Name: rapid synthesis and screening of chemically activated transcription factors with gfp-based reporters
Uploaded: 2013-11-26T20:00:00
Duration: 9 min 22 s
Description: Watch this Scientific Journal Video about Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters at JoVE.com

RSM erkent financiering uit de NSF Graduate Research Fellowship. MBN erkent financiering van een Lewis-Sigler Fellowship en de begiftigd gave van Peter Lewis. DB erkent financiering van de NIH (GM046406) het Nationale Instituut van Algemene Medische Wetenschappen Center for Quantitative Biology (GM071508). Wij erkennen Christina DeCoste voor hulp bij flowcytometrie experimenten.

Figuur 2 geeft een schematische weergave van protocol secties 1-3. 1. Creatie van ATFs <ol><li> Maak primers voor PCR amplificeren DNA-bindende domein van belang. Homologie de ACT1 promotor en hormoonreceptor (zoals beschreven in de figuren 3 en 4) wordt toegevoegd via PCR correcte recombinatie in de stam yMN15 vergemakkelijken. </li><li> PCR versterken DBD van belang met behulp van een high fidelity polymerase. </li><li> Transformeren&gt; 1 ug gezuiverd PCR product in gist met de lithiumacetaat werkwijze 13. </li><li> Na transformatie, spin-cellen op topsnelheid gedurende 15 sec in microcentrifuge en verwijder transformatie mix. </li><li> Resuspendeer in ~ 200 pi steriel water en plaat op YPD. </li><li> De volgende dag replica plaat uit YPD op 5-FOA-platen (5-FOA platen zijn zoals beschreven in de Cold Spring Harbor Gist Manual) 13. </li><li> Laat groei voor 2-4 degen, en restreak minstens 5-10 kolonies op YPD. Voer een kolonie PCR met de primers in Tabel 1 en sequentie integratie verifiëren. </li></ol> 2. Creatie van ATF plasmide Reporter <ol><li> Bepaal de bindingsplaats van de ATF (meest waarschijnlijk uit de literatuur). </li><li> Bestel de gewenste binding regio als oligo (of Ultramers, indien nodig). Bestel onderwerp en onderstrengen correcte overhangen voor NotI en XbaI zoals getoond in Tabel 2. </li><li> Verdun oligo equimolaire concentraties (100 uM). </li><li> Fosforyleren met T4 Polynucleotide Kinase en vervolgens gloeien in een thermocycler. De reactieomstandigheden zijn in Tabel 3. </li><li> Digest ~ 1-2 ug pMN8 met Notl-HF en Xbal gedurende 1 uur bij 37 ° C (reactieomstandigheden in tabel 4). </li><li> Gel zuiveren de ruggengraat band. </li><li> Verdun het gezuiverde ruggengraat van 10 ng / ul. </li><li> Verdun de double-stranded, fosforylated bindingsplaats aan de molaire concentratie van backbone 5x per pl. </li><li> Met T4 DNA Ligase, ligeren de bindingsplaatsen in de hoofdketen gedigereerd bij kamertemperatuur gedurende 30 min (tabel 5). </li><li> Voor transformatie voeg halve ligatiereactie 50 gl standaard chemisch competente Escherichia coli zoals XL1-Blue of DH5-alfa. </li><li> Heat shock cellen gedurende 45 seconden in een 42 ° C waterbad en plaats op ijs gedurende 2 minuten. </li><li> Voeg 900 ul van SOC medium tot transformatie reactie. </li><li> Groeien bij 37 ° C gedurende 1 uur op een roller trommel. </li><li> Verspreid 100-200 pi cellen per LB + AMP (100 ug / ml) plaat en incubeer overnacht. </li><li> Grow up E. coli in LB + AMP vloeistof en oogst plasmide-DNA. Sequence controleren nieuwe reporter plasmide uit ligatie kolonies met behulp van de primer 5&#39;-GTACCTTATATTGAATTTTC-3 &#39;. </li><li> Transformeren nieuwe reporter plasmide in-ATF die gist bevatten strain van afdeling 1 gebruik lithiumacetaat transformatie. </li></ol> 3. Kwantificeren van de Effect van ATF Inductie op genexpressie met behulp van GFP Reporter Voorbereiding van de monsters: <ol><li> Maak 25 mM β-estradiol voorraad (10 ml ethanol + 0,0681 g β-estradiol). Koel bewaren. </li><li> Groeien ATF + Reporter-bevattende stam overnacht in 5 ml SC-URA. </li><li> Verkrijgen negen 250 ml schud kolven en voeg 25 ml SC-URA aan elk. </li><li> Voeg 0 nM, 0,1 nM, 1 nM, 10 nM, 100 nM, 1 pM of 10 pM β-oestradiol. Dit is het gemakkelijkst door het maken van 10-voudige seriële verdunningen van de 25 mM β-estradiol voorraad. Voor een uiteindelijke concentratie van 10 uM β-oestradiol, voeg 10 ul van de 25 mM β-oestradiol voorraad 25 ml SC-URA. </li><li> Voeg 125 ul van overnachtcultures op flesjes (1:200 verdunning). </li><li> Voor de 2 resterende kolven, te enten met een constitutieve GFP producerende strain en een stam ontbreekt GFP. Deze zijn nodig voor het kalibreren van de stroom cytometer. </li><li> Schudden bij 200 rpm bij 30 ° C gedurende 12-18 uur. Opmerking: De optimale incubatietijd wordt bepaald door het identificeren wanneer GFP inductie niet meer verandert na toevoeging van β-oestradiol. </li><li> Neem 500 pi van elke cultuur en spin down in afzonderlijke 1,7 ml microcentrifugebuisjes. </li><li> Aspireren SC-URA. </li><li> Was eenmaal in 1 ml PBS +0,1% Tween-20 en aspireren. </li><li> Voeg 1 ml PBS +0,1% Tween-20 en resuspendeer. </li><li> Voeg 1 ml PBS +0,1% Tween-20 Falcon buizen. </li><li> Voeg de geresuspendeerde cellen 5 ml buisjes (eindvolume = 2 ml) (kan worden opgeslagen bij 4 ° C gedurende enkele dagen). </li><li> Optioneel: ultrasone trillingen cellen te lichtvaardig verbreken elke samengeklonterd cellen. Flowcytometrieanalyse: Overzicht: De fluorescentie van 10.000-100.000 cellen wordt meestal geanalyseerd per monster. Gegevens kunnen in FlowJo of met behulp van aangepaste scripts in MATLAB of verwerkt wordenR. Zorg ervoor dat spanning van de GFP kanaal kalibreren met GFP positieve en negatieve controles. Zodra de FCS bestanden zijn uitgevoerd, een script, zoals die in figuur 6 samen met de functie fca_readfcs ( <a href="http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader">http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader</a> kunnen) worden gebruikt voor het verwerken van de gegevens. </li><li> Voer flowcytometrie. <ol><li> Gebruik voorwaartse verstrooiing (FSC) en zijwaartse verstrooiing (SSC) om gistcellen te identificeren. </li><li> Stel het debiet te ~ 3000 cellen / sec. </li><li> Meet GFP (FITC kanaal). </li><li> Zodra de gegevens zijn verzameld, de export. FCS bestanden </li></ol></li><li> Laad MATLAB. </li><li> Verplaats de. FCS bestanden, fcs_readfcs.m, en een script vergelijkbaar met die van figuur 6, naar dezelfde map. </li><li> Verander de huidige werkmap naar de map met de gegevens en scripts. </li><li> Voer het script uit figuur 6 (let op: delegende is handmatig ingevoerd om te produceren wat zien in figuur 7). </li></ol> 4. Kwantificeren van de Effect van ATF Inductie op celgroei <ol><li> Uit bevroren voorraden, streak uit zowel (1) een-ATF met stam en (2) een-ATF ontbreekt stam (zoals yMN15) op aparte YPD platen. </li><li> Na 2 dagen van groei, te enten aparte cultuur buisjes met 5 ml YPD vloeistof met elke stam en groeien &#39;s nachts bij 30 ° C. </li><li> Voer 10-voudige seriële verdunningen van een 0,25 mM β-oestradiol voorraadoplossing tot 10.000-voudig (0,025 uM β-oestradiol) in 100% ethanol. </li><li> Voeg 40 ul van &#39;s nachts culturen tot 10 ml YPD vloeistof (1-250 verdunning). </li><li> Voor elke stam, voeg 96 ul verdunde cellen aan 18 putjes van een 96-wells plaat. </li><li> Voeg 4 ul van β-oestradiol aan de cellen. Een essentieel punt is om ervoor te zorgen dat elk putje heeft dezelfde totale hoeveelheid ethanol. (U kunt ook een mo<html> re geconcentreerde voorraadoplossing van β-oestradiol kunnen worden en vervolgens verdund tot het punt het effect van ethanol op de groei niet meetbaar). </li><li> Voer in drievoud. Drie van de putjes voor elke stam moet alleen ethanol-controles. </li><li> Bedek de plaat met 96 putjes gas permeabel membraan. </li><li> Monitor groei (OD 600) in plaat-lezer. </li><li> Kwantificeer de groei met behulp van een aantal standaard werkwijzen zoals het vinden van de maximale helling. Opmerking: We hebben goed succes met het open source softwarepakket Grofit 14, die in de R programmeeromgeving loopt gehad Het is vermeldenswaard dat, terwijl de groeipercentages berekend op basis van 96-well plaat assays in vergelijking met (25 ml culturen)-flessen te schudden. zijn niet noodzakelijk (zowel door verschillen in fysiologie en instrumentatie) hebben waargenomen dat de relatieve groeisnelheid vergelijkbaar (hoewel dit niet altijd het geval kan zijn). </li></ol>TLE &quot;&gt; 5. Maak Inducible Genomic Allelen <ol><li> Verkrijgen pMN10, een noncentromeric plasmide met de ATF-responsieve promotor uit pMN8 gefuseerd met KanMX (in tegengestelde richting). </li><li> Restrictiedigest de vector backbone en gel extract zoals in deel 2. </li><li> Gloeien, fosforylering en ligeren oligo&#39;s die geschikte bindingsplaatsen zoals beschreven in paragraaf 2. </li><li> Sequence controleren. Dit plasmide zal nu dienen als een DNA-matrijs voor het maken van de induceerbare allel. </li><li> Het verkrijgen van de giststam de uiting van de overeenkomstige ATF van belang. </li><li> PCR amplificeren van de KanMX-promotor cassette (~ 2 kb) met primers van tabel 6. </li><li> Transformeer het PCR product in de ATF-expressie stam volgens de lithiumacetaat werkwijze. </li><li> Plaat op YPD en replica plaat op YPD + G418 de volgende dag. </li><li> Bevestig geschikte insertie van de promotor met de voorwaartse primer (5&#39;-CTGCAGCGAGGAGCCGTAAT-3 &#39;) en een reverse primer interne ee gen waarvan de promoter is vervangen. De reverse primer is meestal ontworpen op tussen 200-300 bp stroomafwaarts van het eerste ATG 15. Het uiteindelijke PCR product is ~ 1,2 kb. </li></ol>

<ol>
	<li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+gene+expression+perturbation+systems+with+rapid,+tunable,+single-gene+specificity+in+yeast.">Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast.</a> Nucleic acids res. 41, e57 (2013).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast-acting+and+nearly+gratuitous+induction+of+gene+expression+and+protein+depletion+in+Saccharomyces+cerevisiae.">Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae.</a> Mol. Biol. cell. 22, 4447-4459 (2011).</li><li>Louvion, J. F., Havaux-Copf, B., Picard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+of+GAL4-VP16+to+a+steroid-binding+domain+provides+a+tool+for+gratuitous+induction+of+galactose-responsive+genes+in+yeast.">Fusion of GAL4-VP16 to a steroid-binding domain provides a tool for gratuitous induction of galactose-responsive genes in yeast.</a> Gene. 131, 129-134 (1993).</li><li>Littlewood, T. D., Hancock, D. C., Danielian, P. S., Parker, M. G., Evan, G. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+oestrogen+receptor+ligand-binding+domain+as+an+improved+switch+for+the+regulation+of+heterologous+proteins.">A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins.</a> Nucleic acids res. 23, 1686-1690 (1995).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+Analysis+of+mRNA+Molecules+Using+Fluorescence+In+Situ+Hybridization+in+Saccharomyces+cerevisiae.">Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae.</a> J. Vis. Exp. (76), e50382 (2013).</li><li>McIsaac, R. S., Petti, A. A., Bussemaker, H. J., Botstein, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perturbation-based+analysis+and+modeling+of+combinatorial+regulation+in+the+yeast+sulfur+assimilation+pathway.">Perturbation-based analysis and modeling of combinatorial regulation in the yeast sulfur assimilation pathway.</a> Mol. Biol. cell. 23, 2993-3007 (2012).</li><li>Belli, G., Gari, E., Piedrafita, L., Aldea, M., Herrero, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+activator/repressor+dual+system+allows+tight+tetracycline-regulated+gene+expression+in+budding+yeast.">An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.</a> Nucleic acids res. 26, 942-947 (1998).</li><li>Baron, U., Bujard, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tet+repressor-based+system+for+regulated+gene+expression+in+eukaryotic+cells:+principles+and+advances.">Tet repressor-based system for regulated gene expression in eukaryotic cells: principles and advances.</a> Meth. Enzymol. 327, 401-421 (2000).</li><li>Kodama, S., Okada, K., Akimoto, K., Inui, H., Ohkawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+aryl+hydrocarbon+receptors+for+bioassay+of+aryl+hydrocarbon+receptor+ligands+in+transgenic+tobacco+plants.">Recombinant aryl hydrocarbon receptors for bioassay of aryl hydrocarbon receptor ligands in transgenic tobacco plants.</a> Plant Biotechnol. J. 7, 119-128 (2009).</li><li>Hickman, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+regulation+of+sulfur+and+phospholipid+metabolism+reflects+the+importance+of+methylation+in+the+growth+of+yeast.">Coordinated regulation of sulfur and phospholipid metabolism reflects the importance of methylation in the growth of yeast.</a> Mol. Biol. cell. 22, 4192-4204 (2011).</li><li>Taxis, C., Stier, G., Spadaccini, R., Knop, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+protein+depletion+by+genetically+controlled+deprotection+of+a+dormant+N-degron.">Efficient protein depletion by genetically controlled deprotection of a dormant N-degron.</a> Mol. Syst. Biol. 5, 267 (2009).</li><li>Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+auxin-based+degron+system+for+the+rapid+depletion+of+proteins+in+nonplant+cells.">An auxin-based degron system for the rapid depletion of proteins in nonplant cells.</a> Nat. methods. 6, 917-922 (2009).</li><li>Burke, D. J., Amberg, D. C., Strathern, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. , (2005).</li><li>Kahm, M., Hasenbrink, G., Lichtenberg-Frate, H., Ludwig, J., Kschischo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=grofit:+Fitting+Biological+Growth+Curves+with+R.">grofit: Fitting Biological Growth Curves with R.</a> J. Stat. Softw. 33, 1-21 (2010).</li><li>Rozen, S., Skaletsky, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer3+on+the+WWW+for+general+users+and+for+biologist+programmers.">Primer3 on the WWW for general users and for biologist programmers.</a> Methods Mol. Biol. 132, 365-386 (2000).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150, 647-658 (2012).</li><li>Chockalingam, K., Chen, Z., Katzenellenbogen, J. A., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+specific+receptor-ligand+pairs+for+use+in+the+creation+of+gene+switches.">Directed evolution of specific receptor-ligand pairs for use in the creation of gene switches.</a> Proceedings of the National Academy of Sciences of the United States of America. 102, 5691-5696 (2005).</li><li>McLachlan, M. J., Chockalingam, K., Lai, K. C., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+orthogonal+ligand+specificity+in+a+single+scaffold.">Directed evolution of orthogonal ligand specificity in a single scaffold.</a> Angewandte Chemie. 48, 7783-7786 (2009).</li><li>Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J., Tyers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+pathways+that+couple+cell+growth+and+division+in+yeast.">Systematic identification of pathways that couple cell growth and division in yeast.</a> Science. 297, 395-400 (2002).</li><li>Sopko, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+pathways+and+phenotypes+by+systematic+gene+overexpression.">Mapping pathways and phenotypes by systematic gene overexpression.</a> Mol. cell. 21, 319-330 (2006).</li><li>Shimizu-Sato, S., Huq, E., Tepperman, J. M., Quail, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+light-switchable+gene+promoter+system.">A light-switchable gene promoter system.</a> Nat. biotechnol. 20, 1041-1044 (2002).</li><li>Polstein, L. R., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Light-inducible+spatiotemporal+control+of+gene+activation+by+customizable+zinc+finger+transcription+factors.">Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors.</a> J. Am. Chem. Soc. 134, 16480-16483 (2012).</li><li>Losi, A., Gartner, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Old+chromophores,+new+photoactivation+paradigms,+trendy+applications:+flavins+in+blue+light-sensing+photoreceptors.">Old chromophores, new photoactivation paradigms, trendy applications: flavins in blue light-sensing photoreceptors.</a> Photochem. Photobiol. 87, 491-510 (2011).</li><li>Boyden, E. S., Zhang, F., Bamberg, E., Nagel, G., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond-timescale,+genetically+targeted+optical+control+of+neural+activity.">Millisecond-timescale, genetically targeted optical control of neural activity.</a> Nat. Neurosci. 8, 1263-1268 (2005).</li><li>Gradinaru, V., Mogri, M., Thompson, K. R., Henderson, J. M., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+deconstruction+of+parkinsonian+neural+circuitry.">Optical deconstruction of parkinsonian neural circuitry.</a> Science. 324, 354-359 (2009).</li><li>Milias-Argeitis, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+silico+feedback+for+in+vivo+regulation+of+a+gene+expression+circuit.">In silico feedback for in vivo regulation of a gene expression circuit.</a> Nat. biotechnol. 29, 1114-1116 (2011).</li></ol>

McIsaac, Noyes en Botstein (met anderen) zijn onderdeel van dit systeem is ingediend als een octrooi Disclosure.

Het hormoon gebaseerde switches beschreven hebben vele toepassingen, het bestuderen natieve celbiologie het testen van het vermogen van een DNA-bindingsdomein van belang een DNA-sequentie richten in vivo. Het systeem heeft vele wenselijke eigenschappen, waaronder een graded reactie op inductor, snelle actie, en strakke regelgeving (dwz. Geen meetbare lekkage, zie figuur 7). Er is echter nog ruimte voor verbetering en uitbreiding. Recent onderzoek in de synthetische biologie heeft benadrukt multiplexing synthetische systemen en het uitbreiden van het repertoire van goed gekarakteriseerde, programmeerbare DNA delen 16. Onafhankelijke, voorwaardelijke expressie van verschillende doelwit genen vereist zowel meerdere inductoren en DNA-bindende domeinen die overlappende specificiteit missen. De beschikbaarheid van gemanipuleerde en natuurlijk voorkomende receptoren biedt een groot aantal onderdelen waarmee nieuwe kunstmatige transcriptiefactoren ontwikkelen. Het uitbreiden van derepertoire van onderling orthogonale schakelaars is sterk geholpen door gerichte evolutie benadert 17,18. De huidige inspanningen op het ligandbindende specificiteit van onze kunstmatige transcriptiefactoren herprogrammeren worden gepresenteerd in de toekomst. Eerder, de fenotypische gevolgen van gendeletie / overexpressie zijn uitgebreid bestudeerd in gist 19,20. Het is echter niet eenvoudig om het effect van expressie op verschillende fenotypes een bereik van expressieniveaus bestuderen. Een primair kenmerk van de hierin gepresenteerde systeem is de gesorteerde aard (figuur 8). Hoewel vaak wordt aangenomen, kan de relatie tussen genexpressie en fenotypes van belang niet noodzakelijk monotoon. Kunstmatige transcriptiefactoren zoals Z3 en Z4 ES ES zal de taak van het testen van de fenotypische respons op veranderingen in genexpressie eenvoudiger te maken. Tenslotte, de protocollen besprekened in dit manuscript zijn voor engineering en karakteriseren kunstmatige transcriptiefactoren die reageren op β-oestradiol, maar als alternatief kunnen chemisch reageren domeinen is het gebruik van licht reagerende gebieden (zoals PhyB/Pif3, LOV en BLUF) waarvan de activiteiten zijn omkeerbaar zonder de cultuur groeimedium 21-23 verstoren. Light-systemen vergemakkelijken spatiotemporele regulatie van genexpressie, eiwit-eiwit interacties, ionentransport en enzymatische activiteit, die al bewezen krachtig 21-26. Concluderend, hebben wij werkwijzen voor de snelle bouw van induceerbare, kunstmatige transcriptiefactoren in gist gepresenteerd. Dit protocol verschaft een sjabloon voor de bouw in combinatie met verwante GFP reporters, alsook werkwijzen voor het analyseren van de reporter gegevens met flowcytometrie en testen van het effect van ATF activatie groei.

Het ontwikkelen van genetische schakelaars in gist is van groot belang, zowel academisch en industrieel onderzoek. In het ideale geval kan genetische schakelaars worden gebruikt om een ​​bepaald gen (of reeks van genen) activeren wanneer gewenst door de experimentator. Coderende sequentie van een gen stroomafwaarts van een synthetische promoter niet tot expressie in de afwezigheid van een inducerend molecuul: op inductor naast het gen snel worden uitgedrukt. Het is onlangs aangetoond dat een dergelijke schakelaar kan worden gemanipuleerd in gist, waar in de afwezigheid van inducer, de stam wordt een deletie fenotype, maar in de aanwezigheid van inductor, wordt expressie geactiveerd afhankelijk van de hoogte van de inductor in alle cellen 1,2. Historisch gezien, voorwaardelijke expressie in gist hebben zwaar op voedselrijke reactieve DNA-sequenties, met inbegrip van de BMO, FO, en GAL promotoren (waarvan de activiteiten zijn gevoelig voor extracellulaire niveaus van methionine, fosfaat, en vertrouwdengalactose, respectievelijk). Terwijl conditionele expressie kan worden bereikt, dit gaan ten koste van significante pleiotrope effecten. Hormoonreceptoren zoals de menselijke oestrogeen receptoren blijken doeltreffende schakelaars in eukaryoten 3,4 zijn. Bij afwezigheid van hormoon, een eiwit gefuseerd aan een hormoonreceptor worden afgezonderd in het cytoplasma waar de wisselwerking met Hsp90 chaperonne complex. Na binding passende ligand de receptor ondergaat een vormverandering, waardoor het vrijkomen van de Hsp90 chaperonne complex en onthullen een nucleair lokalisatiesignaal. Om de lokalisatie dynamiek van een bepaald hormoon-receptor bevattende eiwit zien, hebben we een C-terminale fusie van Gal4dbd.ER.VP16 (GEV, een synthetisch transcriptiefactor die de Gal4p DNA-bindende domein, het ligandbindende domein van de humane oestrogeen receptor en VP16) met GFP 2. Nucleaire lokalisatie werd waargenomen binnen 8 minuten na toevoeging vanverzadigende hoeveelheden van de inductor, ß-estradiol, waaraan wildtype gist volledig inert. Tegen die tijd, de meeste cellen zichtbaar actieve transcriptie plaatsen voor GEV doelgenen (bepaald via fluorescentie in situ hybridisatie) en volgroeid mRNA 2,5. GEV doelgenen toegenomen expressie&gt; 2-voudig binnen 2,5 min 2,6 (gemeten met microarrays), waaruit blijkt dat het duurt &lt;2,5 min. voor de chimere activator te transloceren naar de kern, binden van DNA en transcriptie activeert. Terwijl verschillende andere on-switches hebben in gist dat verschillende kleine moleculen of drugs (inclusief de klassieke basis van doxycycline switches uit Escherichia coli 7,8 en een indigo gebaseerde schakelaar 9 van Arabidopsis thaliana), hebben geen van de behaalde snelheid te benutten is toegepast, specificiteit, of benauwdheid van regulering tentoongesteld door de hormoon-gebaseerde switches. Het is het vermelden waard tpet snelle off-schakelaars zijn ontwikkeld in gist, en meestal werken door het fuseren van een gen voor een protease of ubiquitine ligase targeting sequentie 2,10,11,12. De mogelijkheid om snel verwijderen van een doeleiwit uit de cel vergemakkelijkt de studie van essentiële genen en genen die gevoelig zijn voor genetische onderdrukking zijn na verwijderen 10. De in dit protocol beschreven methoden zijn voor het bouwen en karakteriseren synthetische op-schakelaars in gist. Ten eerste tonen we hoe snel genereren genomisch geïntegreerde fusie-eiwitten bestaande uit een DNA-bindingsdomein van belang, het ligandbindende domein van de humane oestrogeen receptor en VP16 (DBD-EV&#39;s). Na ons protocol, wordt het fusie-eiwit expressie van een WERKW1 promoter. We zien dan hoe je een verwante reporterplasmide creëren voor de ATF en test de functionaliteit met behulp van flowcytometrie. Hoewel we deze ogen reporter plasmiden gebruikt met nieuwe ATF (figuur 1), kunnen ze be gebruikt als reporters voor een native transcriptieactivator ook. Tenslotte worden gegevens voor het testen van het effect van activatie ATF op de celgroei van 96-well platen en techniek induceerbare genomische allelen ontvangen.

<table border="0" cellpadding="0" cellspacing="0" width="352">
	<colgroup>
		<col span="4" />
	</colgroup>
	<tbody>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Name of the Reagent</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments&#160;</td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Expand High Fidelity PCR System</td>
			<td style="width:88px;">Roche</td>
			<td style="width:88px;">11 732 650 001</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">T4 DNA Ligase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0202S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Competent E. coli</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">18258-012</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Estradiol</td>
			<td style="width:88px;">Tocris Biosciences</td>
			<td style="width:88px;">2824</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Ampicillin</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">BP1760-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">T4 Polynucleotide Kinase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0201</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">PBS</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">10010-23</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">Tween-20</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">9005-64-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">clonNAT</td>
			<td style="width:88px;">Jena Bioscience</td>
			<td style="width:88px;">AB-102L</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">XbaI</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R0145S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">NotI-HF</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R3189S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">CutSmart Buffer</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">B7204S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Glucose</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">D15-500</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Bacto-Peptone</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">211677</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Yeast Extract</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">210929</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Agarose</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">214010</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">100% Ethanol</td>
			<td style="width:88px;">Decon Laboratories</td>
			<td style="width:88px;">04-355-222</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">G418</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">11811-031</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:88px;">QIAGEN</td>
			<td style="width:88px;">27104</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Lithium acetate dihydrate</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">L-6883</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Salmon sperm DNA</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">93283</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">PEG 3350</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">P-3640</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plasmids pMN8 and pMN10; yeast strain yMN15</td>
			<td style="width:88px;">Noyes or Botstein labs</td>
			<td style="width:88px;"></td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Luria Broth</td>
			<td>Sigma-Aldrich</td>
			<td>L3397</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EQUIPMENT:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Material Name</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments (optional)</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">LSRII Flow Cyometer&#160;</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">Various Models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="103">
			<td height="103" style="height:103px;width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">Software for analyzing .FCS files from flow cytometry experiments</td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">R</td>
			<td style="width:88px;">Open Source</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">For analyzing growth-rate data from plate reader.&#160;</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Falcon Tubes</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">352052</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="52">
			<td height="52" style="height:52px;width:88px;">1.7 ml Eppendorf&#160; Tubes</td>
			<td style="width:88px;">GeneMate</td>
			<td style="width:88px;">C3262-1</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">250 ml Shake Flasks</td>
			<td style="width:88px;">Corning</td>
			<td style="width:88px;">4446-250</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">96-well, flat-bottom plates</td>
			<td style="width:88px;">Costar</td>
			<td style="width:88px;">3635</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plate Reader (Synergy H1 Multi-Mode Plate Reader)</td>
			<td style="width:88px;">BioTek</td>
			<td style="width:88px;">H1MG</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Breathe-Easy Membranes</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">Z380059-1PAK</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Thermocycler</td>
			<td style="width:88px;">various companies</td>
			<td style="width:88px;">Various models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">SC-Ura powder</td>
			<td style="width:88px;">MP Biomedicals</td>
			<td style="width:88px;">114410622</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">5-FOA</td>
			<td style="width:88px;">Zymo Research</td>
			<td style="width:88px;">F9001-1</td>
			<td style="width:88px;"></td>
		</tr>
	</tbody>
</table>

rapid synthesis and screening of chemically activated transcription factors with gfp-based reporters

Synthetische biologie is gericht op rationeel ontwerpen en bouwen synthetische circuits met de gewenste kwantitatieve eigenschappen, evenals bieden instrumenten om de structuur van de standaard ingebouwde controle circuits ondervragen. In beide gevallen kan het vermogen om genexpressie programmeren snel en instelbare wijze, zonder off-target effecten nuttig zijn. We hebben giststammen met de ACT1 promoter stroomopwaarts van een URA3 cassette gevolgd door het ligandbindende domein van de humane oestrogeen receptor en VP16 geconstrueerd. Door transformatie van deze soort met een lineaire PCR-product dat een DNA bindend domein en selectie tegen de aanwezigheid van URA3, een constitutief tot expressie kunstmatig transcriptiefactor (ATF) worden gegenereerd door homologe recombinatie. ATFs ontworpen op deze manier een unieke doelgen in aanwezigheid van inductor te activeren, waardoor zowel de off-target activatie en niet-fysiologische groeiomstandigheden gevonden bij gebruikelijke conditi eliminerenonale genexpressiesystemen. Een eenvoudige werkwijze voor de snelle bouw van GFP reporter plasmiden die specifiek reageren op een natieve of kunstmatige transcriptiefactor plaats is ook voorzien.

<html> Figuur 5 toont de inductie van GFP door Z 3 ES, Z4 ES of GEV tijd. Merk de toename van GFP-productie als reactie op de ATFs die nonyeast DNA-bindende domeinen. We hebben onlangs gespeculeerd dat dit uit deze factoren bereiken enkel gen specificiteit in het gist genoom 1. GEV inductie alleen leidt tot activatie / onderdrukking van honderden genen, terwijl Z 3 EV en Z 4 EV alleen activeren expressie van een target-gen stroomafwaarts van een synthetische promotor die geschikte bindingsplaatsen (5&#39;-GCGTGGGCG-3 &#39;en 5&#39;-geplaatst GCGGCGGAGGAG-3 &#39;, respectievelijk) 1. Figuur 7 toont de strakke regulering van het systeem (geen inductor resulteert in geen detecteerbare GFP) en dat alle cellen krijgen geïnduceerd in reactie op inductor Het vermogen van Z 3 EV om GFP in een heel scala van induceren β-oestradiol concentraties wordt getoond in Figuur 8. <html> ent &quot;fo: keep-together.within-page =&quot; altijd &quot;&gt; <img alt="Figuur 1" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig1highres.jpg" src="/files/ftp_upload/51153/51153fig1.jpg" /> Figuur 1. Kunstmatige transcriptiefactoren interactie met Hsp90 in afwezigheid van β-oestradiol. Bij β-oestradiol bindt aan het ATF, Hsp90 dissocieert, zodat de ATF naar de kern voeren en op expressie van het reporter plasmide. <img alt="Figuur 2" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig2highres.jpg" src="/files/ftp_upload/51153/51153fig2.jpg" /> Figuur 2. Schematische voorstelling van het protocol voor de engineering stammen die kunstmatige transcriptiefactoren en bouwen / testen verwante GFP verslaggevers bevatten. load/51153/51153fig3highres.jpg &quot;src =&quot; / files/ftp_upload/51153/51153fig3.jpg &quot;/&gt; Figuur 3. De ACT1pr-URA3-EV sequentie in de stam yMN15 bij de LEU2 locus. <img alt="Figuur 4" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig4highres.jpg" src="/files/ftp_upload/51153/51153fig4.jpg" /> Figuur 4. Ontwerp van PCR-primers voor het amplificeren van een DNA-bindingsdomein plaats met extra sequentie homologie in nieuw fusieproteïne genereren wanneer succes omgezet in yMN15. <img alt="Figuur 5" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig5highres.jpg" src="/files/ftp_upload/51153/51153fig5.jpg" /> Figuur 5. GFP inductie drie verschillende ATF-promoter paar in reactie op 1 uM β-oestradiol. &lt;/ P&gt; <img alt="Figuur 6" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig6highres.jpg" src="/files/ftp_upload/51153/51153fig6.jpg" /> Figuur 6. Een MATLAB script voor verwerking doorstroomcytometrie gegevens. Dit script werd aangepast van <a href="http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data">http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data</a> . <img alt="Figuur 7" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig7highres.jpg" src="/files/ftp_upload/51153/51153fig7.jpg" /> Figuur 7. Inductie van GFP door Z 3 ES reactie op 0 μ M β-oestradiol en 1 uM β-oestradiol na 18 uur inductie. Fluorescentie was measured uit cellen die GFP te illustreren de strakke regulering van de Z 3 EV-systeem. Dit cijfer werd gegenereerd met de code die in figuur 6. <img alt="Figuur 8" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig8highres.jpg" src="/files/ftp_upload/51153/51153fig8.jpg" /> Figuur 8. Het verband tussen inducerende concentratie en expressie uitgang is ingedeeld met een Hill-coëfficiënt van ~ 1. (A) Distributions van GFP-expressie als een functie van β-oestradiol concentratie. (B) De gemiddelde fluorescentie van de uitkeringen van (A). De gegevens zijn geschikt om de functie G (D) = G min. + (G max-min G) Dn / (K + n D n) waarbij D de β-oestradiol dosis G G min en max zijn de minimale en maximale GFP waarden, respectively, n is de Hill coëfficiënt, en K de β-oestradiol dosering ½ (G max + G min.) oplevert. <table border="0" cellpadding="0" cellspacing="0" fo:keep-together.within-page="always" width="176"><tbody><tr><td> Oligonucleotidesequentie </td><td> Naam </td></tr><tr><td> 5&#39;-TTGAAACCA AACTCGCCTCT-3 &#39; </td><td> DBD Controleer Forward </td></tr><tr><td> 5&#39;-tccagagac ttcagggtgct-3 &#39; </td><td> DBD Controleer Reverse </td></tr></tbody></table> Tabel 1. Primers voor bevestiging juiste fusie van DBD van belang voor de oestrogeenreceptor. De voorwaartse primer homoloog WERKW1 de promotor en de reverse primer homoloog aan de oestrogeenreceptor. Voor typische DBDS (~ 300 bp), het PCR product is &lt;1,5 kb. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Oligonucleotidesequentie </td><td> Naam </td></tr><tr><td> 5&#39;-ggccgc ... DBD binging website ... t-3 &#39; </td><td> Top oligo </td></tr><tr><td> 5&#39;-ctaga ... DNA bindingsplaats reverse ... gc-3 &#39; </td><td> Bottom oligo </td></tr><tr><td> 5&#39;-gcc gcGTGGGCG T GCGTGGGCG G G CGTGGGCG T GCGTGGGCG G GCGTG GGCG T GCGTGGGCG t-3 &#39; </td><td> Top oligo + 6x Zif268 bindingsplaatsen </td></tr><tr><td> 5&#39;-ctagaCGCCCACGCACGCCCACGCC CGCCCACGCACGCCCACGCCCGCC CACGCACGCCCACgc-3 &#39; </td><td> Bottom oligo + 6x Zif268 bindingsplaatsen </td></tr></tbody></table> Tabel 2. STRUCTUUR van primers voor het creëren van dsDNA met bindingsplaatsen van belang. Om de Z 3 EV-responsieve promotor te creëren, de oligonucleotiden Top oligo + 6x Zif268 bindingsplaatsen en Bottom oligo + 6x Zif268 Binding werden gebruikt.Sequenties voor het maken van de juiste DNA-overhangen in kleine letters. De Zif268 consensus bindingsplaats, GCGTGGGCG, wordt onderstreept in de top oligo. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Reagens </td><td> Bedrag </td></tr><tr><td> T4 Polynucleotide Kinase Buffer </td><td> 5 pi </td></tr><tr><td> T4 Polynucleotide Kinase (@ 10.000 eenheden / ml) </td><td> 1 pi </td></tr><tr><td> Top oligo (100 uM) </td><td> 1.5 pl </td></tr><tr><td> Bottom oligo (100 uM) </td><td> 1.5 pl </td></tr><tr><td> Water </td><td> 41 pl </td></tr></tbody></table> Tabel 3. Fosforyleren en gloeien primers in een thermocycler met 50 pi reactie hierboven beschreven. Er zijn twee stappen thermocycler. Stap 1: 37 ° C 30 min (fosforyleren), en stap 2: 95 ° C 30 sec (stap naar beneden 1 ° C per 30 seconden totdat bij 4 ° C; Anneal). <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Reagens </td><td> Bedrag </td></tr><tr><td> Xbal </td><td> 1 pi </td></tr><tr><td> NotI-HF </td><td> 1 pi </td></tr><tr><td> Plasmide DNA </td><td> 5 pl (1-2 ug) </td></tr><tr><td> 10x Cut Smart Buffer </td><td> 5 pi </td></tr><tr><td> Water </td><td> 38 pl </td></tr></tbody></table> Tabel 4. Restrictiedigest van plasmide pMN8 met Xbal en Notl. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr height="22" style="height:16.5pt"><td class="xl65" height="22" style="height:16.5pt;width:66pt" width="88"> Reagens </td><td class="xl66" style="width:66pt" width="88"> Bedrag </td></tr><tr height="43" style="height:32.25pt"><td> T4 Ligase Buffer </td><td> 2 pi </td></tr><tr height="22" style="height:16.5pt"><td> T4 Ligase </td><td> 0,2 pl </td></tr><tr height="43" style="height:32.25pt"><td> Backbone @ 10 ng / ul </td><td> 1 pi </td></tr><tr height="106" style="height:79.5pt"><td> Bindingssequenties @ 5x molconcentratie / ul </td><td> 1 pi </td></tr><tr height="22" style="height:16.5pt"><td> Water </td><td> 15.8 pi </td></tr></tbody></table> Tabel 5. Ligeer bindingsplaatsen in plasmide-DNA. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Grondverf </td><td> Beschrijving </td></tr><tr><td> ~ 40 bp stroomopwaarts van ATG + CGCACTTAACTTCGCATCTG-3 &#39; </td><td> Voorwaartse primer voor het versterken KanMX-Promoter </td></tr><tr><td> 5&#39;-reverse complement (ATG + ~ 37bp) + TATAGTTTTTTCTCCTTGACG-3 &#39; </td><td> Reverse primer voor het versterken KanMX-Promoter </td></tr><tr><td> 5&#39;-caatttgtctgctcaagaaaataaa ttaaatacaaataaaCGCAC TTAACTTCGCATCTG-3 &#39; </td><td> Voorwaartse primer voor het maken van GCN4 promotor swap. </td></tr><tr><td> 5&#39;-tggatttaaagcaaataaacttgg ctgatattcggacatTATAGTT TTTTCTCCTTGACG-3 &#39; </td><td> Reverse primer voor het maken van GCN4 promotor swap. </td></tr></tbody></table> Tabel 6. PCR versterken KanMX-promotor voor het maken titratible allel.

Watch this Scientific Journal Video about Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters at JoVE.com

Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Dit protocol beschrijft een experimentele procedure voor de snelle bouw van kunstmatige transcriptiefactoren (ATF) met verwante GFP verslaggevers en kwantificering van de ATFs mogelijkheid om GFP-expressie te stimuleren via flowcytometrie.

Rapid Synthese en Screening van chemisch geactiveerde transcriptie Factoren met GFP gebaseerde Reporters

Synthetic biology aims to rationally design and build synthetic circuits with desired quantitative properties, as well as provide tools to interrogate the ...

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 1

Transcription: DNA to RNA

SCIENTISTS IN ACTION

Generation of Human CD40-activated B cells

Generatie van de Mens CD40-geactiveerde B-cellen

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer ...

Fluorescence Activated Cell Sorting of Plant Protoplasts

Fluorescentie geactiveerde celsortering van plantenprotoplasten

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput screening &#39;en biosensing met fluorescerende C. elegans Stammen

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron (dgn)-destabilized Green Fluorescent Protein (GFP)-based Reporter Protein

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron dgn-destabilized Green Fluorescent Protein GFP-based Reporter Protein

Monitoring van ubiquitine-proteasoom activiteit in levende cellen door een Degron (dgn)-gedestabiliseerd Green Fluorescent Protein (GFP)-gebaseerde Reporter Protein

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. ...

Synthesis of Nine-atom Deltahedral Zintl Ions of Germanium and their Functionalization with Organic Groups

Synthese van Nine-atoom Deltahedral Zintl ionen van germanium en hun functionalisering met organische groepen

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatine Interactie Analyse met gepaarde-End Tag Sequencing (Chia-PET) voor het in kaart brengen van chromatine Interacties en begrijpen Transcriptie Verordening

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

A Chemical Screening Procedure for Glucocorticoid Signaling with a Zebrafish Larva Luciferase Reporter System

Een chemische Screening Procedure voor Glucocorticoid Signalering met een zebravis larve luciferasereporter System

Glucocorticoid stress hormones and their artificial derivatives are widely used drugs to treat inflammation, but long-term treatment with glucocorticoids ...

Using Coculture to Detect Chemically Mediated Interspecies Interactions

Met behulp Coculture te sporen Chemisch Mediated Interspecies Interacties

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Snelle en efficiënte zebravis Genotyping Met behulp van PCR met een hoge resolutie Melt Analyse

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

RNA Isolation from Cell Specific Subpopulations Using Laser-capture Microdissection Combined with Rapid Immunolabeling

RNA isolatie van de Cel specifieke subpopulaties met behulp van laser-capture Microdissection Gecombineerd met Rapid immunolabeling

Laser capture microdissection (LCM) allows the isolation of specific cells from thin tissue sections with high spatial resolution. Effective LCM requires ...