Name: rapid synthesis and screening of chemically activated transcription factors with gfp-based reporters
Uploaded: 2013-11-26T20:00:00
Duration: 9 min 22 s
Description: Watch this Scientific Journal Video about Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters at JoVE.com

RSM מכיר במימון מNSF בוגר מלגת המחקר. MBN מכיר במימון מלגת לואיס-סיגלר ומתנת ניחן של פיטר לואיס. DB מכיר במימון מ-NIH (GM046406) המכון הלאומי למדעי רפואה כללי מרכז לביולוגיה כמותית (GM071508). אנו מכירים כריסטינה DeCoste לקבלת סיוע בניסויי cytometry הזרימה.

איור 2 מספק סכמטי של חלקי פרוטוקול 1-3. 1. יצירת ATFs <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> יצירת פריימרים להגברת PCR תחום מחייב-DNA של עניין. הומולוגיה לקולטן אמרגן ACT1 והורמון (כפי שמתואר באיורים 3 ו -4) הוא הוסיף באמצעות PCR כדי להקל על רקומבינציה הנכונה למתח yMN15. </li><li style=";text-align:right;direction:rtl"> PCR להגביר DBD של ריבית באמצעות פולימראז באיכות גבוהה. </li><li style=";text-align:right;direction:rtl"> שינוי&gt; 1 מיקרוגרם של מוצר ה-PCR מטוהר לשמרים בשיטת ליתיום אצטט 13. </li><li style=";text-align:right;direction:rtl"> בעקבות שינוי, תאי ספין במהירות שיא ל15 שניות בmicrocentrifuge ולהסיר תמהיל טרנספורמציה. </li><li style=";text-align:right;direction:rtl"> Resuspend ב ~ 200 μl של מים סטריליים וצלחת על YPD. </li><li style=";text-align:right;direction:rtl"> למחרת, צלחת העתק מYPD על צלחות 5-פואה (צלחות 5-פואה נעשות כפי שמתוארת במדריך לשמרי Cold Spring Harbor) 13. </li><li style=";text-align:right;direction:rtl"> לאפשר צמיחה ל2-4 דays, וrestreak לפחות 5-10 מושבות על YPD. לבצע PCR מושבה באמצעות פריימרים בטבלה 1 ורצף כדי לוודא הכללה. </li></ol> 2. יצירת ATF פלסמיד Reporter <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> קבע את אתר הקישור של ATF (הסיכוי הטוב ביותר מגיע מהספרות). </li><li style=";text-align:right;direction:rtl"> סדר רצוי אזור מחייב כoligos (או Ultramers, במידת צורך). להזמין כעליון ותחתונים עם גדילי סככות נכונות לNotI &amp; XbaI כפי שמוצג בטבלה 2. </li><li style=";text-align:right;direction:rtl"> לדלל oligos לריכוזי equimolar (100 מיקרומטר). </li><li style=";text-align:right;direction:rtl"> Phosphorylate באמצעות T4 Polynucleotide קינאז ואז לחשל בthermocycler. תנאי התגובה הם בטבלה 3. </li><li style=";text-align:right;direction:rtl"> תקציר ~ 1-2 מיקרוגרם של pMN8 עם NotI-HF וXbaI עבור שעה 1 ב 37 מעלות צלזיוס (תנאי תגובה בלוח 4). </li><li style=";text-align:right;direction:rtl"> ג&#39;ל לטהר את להקת עמוד השדרה. </li><li style=";text-align:right;direction:rtl"> לדלל את עמוד השדרה מטוהרת ל10 ng / μl. </li><li style=";text-align:right;direction:rtl"> לדלל את גדילים הכפול, phosphorylated אתר קישור ל5x הריכוז טוחנת של עמוד השדרה לכל μl. </li><li style=";text-align:right;direction:rtl"> באמצעות אנזים T4 DNA, ולקשור את אתרי הקישור לשדרה מתעכל בטמפרטורת חדר במשך 30 דקות (לוח 5). </li><li style=";text-align:right;direction:rtl"> לשינוי, להוסיף חצי מתגובת קשירת 50 μl לסטנדרטים, Escherichia coli כימי המוסמך כגון XL1 כחול או DH5-אלפא. </li><li style=";text-align:right;direction:rtl"> תאי חום הלם ל45 שניות באמבט מים 42 מעלות צלזיוס ולאחר מכן מניחים על קרח במשך 2 דקות. </li><li style=";text-align:right;direction:rtl"> הוספת 900 μl של מדיום SOC לתגובת טרנספורמציה. </li><li style=";text-align:right;direction:rtl"> לגדול ב 37 מעלות צלזיוס במשך שעה 1 בתוף הרים. </li><li style=";text-align:right;direction:rtl"> מורחים 100-200 תאי μl לLB + AMP צלחת (100 מיקרוגרם / מיליליטר) ו דגירה הלילה. </li><li style=";text-align:right;direction:rtl"> תתבגר E. coli בLB + AMP-DNA פלסמיד הנוזלי והקציר. רצף לאמת פלסמיד כתב החדש ממושבות קשירה באמצעות פריימר 5&#39;-GTACCTTATATTGAATTTTC-3 &quot;. </li><li style=";text-align:right;direction:rtl"> להפוך פלסמיד כתב החדש לשמרים str המכיל ATFעין מסעיף 1 באמצעות שינוי ליתיום אצטט. </li></ol> 3. לכמת את ההשפעה של ATF אינדוקציה על ביטוי גנים בעזרת ה-GFP כתב הכנת הדגימות: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הפוך 25 מ&quot;מ מניית β-אסטרדיול (10 מיליליטר של אתנול + .0681 גרם של β-אסטרדיול). לשמור בקירור. </li><li style=";text-align:right;direction:rtl"> לגדול ATF + כתב המכיל זן הלילה בSC-URA 5 מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> השג תשעה 250 מיליליטר לנער צלוחיות ולהוסיף 25 מיליליטר SC-URA לכל אחד. </li><li style=";text-align:right;direction:rtl"> הוסף 0 ננומטר, 0.1 ננומטר, 1 ננומטר, 10 ננומטר, 100 ננומטר, 1 מיקרומטר, או 10 β-אסטרדיול מיקרומטר. זה נעשה בקלות על ידי ביצוע דילולים סדרתי של פי 10 של מניית β-אסטרדיול 25 מ&quot;מ. לריכוז סופי של 10 β-אסטרדיול מיקרומטר, להוסיף 10 μl של מניית β-אסטרדיול 25 מ&quot;מ ל25 מיליליטר של SC-URA. </li><li style=";text-align:right;direction:rtl"> הוספת 125 μl של תרבויות לילה לצלוחיות (1:200 דילול). </li><li style=";text-align:right;direction:rtl"> ל2 צלוחיות הנותרות, לחסן עם strai GFP הפקה מכונןn ומתח חסר ה-GFP. אלו יש צורך בכיול cytometer את הזרימה. </li><li style=";text-align:right;direction:rtl"> לנער בסל&quot;ד 200 ב30 מעלות צלזיוס במשך שעה 12-18. הערה: זמן הדגירה האופטימלי נקבע על ידי זיהוי שינויים כאשר כבר לא האינדוקציה GFP הבאים תוספת של β-אסטרדיול. </li><li style=";text-align:right;direction:rtl"> קח 500 μl של כל תרבות וספין למטה בצינורות נפרדים microcentrifuge 1.7 מיליליטר. </li><li style=";text-align:right;direction:rtl"> לשאוב SC-URA. </li><li style=";text-align:right;direction:rtl"> לשטוף פעם ב 1 מיליליטר-20 Tween PBS +0.1% ולשאוב. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מיליליטר של-20 Tween PBS +0.1% ו resuspend. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מיליליטר של PBS Tween-20 +0.1% לצינורות פלקון. </li><li style=";text-align:right;direction:rtl"> מוסיף את תאי resuspended ל5 צינורות מיליליטר (נפח סופי = 2 מיליליטר) (יכול להיות מאוחסן על 4 מעלות צלזיוס במשך כמה ימים). </li><li style=";text-align:right;direction:rtl"> אופציונאלי: תאים בקלילות sonicate לפרידה כל תאים בכבדות. ניתוח תזרים cytometry: סקירה: הקרינה של 10,000-100,000 תאים מנותחות בדרך כלל לדגימה. ניתן לעבד נתונים או בFlowJo או באמצעות סקריפטים מותאמים אישית בMATLAB אור &#39;ודא לכייל מתח של ערוץ ה-GFP באמצעות בקרות חיוביות ושליליות ה-GFP. ברגע שקבצי FCS מיוצאים, תסריט כמו זה באיור 6 יחד עם fca_readfcs הפונקציה <a href="http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader">(http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader)</a> יכול לשמש כדי לעבד נתונים. </li><li style=";text-align:right;direction:rtl"> לבצע cytometry זרימה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> שימוש פיזור קדימה (FSC) ופיזור צד (SSC) לזהות תאי שמרים. </li><li style=";text-align:right;direction:rtl"> הגדר את קצב זרימה ל~ 3,000 תאים / sec. </li><li style=";text-align:right;direction:rtl"> מדוד GFP (ערוץ FITC). </li><li style=";text-align:right;direction:rtl"> ברגע שנתונים שנאספו, לייצא קבצים. FCS </li></ol></li><li style=";text-align:right;direction:rtl"> טען MATLAB. </li><li style=";text-align:right;direction:rtl"> להעביר את הקבצים. FCS, fcs_readfcs.m, ותסריט דומה לזה מהאיור 6 לאותה תיקייה. </li><li style=";text-align:right;direction:rtl"> לשנות את ספריית העבודה הנוכחית אל התיקייה המכילה את הנתונים ותסריטים. </li><li style=";text-align:right;direction:rtl"> להריץ את הסקריפט מהאיור 6 (שים לב:אגדה הוזנה באופן ידני כדי לייצר את מה שראה באיור 7). </li></ol> 4. לכמת את ההשפעה של ATF אינדוקציה על גדילה תא <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ממניות קפוא, פס את שני (1) מתח המכיל ATF ו (2) מתח חסר-ATF (כגון yMN15) על גבי צלחות YPD נפרדות. </li><li style=";text-align:right;direction:rtl"> אחרי 2 ימים של צמיחה, לחסן צינורות תרבות נפרדים המכילים 5 מיליליטר של נוזל YPD עם כל זן ולגדול בין לילה ב30 ° C. </li><li style=";text-align:right;direction:rtl"> בצע פי 10 דילולים סדרתי של פתרון 0.25 מ&quot;מ β-אסטרדיול המניה עד 10,000 פי (0.025 מיקרומטר β-אסטרדיול) ב100% אתנול. </li><li style=";text-align:right;direction:rtl"> הוסף 40 μl של תרבויות לילה ל10 מיליליטר של נוזל YPD (1-250 דילול). </li><li style=";text-align:right;direction:rtl"> עבור כל זן, להוסיף 96 μl של תאים בדילול מלא ל18 בארות של צלחת 96 היטב. </li><li style=";text-align:right;direction:rtl"> הוסף 4 μl של β-אסטרדיול לתאים. נקודה מהותית היא לוודא שיש לו כל טוב באותה הכמות של אתנול בסך הכל. (לחלופין, מו<html> מחדש המניה מרוכזת של β-אסטרדיול יכולה לשמש ולאחר מכן מדוללת לנקודת ההשפעה של אתנול על צמיחה היא לא ניתנת למדידה). </li><li style=";text-align:right;direction:rtl"> לבצע בשלושה עותקים. שלוש הבארות עבור כל זן צריכים להיות אתנול בלבד פקדים. </li><li style=";text-align:right;direction:rtl"> מכסה את צלחת 96 היטב בקרום חדיר גז. </li><li style=";text-align:right;direction:rtl"> לפקח על גדילה (OD 600) בצלחת קורא. </li><li style=";text-align:right;direction:rtl"> לכמת את שיעורי הצמיחה באמצעות מספר רב של שיטות סטנדרטיות כגון מציאת השיפוע המרבי. שים לב: יש לנו הצלחה טובה עם גרופית הקוד הפתוח חבילת תוכנת 14, אשר פועלת בסביבת תכנות R ראוי להזכיר שבזמן ששיעורי צמיחה מחושבים ממבחני צלחת 96 היטב בהשוואה לנער-צלוחיות (25 מיליליטר תרבויות). הם אינם בהכרח זהים (הן בשל ההבדלים בפיזיולוגיה ובמכשור), אנחנו כבר ציינו כי שיעורי הצמיחה היחסי דומים (אם כי זה לא תמיד המקרה). </li></ol>ייתכנו &quot;&gt; 5. יצירת אללים הגנום עין מתנהל <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השג pMN10, פלסמיד noncentromeric עם אמרגן ATF מגיב מpMN8 התמזגו KanMX (בכיוון ההפוך). </li><li style=";text-align:right;direction:rtl"> הגבלה לעכל את עמוד השדרה וקטורית ותמצית ג&#39;ל כמו בסעיף 2. </li><li style=";text-align:right;direction:rtl"> לחשל, phosphorylate, וoligos לקשור המכיל אתרי קישור מתאימים כפי שתואר בסעיף 2. </li><li style=";text-align:right;direction:rtl"> רצף לאמת. פלסמיד עכשיו זה יהיה לשמש כתבנית ליצירת ה-DNA אלל מושרה. </li><li style=";text-align:right;direction:rtl"> השג את זן שמרים המבטא את ATF המקביל של ריבית. </li><li style=";text-align:right;direction:rtl"> PCR להגביר את קלטת KanMX-יזם (~ 2 קילו) באמצעות פריימרים מטבלה 6. </li><li style=";text-align:right;direction:rtl"> להפוך את המוצר ה-PCR למתח-להביע ATF בשיטה אצטט ליתיום. </li><li style=";text-align:right;direction:rtl"> צלחת על YPD וצלחת העתק אל YPD + G418 ביום המחרת. </li><li style=";text-align:right;direction:rtl"> לאשר כניסה מתאימה של האמרגן באמצעות פריימר קדימה (5&#39;-CTGCAGCGAGGAGCCGTAAT-3 &quot;) והפוך פנימי פריימר הגן דואר האמרגן שהוחלף. פריימר ההפוכה מיועדת בדרך כלל להיות בין 200-300 נ&quot;ב במורד הזרם של 15 ATG הראשון. מוצר ה-PCR הסופי הוא ~ 1.2 kb. </li></ol>

<ol>
	<li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+gene+expression+perturbation+systems+with+rapid,+tunable,+single-gene+specificity+in+yeast.">Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast.</a> Nucleic acids res. 41, e57 (2013).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast-acting+and+nearly+gratuitous+induction+of+gene+expression+and+protein+depletion+in+Saccharomyces+cerevisiae.">Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae.</a> Mol. Biol. cell. 22, 4447-4459 (2011).</li><li>Louvion, J. F., Havaux-Copf, B., Picard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+of+GAL4-VP16+to+a+steroid-binding+domain+provides+a+tool+for+gratuitous+induction+of+galactose-responsive+genes+in+yeast.">Fusion of GAL4-VP16 to a steroid-binding domain provides a tool for gratuitous induction of galactose-responsive genes in yeast.</a> Gene. 131, 129-134 (1993).</li><li>Littlewood, T. D., Hancock, D. C., Danielian, P. S., Parker, M. G., Evan, G. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+oestrogen+receptor+ligand-binding+domain+as+an+improved+switch+for+the+regulation+of+heterologous+proteins.">A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins.</a> Nucleic acids res. 23, 1686-1690 (1995).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+Analysis+of+mRNA+Molecules+Using+Fluorescence+In+Situ+Hybridization+in+Saccharomyces+cerevisiae.">Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae.</a> J. Vis. Exp. (76), e50382 (2013).</li><li>McIsaac, R. S., Petti, A. A., Bussemaker, H. J., Botstein, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perturbation-based+analysis+and+modeling+of+combinatorial+regulation+in+the+yeast+sulfur+assimilation+pathway.">Perturbation-based analysis and modeling of combinatorial regulation in the yeast sulfur assimilation pathway.</a> Mol. Biol. cell. 23, 2993-3007 (2012).</li><li>Belli, G., Gari, E., Piedrafita, L., Aldea, M., Herrero, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+activator/repressor+dual+system+allows+tight+tetracycline-regulated+gene+expression+in+budding+yeast.">An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.</a> Nucleic acids res. 26, 942-947 (1998).</li><li>Baron, U., Bujard, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tet+repressor-based+system+for+regulated+gene+expression+in+eukaryotic+cells:+principles+and+advances.">Tet repressor-based system for regulated gene expression in eukaryotic cells: principles and advances.</a> Meth. Enzymol. 327, 401-421 (2000).</li><li>Kodama, S., Okada, K., Akimoto, K., Inui, H., Ohkawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+aryl+hydrocarbon+receptors+for+bioassay+of+aryl+hydrocarbon+receptor+ligands+in+transgenic+tobacco+plants.">Recombinant aryl hydrocarbon receptors for bioassay of aryl hydrocarbon receptor ligands in transgenic tobacco plants.</a> Plant Biotechnol. J. 7, 119-128 (2009).</li><li>Hickman, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+regulation+of+sulfur+and+phospholipid+metabolism+reflects+the+importance+of+methylation+in+the+growth+of+yeast.">Coordinated regulation of sulfur and phospholipid metabolism reflects the importance of methylation in the growth of yeast.</a> Mol. Biol. cell. 22, 4192-4204 (2011).</li><li>Taxis, C., Stier, G., Spadaccini, R., Knop, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+protein+depletion+by+genetically+controlled+deprotection+of+a+dormant+N-degron.">Efficient protein depletion by genetically controlled deprotection of a dormant N-degron.</a> Mol. Syst. Biol. 5, 267 (2009).</li><li>Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+auxin-based+degron+system+for+the+rapid+depletion+of+proteins+in+nonplant+cells.">An auxin-based degron system for the rapid depletion of proteins in nonplant cells.</a> Nat. methods. 6, 917-922 (2009).</li><li>Burke, D. J., Amberg, D. C., Strathern, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. , (2005).</li><li>Kahm, M., Hasenbrink, G., Lichtenberg-Frate, H., Ludwig, J., Kschischo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=grofit:+Fitting+Biological+Growth+Curves+with+R.">grofit: Fitting Biological Growth Curves with R.</a> J. Stat. Softw. 33, 1-21 (2010).</li><li>Rozen, S., Skaletsky, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer3+on+the+WWW+for+general+users+and+for+biologist+programmers.">Primer3 on the WWW for general users and for biologist programmers.</a> Methods Mol. Biol. 132, 365-386 (2000).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150, 647-658 (2012).</li><li>Chockalingam, K., Chen, Z., Katzenellenbogen, J. A., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+specific+receptor-ligand+pairs+for+use+in+the+creation+of+gene+switches.">Directed evolution of specific receptor-ligand pairs for use in the creation of gene switches.</a> Proceedings of the National Academy of Sciences of the United States of America. 102, 5691-5696 (2005).</li><li>McLachlan, M. J., Chockalingam, K., Lai, K. C., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+orthogonal+ligand+specificity+in+a+single+scaffold.">Directed evolution of orthogonal ligand specificity in a single scaffold.</a> Angewandte Chemie. 48, 7783-7786 (2009).</li><li>Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J., Tyers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+pathways+that+couple+cell+growth+and+division+in+yeast.">Systematic identification of pathways that couple cell growth and division in yeast.</a> Science. 297, 395-400 (2002).</li><li>Sopko, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+pathways+and+phenotypes+by+systematic+gene+overexpression.">Mapping pathways and phenotypes by systematic gene overexpression.</a> Mol. cell. 21, 319-330 (2006).</li><li>Shimizu-Sato, S., Huq, E., Tepperman, J. M., Quail, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+light-switchable+gene+promoter+system.">A light-switchable gene promoter system.</a> Nat. biotechnol. 20, 1041-1044 (2002).</li><li>Polstein, L. R., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Light-inducible+spatiotemporal+control+of+gene+activation+by+customizable+zinc+finger+transcription+factors.">Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors.</a> J. Am. Chem. Soc. 134, 16480-16483 (2012).</li><li>Losi, A., Gartner, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Old+chromophores,+new+photoactivation+paradigms,+trendy+applications:+flavins+in+blue+light-sensing+photoreceptors.">Old chromophores, new photoactivation paradigms, trendy applications: flavins in blue light-sensing photoreceptors.</a> Photochem. Photobiol. 87, 491-510 (2011).</li><li>Boyden, E. S., Zhang, F., Bamberg, E., Nagel, G., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond-timescale,+genetically+targeted+optical+control+of+neural+activity.">Millisecond-timescale, genetically targeted optical control of neural activity.</a> Nat. Neurosci. 8, 1263-1268 (2005).</li><li>Gradinaru, V., Mogri, M., Thompson, K. R., Henderson, J. M., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+deconstruction+of+parkinsonian+neural+circuitry.">Optical deconstruction of parkinsonian neural circuitry.</a> Science. 324, 354-359 (2009).</li><li>Milias-Argeitis, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+silico+feedback+for+in+vivo+regulation+of+a+gene+expression+circuit.">In silico feedback for in vivo regulation of a gene expression circuit.</a> Nat. biotechnol. 29, 1114-1116 (2011).</li></ol>

McIsaac, נויס, ווטשטיין (עם אחרים) הגישו חלק ממערכת זו כגילוי פטנטים.

יש המתגים המבוסס על ההורמון המתואר כאן יישומים רבים, מלימוד ביולוגיה של תא יליד בודק את יכולתו של תחום מחייב-DNA של עניין למקד רצף ה-DNA בגוף חי. המערכת כוללת תכונות רצויות רבות, כולל תגובה מדורגת למשדל, פעולה מהירה, ורגולציה הדוקה (כלומר. אין דליפות למדידה, ראה איור 7). עם זאת, יש עדיין מקום לשיפור והתרחבות. מחקר שנערך לאחרונה בביולוגיה סינתטית הדגיש מערכות סינתטיות ריבוב והרחבת הרפרטואר של מאופיין היטב חלקי DNA הניתנים לתכנות, 16. ביטוי עצמאי, מותנה של גנים המטרה שונים דורש גם מעוררים מרובים ותחומים מחייבים DNA כי חוסר הספציפיות חופפות. הזמינות של הקולטנים מהונדסים וטבעיים מספקת קבוצה גדולה של חלקים שבה לפתח את גורמי שעתוק מלאכותי חדשים. הרחבתרפרטואר של מתגי אורתוגונליים הדדית כבר סייע במידה רבה על ידי אבולוציה מכוונת גישות 17,18. מאמצים הנוכחיים כדי לתכנת מחדש את הספציפיות מחייב ליגנד של גורמי השעתוק המלאכותי שלנו יוצגו בעתיד. בעבר, את ההשלכות פנוטיפי של מחיקה / ביטוי יתר גן נחקרו רבות בשמרים 19,20. עם זאת, זה לא היה פשוט ללמוד את ההשפעה של ביטוי בפנוטיפים שונים על פני טווח של רמות ביטוי. תכונה העיקרית של מערכת המוצגת כאן היא הטבע מדורג שלה (איור 8). אמנם לעתים קרובות להניח, את הקשר בין ביטוי גנים ופנוטיפים של עניין לא בהכרח מונוטונית. גורמי שעתוק מלאכותיים כגון Z 3 EV ו-Z 4 EV יהפכו את המשימה שלו מנסה לאמוד את התגובות פנוטיפי לשינויים בביטוי גנים פשוטים. לבסוף, הפרוטוקולים לדוןדעה בכתב יד זה הוא להנדסה ואפיון גורמי שעתוק מלאכותיים המגיבים לβ-אסטרדיול, עם זאת, אלטרנטיבה חשובה לתחומים כימי תגובה הוא השימוש בתחומי אור תגובה (כגון PhyB/Pif3, LOV, וBLUF), שפעילותו הן הפיכה מבלי להפריע מדיום גידול תרבות 21-23. מערכות מבוססות אור להקל על שליטת spatiotemporal של ביטוי גנים, חלבונים אינטראקציות, הובלת יונים, ופעילות האנזימטית, שכבר הוכיחו את העוצמה 21-26. לסיכום, יש לנו הציגו שיטות לבנייה המהירה של גורמי שעתוק מושרה, מלאכותיים בשמרים. פרוטוקול זה מספק תבנית לבנייה שלהם בשיתוף עם כתבי ה-GFP מאותו מקור, כמו גם שיטות לניתוח נתוני הכתב באמצעות cytometry זרימה ומנסה לאמוד את ההשפעה של הפעלת ATF על צמיחה.

פיתוח מתגים גנטיים בשמרים הוא עניין רב במחקר אקדמי ותעשייתי. במקרה האידיאלי, ניתן להשתמש במתגים גנטיים כדי להפעיל את גן מסוים (או קבוצה של גנים) רק בעת צורך על ידי הנסיין. רצף הקידוד של גן ממוקם במורד הזרם של אמרגן סינטטי לא בא לידי ביטוי בהעדר מולקולת התרמה: על בנוסף inducer הגן צריך לבוא לידי ביטוי במהירות. רק לאחרונה זה כבר הוכיח כי מתג כזה יכול להיות מהונדס בשמרים, שבו בהיעדרו של משדל, את המתח מציג פנוטיפ מחיקה, אבל בנוכחות של משדל, ביטוי מופעל באופן יחסי לרמה של משדל בכל התאים 1,2. מבחינה היסטורית, מערכות ביטוי תנאי בשמרים יש לסמוך במידה רבה על רצפי DNA תזונתיים מגיב, כוללים MET, PHO, ויזמי גל (שפעילותם רגישות לרמות תאיים של מתיונין, פוספט, וגלקטוז, בהתאמה). בעוד ניתן להשיג ביטוי תנאי, זה מגיע במחיר של תופעות pleiotropic משמעותיות. קולטני הורמון כגון קולטני אסטרוגן האנושי הוכיחו להיות מתגים יעילים באאוקריוטים 3,4. בהעדר ההורמון, חלבון התמזגו לקולטן הורמון יכול להיות מוחרם בציטופלסמה שבה הוא מקיים אינטראקציה עם מורכב מלווה Hsp90. על כריכת ליגנד המתאים, קולט עובר שינוי קונפורמציה, גורם לו להשתחרר ממורכב מלווה Hsp90 וחושף אות לוקליזציה גרעינית. כדי לבחון את דינמיקת הלוקליזציה של חלבון המכיל קולטן הורמון מסוים, יצרנו היתוך בטרמינל C-של Gal4dbd.ER.VP16 (GeV, גורם שעתוק סינטטי המכילים תחום מחייב Gal4p DNA, תחום מחייב יגנד של קולטן אסטרוגן האנושי , וVP16) עם GFP 2. לוקליזציה גרעינית נצפתה בתוך 8 דקות הבאות תוספת שללהרוות כמויות של המשדל, SS-אסטרדיול, כדי ששמרים מסוג בר הוא אינרטי לחלוטין. בשלב זה, רוב התאים באתרים נראים בבירור פעילים שעתוק לגני מטרת GeV (assayed באמצעות הקרינה הכלאה באתר), כמו גם mRNAs בגרות מלא 2,5. גנים מטרת GeV מוגברים בביטוי&gt; פי 2 בתוך 2.5 דקות 2,6 (נמדד באמצעות microarrays), הוכחת כי זה לוקח &lt;2.5 דקות לactivator chimeric לtranslocate לגרעין, נקשרים ה-DNA, ולהפעיל שעתוק. בעוד כמה אחרים במתגים יושמו בשמרים לנצל מולקולות שונות קטנות או תרופות (כולל המתגים הקלאסיים מבוסס דוקסיציקלין מEscherichia coli 7,8 ומתג מבוסס אינדיגו 9 מthaliana ארבידופסיס), אף השיגו את המהירות, סגוליות, או אטימות של רגולציה הוצגו על ידי המתגים המבוסס על ההורמון. ראוי להזכיר tכובע מהיר מחוץ למתגים יש גם פותחו בשמרים, ובדרך כלל עובד על ידי פיוזינג גן לפרוטאז או האנזים היוביקוויטין מיקוד רצף 2,10,11,12. היכולת להסיר במהירות חלבון מטרה מהתא מאפשרת המחקר של גנים חיוניים, כמו גם גנים שנוטים לדיכוי גנטי כאשר נמחקו 10. השיטות שתוארו בפרוטוקול זה הן לבנייה ואפיון סינטטי על מתגים בשמרים. ראשית, אנו מראים כיצד ליצור במהירות חלבוני היתוך genomically משולב המורכב מתחום מחייב-DNA של עניין, ליגנד מחייב תחום של קולטן אסטרוגן האנושי, וVP16 (DBD-EV של). בעקבות הפרוטוקול שלנו, חלבון ההיתוך בא לידי ביטוי מאמרגן ACT1. לאחר מכן, אנו מראים כיצד ליצור פלסמיד כתב מאותו מקור לATF ולבדוק את הפונקציונליות שלו באמצעות cytometry זרימה. למרות שאנו מדמיינים פלסמידים כתב אלה בשימוש עם ATFs החדש (איור 1), הם יכולים bדואר המשמש ככתבים לactivator תעתיק מקורי גם כן. לבסוף, את הפרטים לבדיקת ההשפעה של הפעלת ATF על צמיחת תאים בצלחות 96 היטב והנדסת אללים הגנומי מושרה מסופקים.

<table border="0" cellpadding="0" cellspacing="0" width="352">
	<colgroup>
		<col span="4" />
	</colgroup>
	<tbody>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Name of the Reagent</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments&#160;</td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Expand High Fidelity PCR System</td>
			<td style="width:88px;">Roche</td>
			<td style="width:88px;">11 732 650 001</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">T4 DNA Ligase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0202S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Competent E. coli</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">18258-012</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Estradiol</td>
			<td style="width:88px;">Tocris Biosciences</td>
			<td style="width:88px;">2824</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Ampicillin</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">BP1760-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">T4 Polynucleotide Kinase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0201</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">PBS</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">10010-23</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">Tween-20</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">9005-64-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">clonNAT</td>
			<td style="width:88px;">Jena Bioscience</td>
			<td style="width:88px;">AB-102L</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">XbaI</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R0145S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">NotI-HF</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R3189S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">CutSmart Buffer</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">B7204S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Glucose</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">D15-500</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Bacto-Peptone</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">211677</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Yeast Extract</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">210929</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Agarose</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">214010</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">100% Ethanol</td>
			<td style="width:88px;">Decon Laboratories</td>
			<td style="width:88px;">04-355-222</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">G418</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">11811-031</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:88px;">QIAGEN</td>
			<td style="width:88px;">27104</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Lithium acetate dihydrate</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">L-6883</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Salmon sperm DNA</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">93283</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">PEG 3350</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">P-3640</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plasmids pMN8 and pMN10; yeast strain yMN15</td>
			<td style="width:88px;">Noyes or Botstein labs</td>
			<td style="width:88px;"></td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Luria Broth</td>
			<td>Sigma-Aldrich</td>
			<td>L3397</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EQUIPMENT:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Material Name</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments (optional)</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">LSRII Flow Cyometer&#160;</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">Various Models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="103">
			<td height="103" style="height:103px;width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">Software for analyzing .FCS files from flow cytometry experiments</td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">R</td>
			<td style="width:88px;">Open Source</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">For analyzing growth-rate data from plate reader.&#160;</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Falcon Tubes</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">352052</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="52">
			<td height="52" style="height:52px;width:88px;">1.7 ml Eppendorf&#160; Tubes</td>
			<td style="width:88px;">GeneMate</td>
			<td style="width:88px;">C3262-1</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">250 ml Shake Flasks</td>
			<td style="width:88px;">Corning</td>
			<td style="width:88px;">4446-250</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">96-well, flat-bottom plates</td>
			<td style="width:88px;">Costar</td>
			<td style="width:88px;">3635</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plate Reader (Synergy H1 Multi-Mode Plate Reader)</td>
			<td style="width:88px;">BioTek</td>
			<td style="width:88px;">H1MG</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Breathe-Easy Membranes</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">Z380059-1PAK</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Thermocycler</td>
			<td style="width:88px;">various companies</td>
			<td style="width:88px;">Various models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">SC-Ura powder</td>
			<td style="width:88px;">MP Biomedicals</td>
			<td style="width:88px;">114410622</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">5-FOA</td>
			<td style="width:88px;">Zymo Research</td>
			<td style="width:88px;">F9001-1</td>
			<td style="width:88px;"></td>
		</tr>
	</tbody>
</table>

rapid synthesis and screening of chemically activated transcription factors with gfp-based reporters

ביולוגיה סינתטית שואפת לעצב באופן רציונלי ולבנות מעגלים סינטטיים עם מאפייני כמותיים רצויים, כמו גם לספק כלים לחקור את המבנה של מעגלי שליטת ילידים. בשני המקרים, את היכולת לתכנת את ביטוי הגנים באופנה מהירה ומתכוננת, ללא תופעות מחוץ יעד, יכולה להיות שימושית. יש לנו נבנו זני שמרים המכילים במעלה הזרם אמרגן ACT1 של קלטת URA3 אחריו תחום מחייב ליגנד של קולטן אסטרוגן האנושי וVP16. על ידי הפיכת זן זה עם מוצר ליניארי PCR המכיל תחום ה-DNA מחייב ובחירה נגד הנוכחות של URA3, גורם הביע constitutively מלאכותי שעתוק (ATF) יכול להיווצר על ידי רקומבינציה הומולוגית. ATFs המהונדס בצורה זו ניתן להפעיל גן יעד ייחודי בנוכחות המשדל, ובכך למנוע גם את ההפעלה מחוץ היעד ותנאי גידול nonphysiological נמצאים עם מיזוג נפוץמערכות ביטוי גני onal. שיטה פשוטה לבנייה המהירה של פלסמידים כתב ה-GFP שמגיבים באופן ספציפי לגורם שעתוק ילידים מלאכותי או של עניין היא גם סיפקה.

<html> איור 5 מראה אינדוקציה של ה-GFP על ידי Z 3 EV, Z 4 EV, או גב לאורך זמן. שים לב לעלייה בייצור ה-GFP בתגובה לATFs מכיל DNA nonyeast מחייב תחומים. אנחנו העריכו לאחרונה כי זה נובע מגורמים הללו השגת סגוליות של גן יחיד בשמרי הגנום 1. אינדוקציה גב לבד מובילה להפעלה / דיכוי של מאות גנים, ואילו Z EV 3 ו-Z EV 4 להפעיל רק ביטוי של גן המטרה להציב במורד הזרם של אמרגן סינטטי המכיל אתרי קישור מתאימים (5&#39;-GCGTGGGCG-3 &quot;ו5&#39;- GCGGCGGAGGAG-3 &quot;, בהתאמה) 1. איור 7 ממחיש את הרגולציה ההדוקה של המערכת (אין תוצאות inducer בשום GFP לזיהוי), וכי כל התאים מקבלים מושרה בתגובה למשדל היכולת של Z 3 EV כדי לגרום GFP על פני מגוון של ריכוזי β-אסטרדיול מוצגים באיור 8. <html> אף אוזן גרון &quot;עבור: לשמור-together.within-page =&quot; תמיד &quot;&gt; <img alt="איור 1" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig1highres.jpg" src="/files/ftp_upload/51153/51153fig1.jpg" /> איור 1. גורמי שעתוק מלאכותיים אינטראקציה עם Hsp90 בהעדר β-אסטרדיול. כאשר β-אסטרדיול נקשר ATF, Hsp90 dissociates, המאפשר ATF להיכנס לגרעין ולהפעיל את ביטוי מן כתב פלסמיד. <img alt="איור 2" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig2highres.jpg" src="/files/ftp_upload/51153/51153fig2.jpg" /> איור 2. סכמטי של פרוטוקול לזני הנדסה המכילים גורמי שעתוק מלאכותיים ובנייה / בדיקת כתבי ה-GFP מאותו מקור. &quot;Src =&quot; load/51153/51153fig3highres.jpg / files/ftp_upload/51153/51153fig3.jpg &quot;/&gt; איור 3. רצף ACT1pr-URA3-EV במתח yMN15 במוקד LEU2. <img alt="איור 4" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig4highres.jpg" src="/files/ftp_upload/51153/51153fig4.jpg" /> איור 4. עיצוב של primers PCR להגברת תחום מחייב-DNA של עניין עם הומולוגיה ברצף נוסף כדי לייצר חלבון היתוך חדש כאשר הפכו בהצלחה לyMN15. <img alt="איור 5" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig5highres.jpg" src="/files/ftp_upload/51153/51153fig5.jpg" /> איור 5. האינדוקציה ה-GFP על ידי שלושה זוגות ATF-אמרגן שונים בתגובה ל1 מיקרומטר β-אסטרדיול. &lt;/ P&gt; <img alt="איור 6" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig6highres.jpg" src="/files/ftp_upload/51153/51153fig6.jpg" /> איור 6. תסריט MATLAB לעיבוד זרימת cytometry נתונים. תסריט זה הותאם מ <a href="http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data">http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data.</a> <img alt="איור 7" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig7highres.jpg" src="/files/ftp_upload/51153/51153fig7.jpg" /> איור 7. אינדוקציה של ה-GFP על ידי Z EV 3 בתגובה ל0 μ M-β אסטרדיול ו1 מיקרומטר β-אסטרדיול הבא 18 שעות של אינדוקציה. הקרינה הייתה גם מאהנטול מתאים חסרי GFP כדי להמחיש את הרגולציה ההדוקה של מערכת EV Z 3. נתון זה נוצר באמצעות הקוד באיור 6. <img alt="איור 8" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig8highres.jpg" src="/files/ftp_upload/51153/51153fig8.jpg" /> איור 8. הקשר בין ריכוז משדל ופלט ביטוי הוא מדורג עם מקדם היל ~ 1. () הפצות של ביטוי ה-GFP כפונקציה של ריכוז β-אסטרדיול. (ב) הקרינה הממוצעת של ההפצות מ( א &#39;). הנתונים היו לנכון G הפונקציה (D) = D דקות G + (דקות המקסימום G-G) n / (K n + n D) כאשר D היא מינון β-אסטרדיול, דקות G ו-G מקסימום הם המינימום ו ערכי ה-GFP, מיל מקסימוםpectively, n הוא מקדם היל, ו-K הוא מינון β-אסטרדיול כי תשואות ½ (G המקסימום + G דקות). <table border="0" cellpadding="0" cellspacing="0" fo:keep-together.within-page="always" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> רצף oligonucleotide </td><td> שם </td></tr><tr><td> 5&#39;-TTGAAACCA AACTCGCCTCT-3 &quot; </td><td> DBD בדוק קדימה </td></tr><tr><td> 5&#39;-tccagagac ttcagggtgct-3 &quot; </td><td> בדוק היפוך DBD </td></tr></tbody></table> טבלת 1. צבעי יסוד למאשר היתוך נכון של DBD המעניין את הקולטן לאסטרוגן. פריימר קדימה הוא הומולוגי אמרגן ACT1 ופריימר ההפוכה היא הומולוגית לרצפטור אסטרוגן. לDBDs אופייני (~ 300 נ&quot;ב), המוצר ה-PCR הוא &lt;1.5 kb. <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> רצף oligonucleotide </td><td> שם </td></tr><tr><td> 5&#39;-ggccgc ... אתר binging DBD ... t-3 &quot; </td><td> אוליגו למעלה </td></tr><tr><td> 5&#39;-ctaga ... אתר קישור ה-DNA הפוך ... GC-3 &quot; </td><td> אוליגו התחתון </td></tr><tr><td> 5&#39;-gcc gcGTGGGCG T GCGTGGGCG G G CGTGGGCG T GCGTGGGCG G GCGTG GGCG T GCGTGGGCG &#39;t-3 </td><td> אתרי קישור אוליגו למעלה + 6x Zif268 </td></tr><tr><td> 5&#39;-ctagaCGCCCACGCACGCCCACGCC CGCCCACGCACGCCCACGCCCGCC CACGCACGCCCACgc-3 &quot; </td><td> אתרי קישור אוליגו התחתון + 6x Zif268 </td></tr></tbody></table> טבלה 2. Tructure S של פריימרים ליצירת dsDNA המכיל אתרי קישור של עניין. כדי ליצור Z 3 אמרגן EV-תגובה, oligonucleotides אוליגו למעלה + 6x אתרי קישור Zif268 ואוליגו התחתון + 6x Zif268 עקידה הייתה בשימוש.רצפים ליצירת סככות DNA הנכונים הם באותיות קטנות. אתר Zif268 ההסכמה מחייב, GCGTGGGCG, הוא הדגיש באוליגו העליון. <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> מגיב </td><td> הסכום </td></tr><tr><td> T4 Polynucleotide קינאז הצפת </td><td> 5 μl </td></tr><tr><td> T4 Polynucleotide קינאז (@ 10,000 יחידות / מיליליטר) </td><td> 1 μl </td></tr><tr><td> אוליגו למעלה (100 מיקרומטר) </td><td> 1.5 μl </td></tr><tr><td> אוליגו התחתון (100 מיקרומטר) </td><td> 1.5 μl </td></tr><tr><td> מים </td><td> 41 μl </td></tr></tbody></table> לוח 3. Phosphorylate ופריימרים לחשל בthermocycler באמצעות 50 μl של תגובה שתוארה לעיל. ישנם שני שלבי thermocycler. שלב 1: 37 מעלות צלזיוס 30 דקות (phosphorylate), ושלב 2: 95 ° שניות 30 C (להתפטר C ° 1 כל 30 שניות עד 4 ° C; לחשל). <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> מגיב </td><td> הסכום </td></tr><tr><td> XbaI </td><td> 1 μl </td></tr><tr><td> NotI-HF </td><td> 1 μl </td></tr><tr><td> פלסמיד דנ&quot;א </td><td> 5 μl (1-2 מיקרוגרם) </td></tr><tr><td> 10x Cut חכם הצפת </td><td> 5 μl </td></tr><tr><td> מים </td><td> 38 μl </td></tr></tbody></table> לוח 4. הגבלה לעכל של פלסמיד pMN8 עם XbaI וNotI. <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr height="22" style="height:16.5pt"><td class="xl65" height="22" style="height:16.5pt;width:66pt" width="88"> מגיב </td><td class="xl66" style="width:66pt" width="88"> הסכום </td></tr><tr height="43" style="height:32.25pt"><td> T4 האנזים buffer </td><td> 2 μl </td></tr><tr height="22" style="height:16.5pt"><td> T4 אנזים </td><td> 0.2 μl </td></tr><tr height="43" style="height:32.25pt"><td> עמוד השדרה @ 10 ng / μl </td><td> 1 μl </td></tr><tr height="106" style="height:79.5pt"><td> רצפי העקידה @ ריכוז / μl טוחנת 5x </td><td> 1 μl </td></tr><tr height="22" style="height:16.5pt"><td> מים </td><td> 15.8 μl </td></tr></tbody></table> לוח 5. ולקשור אתרי קישור לפלסמיד דנ&quot;א. <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> תחל </td><td> תיאור </td></tr><tr><td> ~ 40 נ&quot;ב במעלה הזרם של ATG + &#39;CGCACTTAACTTCGCATCTG-3 </td><td> פריימר קדימה להגברת KanMX-יזם </td></tr><tr><td> 5&#39;-הפוך משלימים (ATG + ~ 37bp) + TATAGTTTTTTCTCCTTGACG-3 &quot; </td><td> הפוך פריmer להגברת KanMX-יזם </td></tr><tr><td> 5&#39;-caatttgtctgctcaagaaaataaa ttaaatacaaataaaCGCAC TTAACTTCGCATCTG-3 &quot; </td><td> פריימר קדימה לביצוע החלפת אמרגן GCN4. </td></tr><tr><td> 5&#39;-tggatttaaagcaaataaacttgg ctgatattcggacatTATAGTT TTTTCTCCTTGACG-3 &quot; </td><td> הפוך פריימר לביצוע החלפת אמרגן GCN4. </td></tr></tbody></table> לוח 6. PCR להגביר KanMX-יזם לביצוע אלל titratible.

Watch this Scientific Journal Video about Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters at JoVE.com

Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

פרוטוקול זה מתאר הליך ניסיוני לבנייה המהירה של גורמי שעתוק מלאכותיים (ATFs) עם כתבי ה-GFP מאותו מקור וכימות של יכולת ATFs כדי לעורר ביטוי של GFP באמצעות cytometry זרימה.

סינתזה והקרנה של גורמי שעתוק הופעל כימי עם כתבים המבוסס על ה-GFP מהיר

Synthetic biology aims to rationally design and build synthetic circuits with desired quantitative properties, as well as provide tools to interrogate the ...

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 1

Transcription: DNA to RNA

SCIENTISTS IN ACTION

Generation of Human CD40-activated B cells

הדור של האדם CD40 בתאי B המופעל

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer ...

Fluorescence Activated Cell Sorting of Plant Protoplasts

מיון פלואורסצנטי תא פעיל של Protoplasts הצמח

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

תפוקה גבוהה הקרנת ו biosensing עם פלורסנט ג elegans מתחים

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron (dgn)-destabilized Green Fluorescent Protein (GFP)-based Reporter Protein

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron dgn-destabilized Green Fluorescent Protein GFP-based Reporter Protein

ניטור של פעילות יוביקוויטין-הפרוטאזום בתאי חיים באמצעות ערער-חלבון Degron (DGN) ירוק פלורסנט חלבון (GFP)-מבוסס כתב

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. ...

Synthesis of Nine-atom Deltahedral Zintl Ions of Germanium and their Functionalization with Organic Groups

סינתזה של לתשעה אטום יונים Zintl Deltahedral של גרמניום functionalization שלהם עם קבוצות אורגניים

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

הכרומטין ניתוח אינטראקציה עם מנבא סוף תג הרצף (Chia-PET) עבור מיפוי אינטראקציות הכרומטין הבנת תקנה תמלול

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

A Chemical Screening Procedure for Glucocorticoid Signaling with a Zebrafish Larva Luciferase Reporter System

הליך מיון כימי לGlucocorticoid איתות עם מערכת כתב דג הזברה הזחל בלוציפראז

Glucocorticoid stress hormones and their artificial derivatives are widely used drugs to treat inflammation, but long-term treatment with glucocorticoids ...

Using Coculture to Detect Chemically Mediated Interspecies Interactions

שימוש Coculture לזהות אינטראקציות interspecies המתווכת כימית

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

מהירה ויעילה דג הזברה Genotyping באמצעות PCR עם רזולוציה גבוהה ממיסים ניתוח

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

RNA Isolation from Cell Specific Subpopulations Using Laser-capture Microdissection Combined with Rapid Immunolabeling

בידוד RNA מן אוכלוסיות תאים ספציפיות באמצעות Microdissection לייזר ללכוד בשילוב עם ראפיד immunolabeling

Laser capture microdissection (LCM) allows the isolation of specific cells from thin tissue sections with high spatial resolution. Effective LCM requires ...