אלה רק לעתים נדירות נעשו שימוש כדי להגדיר את האופי שבו ligands / יריבים אינטראקציה עם מתחמי קולטן חלבונים גרעיניים. לפיכך, המעבדה שלנו התמקדה מאמצים בהגדרת שיטה, במיוחד לחלבוני הקולטן שאינםנוח בקלות לproteomic שיטות מבוססות, שיחשוף ליגנד רומן / אנטגוניסט אינטראקציה שאריות באמצעות פלטפורמת גילוי Y2H מבוססת הפוכה. בהתבסס על הממצא הקודם שלנו שketoconazole משבש PXR וactivator SRC-1, פיתחנו רומן הפוך מערכת Y2H שיאפשר לנו להגדיר ולחקור את שאריות ketoconazole האינטראקציה בPXR 6. השיטה שלנו מבוססת על המאפיינים של חלבון GAL4 שמרים שמורכבת מתחומים להפרדה אחראים להפעלת ה-DNA מחייבת ותעתיק. חלבון PXR LBD מבוטא היתוך לתחום LexA-DNA מחייב (DNA-BD), תוך שיתוף מפעילי אורך המלא SRC-1 (coactivator קולטן סטרואידים 1) חלבונים באים לידי ביטוי כהתכה לתחום הפעלת GAL4 (AD ). אינטראקציה בין PXR וחלבונים היתוך SRC-1 מובילה להפעלת תעתיק של אתרי GAL4 מחייבים המכילים גן כתב β-Lac Z המשתלב בשמרים genomדואר. Ketoconazole, אנטגוניסט PXR, משבש PXR ואינטראקציה SRC-1 15, 16, 17 ואנחנו יכולים לזהות את האינטראקציה של PXR וSRC-1 בנוכחותו או היעדריו של ketoconazole לאחר צביעת מושבות במסננים לפעילות X-gal. עיקרון Y2H מודגם באיור 1 והליך הניסוי מסוכם באיור 2.

<table border="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Yeast Strain CTY10-5d erg3&#916;/erg11&#916;</td>
			<td>Our lab</td>
			<td></td>
			<td>CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3&#916;/erg11&#916;) genes6 .</td>
		</tr>
		<tr>
			<td>YPD Growth Medium</td>
			<td>BD Biosciences</td>
			<td>630409</td>
			<td></td>
		</tr>
		<tr>
			<td>Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate</td>
			<td>BD Biosciences</td>
			<td>233520</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacto Agar</td>
			<td>BD Biosciences</td>
			<td>214010</td>
			<td></td>
		</tr>
		<tr>
			<td>CSM-His/-Leu Complete Supplement Mixture</td>
			<td>MP Biomedicals</td>
			<td>4250-412</td>
			<td></td>
		</tr>
		<tr>
			<td>ONPG (o-Nitrophenyl &#914;-D- Galactopyranoside).</td>
			<td>Sigma-Aldrich</td>
			<td>N1127</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Luria Broth (LB)</td>
			<td>Sigma-Aldrich</td>
			<td>L3022</td>
			<td></td>
		</tr>
		<tr>
			<td>X-Gal</td>
			<td>Fisher</td>
			<td>BP-1615</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicated Salmon Sperm DNA boiled (10 mg/ml)</td>
			<td>Life Technology</td>
			<td>156-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Acros Organics</td>
			<td>61177</td>
			<td></td>
		</tr>
		<tr>
			<td>Ketoconazole</td>
			<td>Sigma-Aldrich</td>
			<td>K1003</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N-Dimethylformamide</td>
			<td>Acros Organics</td>
			<td>326871000</td>
			<td></td>
		</tr>
		<tr>
			<td>Lithium Acetate</td>
			<td>Sigma-Aldrich</td>
			<td>L4158</td>
			<td></td>
		</tr>
		<tr>
			<td>50% PEG-3350 solution, filter-sterilized</td>
			<td>Sigma-Aldrich</td>
			<td>P-3640</td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose Membrane</td>
			<td>Whatman</td>
			<td>10402091</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm Petri Dish</td>
			<td>Fisher</td>
			<td>875712</td>
			<td></td>
		</tr>
		<tr>
		</tr>
	</tbody>
</table>

<table border="1">
	<tbody>
		<tr>
			<td>5&#39;-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD forward primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-AGAGTCGACTCAGCTA CCTGTGATGCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD reverse primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 forward primer for pGADNOT</td>
		</tr>
		<tr>
			<td>5&#39;-GCGGTCGACTTATTCAGTCA GTAGCTG -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 reverse primer for pGADNOT</td>
		</tr>
		<tr>
			<td>Platinum PCR Supermix</td>
			<td>Invitrogen</td>
			<td>11306-016</td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>our lab</td>
			<td>R0136</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>our lab</td>
			<td>R0138</td>
			<td></td>
		</tr>
		<tr>
			<td>NotI</td>
			<td>our lab</td>
			<td>R0189</td>
			<td></td>
		</tr>
	</tbody>
</table>

reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists

כרגולטור קריטי של חילוף חומרים בסמים ודלקת, pregnane X קולטן (PXR), ממלא תפקיד חשוב בפתופיזיולוגיה מחלה המקשר את חילוף החומרים ודלקת (למשל steatosis כבד) 1,2. חל התקדמות רבה בזיהוי של ligands אגוניסט לPXR, לעומת זאת, יש תיאורים מוגבלים של יריבים כמו סמים ואתרי הקישור שלהם על PXR 3,4,5. מכשול קריטי היה חוסר היכולת לטהר את יעילות החלבון באורך מלא ללימודים מבניים עם יריבים למרות שPXR שוכפל ומאופיין ב1998. המעבדה שלנו שפותחה על שמרי תפוקה גבוהה רומן מבוסס assay שני ההיברידי להגדיר אנטגוניסט, ketoconazole של, מחייב שאריות על PXR 6. השיטה שלנו כרוכה ביצירת ספריות מוטאציות שתצלנה את ההשפעה של מוטציות בודדות על פני השטח AF-2 של PXR הצפוי לקיים אינטראקציה עם ketoconazole. הצלה או &quot;רווח של הפונקציה&quot; הערוץמוטציות nd יכולים להתבצע כך שמסקנות לגבי האינטראקציה הגנטית של ketoconazole ושאריות המשטח (ים) בPXR הן ריאלי. לכן, פיתחנו תפוקה גבוהה של שני היברידי שמרי מסך של מוטציות PXR אינטראקציה עם coactivator, SRC-1. שימוש בגישה זו, שבה את השמרים שונה כדי להתאים את המחקר של התרופה נגד פטריות, ketoconazole, אנחנו יכולים להפגין מוטציות ספציפיות על PXR מועשרת בשיבוטים מסוגלים להיקשר ketoconazole. לפי היגיון הפוך, אנו מגיעים למסקנה שהשאריות המקוריות הן שאריות אינטראקציה ישירות עם ketoconazole. assay זה מייצג רומן, assay הגנטי הצייתן למסך לאתרי קישור אנטגוניסט על משטחי קולטן גרעיני. assay זה יכול להיות מיושם על כל תרופה ללא קשר לפוטנציאל ציטוטוקסיות שלה לשמרים, כמו גם לחלבון תאי (ים) שלא ניתן ללמוד באמצעות ביולוגיה מבנית סטנדרטית או שיטות proteomic מבוססות. החסרונות פוטנציאליים כוללים פרשנות של נתונים (שיטות משלימות שימושי), רליאהה בשיטה אחת Y2H, מומחיות בטיפול בשמרים או ביצוע מבחני שני היברידי שמרים, וassay אופטימיזציה.

ביצענו assay כדי לראות אם אנחנו יכולים לזהות readout colorimetric של העמותה של PXR וקולטן סטרואידי coactivator-1 (SRC-1). מאז שמרים יש ייצור סטרולים משמעותי, זה כבר בעבר הראה כי ביטוי lacZ בשמרים יכול להיגרם ללא הצורך יגנד אקסוגניים נוסף. מצאנו כי ביטוי lacZ (מושבות כחולות) הוא גם מושרה בזן השמרי...

Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Ketoconazole נקשר ולעוינות pregnane X קולטן הפעלה (PXR). מסכי תפוקת שמרים גבוהים של מוטציות PXR להגדיר אזור ייחודי לketoconazole מחייב. שיטה גנטית המבוסס על שמרים זה מגלה אינטראקציות רצפטור הגרעיני רומן עם ligands שמקשר עם אתרי פני השטח מחייבים.

הפוך מערכת דו היברידית שמרים לזהות יונקים הגרעיני קולטן שאריות כי אינטראקציה עם ligands ו / או יריבים

As a critical regulator of drug metabolism and inflammation, Pregnane X Receptor (PXR), plays an important role in disease pathophysiology linking ...

Research

JoVE Journal

Biology

Proteomics to Identify Proteins Interacting with P2X2 Ligand-Gated Cation Channels

Proteomics כדי לזהות חלבונים אינטראקציה עם ליגנד P2X2-מגודרת ערוצי קטיון

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys ...

Split-Ubiquitin Based Membrane Yeast Two-Hybrid (MYTH) System: A Powerful Tool For Identifying Protein-Protein Interactions

Split-Ubiquitin Based Membrane Yeast Two-Hybrid MYTH System: A Powerful Tool For Identifying Protein-Protein Interactions

Split-יוביקוויטין ממברנה שמרים בהתבסס שני היברידי (מיתוס) מערכת: כלי רב עוצמה עבור זיהוי חלבונים אינטראקציות

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

אנליזה של קינטיקה mRNA גרעיני ייצוא בתאי יונקים ידי Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

RNAi הקרנת לזהות פנוטיפים Postembryonic ב ג elegans</em

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated ...

Modified Yeast-Two-Hybrid System to Identify Proteins Interacting with the Growth Factor Progranulin

השתנה שמרים-Two-Hybrid System כדי לזהות חלבונים אינטראקציה עם גורם הגדילה Progranulin

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

הקרנת siRNA לזיהוי יוביקוויטין ורגולטורים מערכת דמויות יוביקוויטין של מסלולים ביולוגיים בתאי יונקים בתרבית

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Nanogold Labeling of the Yeast Endosomal System for Ultrastructural Analyses

Nanogold תיוג של מערכת endosomal שמרים לניתוח Ultrastructural

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

זיהוי ליגנדים אסטרוגניים במוצרי טיפוח אישי באמצעות של שמרים אסטרוגן מסך ממוטב עבור המעבדה הוראה לתואר ראשון

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine ...

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain (RTA) Trafficking in Yeast

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain RTA Trafficking in Yeast

וזמינותו כתב המבוסס על ידי קרינה פלואורסצנטית פשוט לזהות את מרכיבי התא הדרושות רעלן ריצין שרשרת (RTA) סחר בבני אדם שמרים

Bacterial and plant A/B toxins exploit the natural trafficking pathways in eukaryotic cells to reach their intracellular target(s) in the cytosol and to ...