Name: stimulation of cytoplasmic dna sensing pathways in vitro and in vivo
Uploaded: 2014-09-18T13:00:00
Description: Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

الكتاب ليس لديهم الاعترافات.

1. Concatemerization <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> الاشعال في resuspend مهاجم ورف (انظر جدول المواد للتسلسل التمهيدي) إلى تركيز 10 ميكروغرام / ميكرولتر في الصف البيولوجيا الجزيئية H 2 O. ثم، مزيج 5 ميكرولتر من مهاجم و5 ميكرولتر من رف التمهيدي في أنبوب microcentrifuge ...

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

وتستخدم بروتوكولات الموصوفة هنا إلى توليد dsDNA لتحفيز الاستجابة المناعية الفطرية عصاري خلوي مع نتائج استنساخه في مجموعة واسعة من أنواع الخلايا في الجسم الحي و. منذ كاشف الركيزة الرئيسي المستخدم هو قليل النوكليوتيد الاصطناعية، وهناك مرونة في هذا النظام لاستخدام...

الحمض النووي هو مكون أساسي من مكونات كل الكائنات الحية والخلايا، والتي تبقي حقيقيات النوى في مقصورات محددة. واحد وظيفة الجهاز المناعي الفطري هي تحديد عندما يكسر هذا التقسيم لأسفل أو عند إدخال مواد غريبة في الحي عبر خرق والحواجز المادية الخارجية. في جسم الإنسان هناك عدد من البروتينات التي توجد للمساعدة تتحلل كميات صغيرة من الحمض النووي التي قد هربا من التقسيم الصحيح. الدناز I، II، III وتحطيم الحمض النووي في البلازما، دخلول؛ جسيم داخلي، والعصارة الخلوية، على التوالي. ومع ذلك، فقد تبين أن الفئران التي تفتقر إلى الدناز الثاني تموت من فقر الدم الشديد الناجم عن الإفراط في إنتاج إنترفيرون 1 مما يشير إلى أن نظام المناعة الفطري يستجيب لDNA خارج النووي. حدوث هذه الاستجابة حتى في الفئران التي تعاني من نقص تماما في قدرة مستقبلات الإشارات شبيهة عدد القتلى. وقد أظهرت العديد من الدراسات الآن أن مشجعا للجينات الانترفيرون (STING) 2 وملزم TANK كيناز 1 (TBوتشارك K1) 3 في الكشف عن الحمض النووي في السيتوبلازم وهذا يشير مسار ينشط عامل الانترفيرون التنظيمي (IRF) -3 4. والتي تعتمد على IRF3 النسخ اللاحقة من خلوى، chemokine، وجينات الانترفيرون هو سمة من الاستجابة المناعية الفطرية إما الممرض أو الخطر المرتبطة نمط الجزيئية (PAMP أو رطبة) 5. وقد أدت الرغبة في دراسة مسارات الاستشعار الحمض النووي داخل الخلايا لمتطلبات لتطوير أساليب قوية وقابلة للتكرار لتحفيز الخلايا عن طريق إدخال DNA أو RNA في الخلايا من دون تنشيط الاستجابات المناعية الفطرية الأخرى. واحدة الطريقة التي يمكن حفز STING / TBK1 / IRF3 المسار هو باستخدام الكواشف ترنسفكأيشن الدهون الموجبة لتقديم حامض النووي في السيتوبلازم حيث يمكن الوصول إليها من قبل أجهزة الاستشعار DNA مثل DNA-PK، IFI16، وcGAS 6-8. خصائص الحمض النووي التي تفهم حاليا للسماح للممثل المؤسسةتفعيل icient من الاستجابة المناعية الفطرية هيولي دون تحفيز مسارات غيرها من طوله والكتلة، والنقاء، وعدم وجود الدليل السياسي الشامل الزخارف 4،7،9. أليغنوكليوتيد] الاصطناعية هي مناسبة للغاية لغرض توليد استجابة مناعية فطرية لأنها تسمح تسلسل الحمض النووي ليكون الأمثل وإعداد كنوع كيميائية نقية. وحددت الحمض النووي (ISD) تسلسل المناعة تنشيطية 45 زوج قاعدة من القبعة وآخرون. 4 عن كونه مناسبة، تسلسل مجانا الدليل السياسي الشامل لهذا الغرض. هذا التسلسل dsDNA هو إلا عشوائية وليس لديه سمات محددة وراء افتقارها إلى زخارف الدليل السياسي الشامل. لقد وجدنا أن من concatemerizing قليل النوكليوتيد ISD إلى خيوط أطول بشكل ملحوظ يزيد من حجم التحفيز 7. جيل من ISD concatemerized بالتالي فهو مفيد لتحفيز الاستجابة المناعية الفطرية حشوية. هنا نقدم بروتوكولات لإعداد هذا كاشف وكيف يمكن استخدامها لتفعيل مسار الاستشعار عن الحمض النووي فيالمختبر كذلك في الجسم الحي. ملاحظة: يتم تنفيذ كافة الدراسات على الحيوانات تحت بروتوكولات المؤسسية المعتمدة والمبادئ التوجيهية رعاية الحيوان.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

من أجل تحفيز كفاءة الاستجابة المناعية الفطرية، يجب أن يكون الحمض النووي من طول ونقاء كافية. نقدم طريقة حيث تقطعت بهم السبل الحمض النووي المزدوج (dsDNA) الذي له خصائص المطلوبة لتحفيز DNA حشوية يمكن أن تتولد مسارات الاستشعار بثمن بخس وبكل سهولة. قبل concatemerization من، أليغنوكليوتيد] الاصطناعية قصيرة (التي تفتقر إلى زخارف الدليل السياسي الشامل)، يمكن أن تتولد dsDNA أن يكون من طول كافية لتفعيل عصاري خلوي مسار الاستشعار DNA. هذا البروتوكول يتضمن ربط نهاية حادة من أليغنوكليوتيد] في وجود البولي ايثيلين جلايكول (PEG)، والذي يوفر بيئة للربط كفاءة تحدث. وconcatemers dsDNA يمكن استخدامها بعد تنقية عن طريق استخراج الفينول / الكلوروفورم، لمحاكاة الاستجابة المناعية الفطرية في المختبر بواسطة بروتوكولات ترنسفكأيشن القياسية. ويمكن أيضا أن تستخدم هذا الحمض النووي لتحفيز المناعة الفطرية في الجسم الحي عن طريق الحقن داخل الأدمة في الصيوان الأذن على فأرة الحاسوب، على سبيل المثال. بواسطةتوحيد عملية concatemerization والبروتوكولات التحفيز لاحقة، يمكن أن تنتج وتفعيل موثوقة وقابلة للتكرار للنظام المناعة الفطري.

<html> نتائج أدناه تشير إلى أن الحمض النووي concatemerized يمكن أن تتولد بسهولة نسبية، وقادر على تحفيز استجابة مناعية فطرية قوية في خلايا بشرية وفي فئران. مع استخدام PEG8000، يمكن أن نرى بوضوح أن طول الحمض النووي التي يتم توليدها بشكل ملحوظ أطول وقادرة على إحداث نفس القدر من النسخ ...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

تحفيز حشوية DNA الاستشعار عن مسارات<em&gt; في المختبر</em&gt; و<em&gt; في فيفو</em

الهدف من البروتوكول هو استخدام الأساليب المثلى لتحفيز مسارات الاستشعار عن الحمض النووي في خلايا حشوية والحية. ويتحقق ذلك من خلال تحسين توليد DNA طويلة، المزدوج تقطعت بهم السبل أثناء حادة في نهاية ربط. الخلايا أو الفئران ثم يتم transfected باستخدام كاشف ترنسفكأيشن الدهون.

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

في المختبر والمجراة في ضوء بارد مراسل التصوير الجيني للخلايا منشأ جنينية بشرية

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

ترنسفكأيشن الحمض النووي لعضلات الهيكل العظمي باستخدام الثدييات في فيفو Electroporation

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo and in vitro Studies of Adaptor-clathrin Interaction

في الجسم الحي والدراسات في المختبر من محول - clathrin التفاعل

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

MG53 تصور بوساطة غشاء الخلية عن طريق إصلاح في الجسم الحي و في المختبر أنظمة

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

تفعيل موت الخلايا المبرمج من قبل Microinjection هيولي من السيتوكروم ج</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

عزلة البروتينية ريبوسوم الوليدة منضم<em&gt; في المختبر</em&gt; لتحديد المواقع وقفة بالحركة على طول مرنا

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

بروتين ج-FOS كشف Immunohistological: أداة مفيدة كعلامة للممرات الوسطى تشارك في الاستجابات الفسيولوجية محددة<em&gt; في فيفو</em&gt; و<em&gt; فيفو السابقين</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

عزل الترشيح من الأحماض النووية: وبسيطة وسريعة استخراج الحمض النووي الطريقة

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

قياس امتصاص الجلوكوز والاستجابة لتحفيز الأنسولين في<em&gt; في المختبر</em&gt; مثقف الإنسان ميوتوبيس الابتدائية

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

في المختبر و في فيفو النهج لتحديد نفاذية الخلايا الظهارية المعوية

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...