Name: reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists
Uploaded: 2013-11-15T18:30:00
Description: Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

This work was supported by National Institutes of Health (NIH) Grants CA127231 and The Damon Runyon Foundation Clinical Investigator Award (CI 1502) (to S.M). We would like to thank Professor Zdenek Dvorak from Palacky University Olomouc, Czech Republic for his helpful insights into discussing portability of this technique to their institution and standardization of protocol.

1. Construction of PXR and SRC-1 Fusions in Yeast Vectors
<ol>
	<li>PCR amplification of Human PXR LBD (107-434 amino acids) and Human SRC-1 full length (1-1401 amino acids).
	<ol>
		<li>Use pSG5-hPXR plasmid8 as PXR LBD template, use pCMX-SRC1 plasmid as SRC-1 templates.</li>
		<li>Thaw PCR SuperMix, DNA templates and primers (see Materials), keep them on ice.</li>
		<li>Add 0.25 &#956;g/&#956;l DNA template 1 &#956;l, 10 mM primer pairs 2 &#956;l each, PCR SuperMix 45 &#956;l and add H2O to brin...

<ol>
	<li>Kliewer, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+orphan+nuclear+receptor+activated+by+pregnanes+defines+a+novel+steroid+signaling+pathway.">An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway.</a> Cell. 92 (1), 73-82 (1998).</li><li>Blumberg, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+novel+steroid+and+xenobiotic-sensing+nuclear+receptor.">a novel steroid and xenobiotic-sensing nuclear receptor.</a> Genes Dev. 12 (20), 3195-3205 (1998).</li><li>Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+the+'Jekyll+and+Hyde'+Nature+of+PXR:+The+Case+for+Discovering+Antagonists.">Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists.</a> Pharm. Res. 26 (8), 1807-1815 (2009).</li><li>Pondugula, S. R., Mani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pregnane+xenobiotic+receptor+in+cancer+pathogenesis+and+therapeutic+response.">Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response.</a> Cancer Lett. 328 (1), 1-9 (2013).</li><li>Mani, S., Dou, V., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PXR+antagonists+and+implications+for+drug+metabolism.">PXR antagonists and implications for drug metabolism.</a> Drug Metab. Rev. 45 (1), 60-72 (2013).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Yeast-Based+Strategy+Unveils+Antagonist+Binding+Regions+on+the+Nuclear+Xenobiotic+Receptor+PXR.">Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR.</a> J. Biol. Chem. 288 (19), 13655-13668 (2013).</li><li>Hollenberg, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+new+family+of+tissue-specific+basic+helix-loop-helix+proteins+with+a+two-hybrid+system.">Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.</a> Mol. Cell. Biol. 15 (7), 3813-3822 (1995).</li><li>Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+Ras+interacts+directly+with+the+serine/threonine+kinase+Raf.">Mammalian Ras interacts directly with the serine/threonine kinase Raf.</a> Cell. 74 (1), 205-214 (1993).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phytoestrogen+coumestrol+is+a+naturally+occurring+antagonist+of+the+human+pregnane+X+receptor.">The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor.</a> Mol. Endocrinol. 22 (4), 838-857 (2008).</li><li>Kalpana, G. V., Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+homomeric+interactions+of+human+immunodeficiency+virus+type+1+integrase+using+the+yeast+two-hybrid+system.">Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system.</a> Proc. Natl. Acad. Sci. U.S.A. 90 (22), 10593-10597 (1993).</li><li>Hamdi, A., Colas, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeast+two-hybrid+methods+and+their+applications+in+drug+discovery.">Yeast two-hybrid methods and their applications in drug discovery.</a> TiPS. 33 (2), 109-118 (2012).</li><li>Battesti, A., Bouveret, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bacterial+two-hybrid+system+based+on+adenylate+cyclase+reconstitution+in+Escherichia+coli.">The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli.</a> Methods. 58 (4), 325-334 (2012).</li><li>Caufield, J. H., Sakhawalkar, N., Uetz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+and+optimization+of+yeast+two-hybrid+systems.">A comparison and optimization of yeast two-hybrid systems.</a> Methods. 58 (4), 317-324 (2012).</li><li>Albers, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+yeast+two-hybrid+screening+for+nuclear+receptor-interacting+proteins.">Automated yeast two-hybrid screening for nuclear receptor-interacting proteins.</a> Mol. Cell Proteomics. 4 (2), 205-213 (2005).</li><li>Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+role+of+the+orphan+nuclear+receptor+SXR+(steroid+and+xenobiotic+receptor)+in+the+mechanism+of+CYP3A4+inhibition+by+xenobiotics.">Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics.</a> J. Biol. Chem. 277 (36), 32453-32458 (2002).</li><li>Huang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+drug+metabolism+by+blocking+the+activation+of+nuclear+receptors+by+ketoconazole.">Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole.</a> Oncogene. 26 (2), 258-268 (2007).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activated+pregnenolone+X-+receptor+is+a+target+for+ketoconazole+and+Its+analogs.">Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs.</a> Clin. Cancer Res. 13 (8), 2488-2495 (2007).</li><li>Ghannoum, M. A., Rice, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antifungal+agents:+mode+of+action,+mechanisms+of+resistance,+and+correlation+of+these+mechanisms+with+bacterial+resistance.">Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance.</a> Clin. Microbiol. Rev. 12 (4), 501-517 (1999).</li><li>Kaur, R., Bachhawat, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+yeast+multidrug+resistance+pump,+Pdr5p,+confers+reduced+drug+resistance+in+erg+mutants+of+Saccharomyces+cerevisiae.">The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae.</a> Microbiology. 145, 809-818 (1999).</li><li>White, T. C., Marr, K. A., Bowden, R. A., cellular, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical,+cellular,+and+molecular+factors+that+contribute+to+antifungal+drug+resistance.">Clinical, cellular, and molecular factors that contribute to antifungal drug resistance.</a> Clin. Microbiol. Rev. 11 (2), 382-402 (1998).</li><li>Serebriiskii, I. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+peptides,+proteins,+and+drugs+that+selectively+interact+with+protein+targets.">Detection of peptides, proteins, and drugs that selectively interact with protein targets.</a> Genome Res. 12, 1785-1791 (2002).</li><li>Yang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+role+for+PELP1+in+nonandrogenic+activation+of+the+androgen+receptor+in+prostate+cancer.">Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer.</a> Mol Endocrinol. 26 (4), 550-561 (2012).</li><li>Zhan, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+orphan+nuclear+receptor+Nur77+regulates+LKB1+localization+and+activates+AMPK.">The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK.</a> Nat Chem Biol. 8 (11), 897-904 (2012).</li></ol>

In our modified Y2H assay, we have identified important residues for ketoconazole interactions on PXR6. Since SRC-1 is a coactivator (and was cloned into the pGADNot vector), we also tested whether SRC-1 could activate lacZ expression when cloned into the pSH vector system and whether this would change the activation profile and/or affect the leakiness of the yeast two-hybrid assay. Using our redesigned plasmids we performed two-hybrid assays in erg3&#916;/erg11&#916; yeast. As before, we sho...

खमीर दो संकर (Y2H) परख व्यापक रूप से प्रोटीन, प्रोटीन बातचीत की खोज करने के लिए प्रयोग किया जाता है और हाल ही में प्रोटीन, प्रोटीन बातचीत परिसरों 7, 8, 9, 10, 11 को बाधित कि उपन्यास छोटे अणुओं की खोज के लिए. हालांकि, इस परख के परंपरागत तरीके, दवाओं की खोज या &#39;हिट&#39; के लिए इस्तेमाल किया, प्रोटीन, प्रोटीन सतहों के भीतर रसायन यौगिकों के allosteric बातचीत अवशेषों का पता लगाने के लिए अनुमति नहीं देते हैं कि बातचीत और बदल अवशेष 11 से पूछताछ के लिए अनुमति अभी भी बदल जब . दरअसल, इस तरह के एक विधि (एस), विकसित करना संभव है, तो प्रोटीन, प्रोटीन बातचीत विघटन के लिए महत्वपूर्ण allosteric बातचीत अवशेषों के उच्च throughput मूल्यांकन के लिए एक विनयशील खमीर प्रणाली सक्षम होगा. दवाओं की खोज के संदर्भ में, प्रोटीन के साथ यौगिकों की बातचीत की स्थापना के लिए सबसे सीधा रास्ता संरचनात्मक निर्धारण (प्रोटीन अवरोध करनेवाला परिसर के जैसे crystalization) शामिल होगा. इन विधियों सह रहे हैंbersome, व्यापक संसाधनों का उपयोग करें और यह हर प्रोटीन पर संरचनात्मक अध्ययन को करने के लिए तकनीकी रूप से संभव नहीं है. विनयशील आनुवंशिक दवा स्क्रीनिंग सिस्टम बैक्टीरिया 1, 2 और स्तनधारी दो संकर जैसे अन्य मॉडल प्रणाली में स्थापित किया गया है. हालांकि, इन प्रणालियों अनुकूलन की जरूरत है और Y2H जैसे वैकल्पिक सिस्टम अभी भी सबसे दवाओं की खोज में परीक्षण किया गया. गरीब संवेदनशीलता और विलक्षण विधियों 13 का उपयोग करते हुए बातचीत की विश्वसनीयता भी शामिल है कि सीमाएं हैं, हालांकि, एक भी Y2H परख बातचीत अवशेषों के बारे में विशिष्ट सवालों के जवाब देने के लिए संशोधित किया जा सकता है. परमाणु रिसेप्टर अनुसंधान के क्षेत्र में, Y2H बातचीत प्रोटीन 14 को परिभाषित करने के लिए इस्तेमाल किया गया है, हालांकि, इन प्रोटीन बातचीत शायद ही कभी / विरोधी परमाणु रिसेप्टर प्रोटीन परिसरों के साथ बातचीत ligands जिसमें प्रकृति को परिभाषित करने के लिए इस्तेमाल किया गया है. इस प्रकार, हमारी प्रयोगशाला विशेष रूप से नहीं कर रहे हैं कि रिसेप्टर प्रोटीन के लिए एक विधि को परिभाषित करने के प्रयासों पर ध्यान केंद्रितआधारित विधियों प्रोटिओमिक आसानी से उत्तरदायी, कि एक रिवर्स Y2H आधारित खोज मंच का उपयोग अवशेषों बातचीत उपन्यास ligand / प्रतिपक्षी पता लगाना होगा. Ketoconazole PXR और इसके उत्प्रेरक एसआरसी 1 बाधित कि हमारे पिछले खोज के आधार पर, हम एक उपन्यास PXR 6 पर ketoconazole बातचीत अवशेषों को परिभाषित करने और पूछताछ करने के लिए सक्षम है कि Y2H प्रणाली रिवर्स विकसित की है. हमारे विधि डीएनए बाध्यकारी और transcriptional सक्रियण के लिए जिम्मेदार वियोज्य डोमेन के होते हैं कि खमीर GAL4 प्रोटीन के गुणों पर आधारित है. पूरी लंबाई सह activators एसआरसी -1 (स्टेरॉयड रिसेप्टर coactivator 1) प्रोटीन GAL4 सक्रियण डोमेन के लिए fusions के रूप में व्यक्त कर रहे हैं, जबकि PXR LBD प्रोटीन (, Lexa डीएनए बाध्यकारी डोमेन (डीएनए बी) को एक संलयन के रूप में व्यक्त किया जाता है ई. ). PXR और एसआरसी 1 संलयन प्रोटीन के बीच बातचीत खमीर genom में एकीकृत है कि β-लैक जेड रिपोर्टर जीन युक्त GAL4 बाध्यकारी साइटों के transcriptional सक्रियण की ओर जाता हैई. Ketoconazole, एक PXR प्रतिपक्षी, PXR और एसआरसी 1 बातचीत 15, 16, 17 को बाधित और हम एक्स लड़की गतिविधि के लिए फिल्टर पर कालोनियों धुंधला के बाद उपस्थिति या ketoconazole के अभाव में PXR की बातचीत का पता लगाने और एसआरसी 1 कर सकते हैं. Y2H के सिद्धांत चित्र 1 में सचित्र है और प्रयोगात्मक प्रक्रिया चित्रा 2 में संक्षेप.

<table border="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Yeast Strain CTY10-5d erg3&#916;/erg11&#916;</td>
			<td>Our lab</td>
			<td></td>
			<td>CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3&#916;/erg11&#916;) genes6 .</td>
		</tr>
		<tr>
			<td>YPD Growth Medium</td>
			<td>BD Biosciences</td>
			<td>630409</td>
			<td></td>
		</tr>
		<tr>
			<td>Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate</td>
			<td>BD Biosciences</td>
			<td>233520</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacto Agar</td>
			<td>BD Biosciences</td>
			<td>214010</td>
			<td></td>
		</tr>
		<tr>
			<td>CSM-His/-Leu Complete Supplement Mixture</td>
			<td>MP Biomedicals</td>
			<td>4250-412</td>
			<td></td>
		</tr>
		<tr>
			<td>ONPG (o-Nitrophenyl &#914;-D- Galactopyranoside).</td>
			<td>Sigma-Aldrich</td>
			<td>N1127</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Luria Broth (LB)</td>
			<td>Sigma-Aldrich</td>
			<td>L3022</td>
			<td></td>
		</tr>
		<tr>
			<td>X-Gal</td>
			<td>Fisher</td>
			<td>BP-1615</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicated Salmon Sperm DNA boiled (10 mg/ml)</td>
			<td>Life Technology</td>
			<td>156-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Acros Organics</td>
			<td>61177</td>
			<td></td>
		</tr>
		<tr>
			<td>Ketoconazole</td>
			<td>Sigma-Aldrich</td>
			<td>K1003</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N-Dimethylformamide</td>
			<td>Acros Organics</td>
			<td>326871000</td>
			<td></td>
		</tr>
		<tr>
			<td>Lithium Acetate</td>
			<td>Sigma-Aldrich</td>
			<td>L4158</td>
			<td></td>
		</tr>
		<tr>
			<td>50% PEG-3350 solution, filter-sterilized</td>
			<td>Sigma-Aldrich</td>
			<td>P-3640</td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose Membrane</td>
			<td>Whatman</td>
			<td>10402091</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm Petri Dish</td>
			<td>Fisher</td>
			<td>875712</td>
			<td></td>
		</tr>
		<tr>
		</tr>
	</tbody>
</table>

<table border="1">
	<tbody>
		<tr>
			<td>5&#39;-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD forward primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-AGAGTCGACTCAGCTA CCTGTGATGCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD reverse primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 forward primer for pGADNOT</td>
		</tr>
		<tr>
			<td>5&#39;-GCGGTCGACTTATTCAGTCA GTAGCTG -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 reverse primer for pGADNOT</td>
		</tr>
		<tr>
			<td>Platinum PCR Supermix</td>
			<td>Invitrogen</td>
			<td>11306-016</td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>our lab</td>
			<td>R0136</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>our lab</td>
			<td>R0138</td>
			<td></td>
		</tr>
		<tr>
			<td>NotI</td>
			<td>our lab</td>
			<td>R0189</td>
			<td></td>
		</tr>
	</tbody>
</table>

reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists

दवा चयापचय और सूजन के एक महत्वपूर्ण नियामक के रूप में, Pregnane एक्स रिसेप्टर (PXR), चयापचय और सूजन (जैसे यकृत steatosis) 1,2 जोड़ने रोग pathophysiology में एक महत्वपूर्ण भूमिका निभाता है. PXR के लिए agonist ligands की पहचान में बहुत प्रगति हुई है, हालांकि, दवा की तरह गरम और PXR 3,4,5 पर उनके बाध्यकारी साइटों के सीमित वर्णन कर रहे हैं. एक महत्वपूर्ण बाधा कुशलता PXR 1998 में क्लोन और विशेषता थी कि इस तथ्य के बावजूद विरोधी के साथ संरचनात्मक अध्ययन के लिए पूर्ण लंबाई प्रोटीन को शुद्ध करने में असमर्थता किया गया है. हमारी प्रयोगशाला PXR 6 पर अवशेषों बंधन, एक विरोधी, ketoconazole के परिभाषित करने के लिए आधारित एक उपन्यास उच्च throughput खमीर दो संकर परख विकसित की है. हमारे विधि ketoconazole के साथ बातचीत करने की उम्मीद PXR की वायुसेना -2 सतह पर एक परिवर्तन के प्रभाव बचाव होता है कि उत्परिवर्तनीय पुस्तकालयों का निर्माण शामिल है. बचाव या &quot;लाभ के समारोह&quot; Secoएन डी म्यूटेशन PXR पर ketoconazole की आनुवंशिक बातचीत और सतह छाछ (ओं) के बारे में निष्कर्ष संभव है कि इस तरह बनाया जा सकता है. इस प्रकार, हम अपने coactivator, एसआरसी-1 के साथ बातचीत PXR म्यूटेंट के एक उच्च throughput दो संकर खमीर स्क्रीन विकसित की है. खमीर रोधी दवा, ketoconazole के अध्ययन को समायोजित करने के लिए संशोधित किया गया था जिसमें इस दृष्टिकोण का उपयोग करना, हम ketoconazole करने के लिए बाध्य करने में असमर्थ क्लोन में समृद्ध PXR पर विशिष्ट परिवर्तन का प्रदर्शन कर सकता. रिवर्स तर्क से, हम मूल अवशेषों ketoconazole के साथ सीधी बातचीत के अवशेष हैं कि समाप्त. यह परख एक उपन्यास, परमाणु रिसेप्टर सतहों पर प्रतिपक्षी बाध्यकारी साइटों के लिए स्क्रीन को विनयशील आनुवंशिक परख का प्रतिनिधित्व करता है. यह परख खमीर करने के साथ ही मानक संरचनात्मक जीव विज्ञान या प्रोटिओमिक आधारित विधियों का उपयोग कर अध्ययन नहीं किया जा सकता कि सेलुलर प्रोटीन (ओं) को परवाह किए बिना अपने साइटोटोक्सिक क्षमता के किसी भी दवा के लिए लागू किया जा सकता है. संभावित नुकसान डेटा की व्याख्या (पूरक के तरीकों उपयोगी), धर्म में शामिलएकल Y2H विधि, खमीर से निपटने या खमीर दो संकर assays के प्रदर्शन में विशेषज्ञता, और परख अनुकूलन पर मंजूरी.

We performed an assay to see if we could detect a colorimetric readout of the association of PXR and steroid receptor coactivator-1 (SRC-1). Since yeast has significant sterol production, it has previously been shown that lacZ expression in yeast can be induced without the need for additional exogenous ligand. We found that lacZ expression (blue colonies) is also induced in the yeast strain transformed with PXR and SRC-1; however, there is no induction of LacZ expression (white colonies) in yeast transformed with empty v...

Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Ketoconazole binds to and antagonizes Pregnane X Receptor (PXR) activation. Yeast high throughput screens of PXR mutants define a unique region for ketoconazole binding. This yeast-based genetic method discovers novel nuclear receptor interactions with ligands that associate with surface binding sites.

स्तनधारी परमाणु रिसेप्टर अवशेष की पहचान के लिए खमीर दो संकर प्रणाली है कि रिवर्स ligands और / या गरम के साथ बातचीत

As a critical regulator of drug metabolism and inflammation, Pregnane X Receptor (PXR), plays an important role in disease pathophysiology linking ...

Research

JoVE Journal

Biology

Proteomics to Identify Proteins Interacting with P2X2 Ligand-Gated Cation Channels

प्रोटिओमिक्स P2X2 ligand-gated कटियन चैनल के साथ बातचीत प्रोटीन की पहचान

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys ...

Split-Ubiquitin Based Membrane Yeast Two-Hybrid (MYTH) System: A Powerful Tool For Identifying Protein-Protein Interactions

Split-Ubiquitin Based Membrane Yeast Two-Hybrid MYTH System: A Powerful Tool For Identifying Protein-Protein Interactions

भाजित Ubiquitin आधार झिल्ली खमीर (मिथक) दो - हाइब्रिड सिस्टम: प्रोटीन, प्रोटीन बातचीत की पहचान करने के लिए एक शक्तिशाली उपकरण

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

MRNA परमाणु निर्यात कैनेटीक्स के Microinjection द्वारा स्तनधारी कोशिकाओं में विश्लेषण

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

आरएनएआई स्क्रीनिंग में Postembryonic phenotypes पहचानें सी. एलिगेंस</em

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated ...

Modified Yeast-Two-Hybrid System to Identify Proteins Interacting with the Growth Factor Progranulin

संशोधित खमीर दो हाइब्रिड ग्रोथ फैक्टर progranulin के साथ बातचीत प्रोटीन की पहचान प्रणाली

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

संवर्धित स्तनधारी कोशिकाओं में जैविक रास्ते की Ubiquitin और ubiquitin की तरह सिस्टम नियामकों की पहचान siRNA स्क्रीनिंग

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Nanogold Labeling of the Yeast Endosomal System for Ultrastructural Analyses

Ultrastructural विश्लेषण के लिए खमीर endosomal प्रणाली की Nanogold लेबल

Endosomes are one of the major membrane sorting checkpoints in eukaryotic cells and they regulate recycling or destruction of proteins mostly from the ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

एक खमीर एस्ट्रोजन स्क्रीन स्नातक शिक्षण प्रयोगशाला के लिए अनुकूलित का उपयोग कर व्यक्तिगत देखभाल उत्पादों में एस्ट्रोजन लाइगैंडों का पता लगाने

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine ...

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain (RTA) Trafficking in Yeast

A Simple Fluorescence-based Reporter Assay to Identify Cellular Components Required for Ricin Toxin A Chain RTA Trafficking in Yeast

एक साधारण प्रतिदीप्ति-रिपोर्टर परख सेलुलर घटकों की पहचान करने के लिए Ricin विष के लिए आवश्यक एक श्रृंखला (आरटीए) खमीर में तस्करी

Bacterial and plant A/B toxins exploit the natural trafficking pathways in eukaryotic cells to reach their intracellular target(s) in the cytosol and to ...

A Flow Cytometry-based Assay to Identify Compounds That Disrupt Binding of Fluorescently-labeled CXC Chemokine Ligand 12 to CXC Chemokine Receptor 4

एक प्रवाह Cytometry-परख की पहचान करने के लिए यौगिक यौगिकों कि बाधा फ्लोरोसेंट की बाध्यकारी-लेबल CXC Chemokine Ligand 12 करने के लिए CXC Chemokine रिसेप्टर 4