Name: stimulation of cytoplasmic dna sensing pathways in vitro and in vivo
Uploaded: 2014-09-18T13:00:00
Description: Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

The authors have no acknowledgments.

1. Concatemerization <ol><li> Resuspender primere Fw og Rv (se tabel af materialer til primersekvenser) til en koncentration på 10 ug / ul i molekylær biologi klasse H 2 O. Derefter blandes 5 pi Fw og 5 pi Rv primer i et 1,5 ml mikrocentrifugerør. </li><li> Anneal primerblanding ved opvarmning til korrekt annealing temperatur (75 ° C i primerne beskrevet her) i 15 minutter. Lad på bænken til at afkøle ved stuetemperatur (RT). Forbered 60% PEG8000 i løbet af denne inkubation den ved at opløse i Hede...

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

The protocols described here are used to generate dsDNA to stimulate the cytosolic innate immune response with reproducible results in a wide range of cell types and in vivo. Since the main substrate reagent used is a synthetic oligonucleotide, there is flexibility in this system for using alternative DNA sequences or chemical modifications. It is possible, for instance, to replace the forward strand oligonucleotide described in this protocol with one that contains a fluorescent label or a biotin moiety to track...

DNA er en vital del af alle organismer og celler, der eukaryoter holder i bestemte rum. En funktion af det medfødte immunsystem er at identificere, når en sådan opdeling bryder ned, eller når udenlandsk materiale indføres i organismen via en overtrædelse af fysiske, ydre barrierer. I den menneskelige krop er der en række af proteiner, der findes til at hjælpe nedbryde små mængder af DNA, som kan undslippe korrekt opdeling; DNAse I, II og III nedbryde DNA i plasma, endosom, og cytosolen, hhv. Det har dog vist, at mus, der manglede DNAse II dør af alvorlig blodmangel forårsaget af overdreven produktion af interferoner 1 tyder på, at det medfødte immunsystem reagerer på ekstra-kerne-DNA. Denne reaktion forekommer selv i mus, som er fuldstændig mangelfuld i toll-lignende receptor signalering kapacitet. Talrige undersøgelser har nu vist, at stimulator af interferon gener (STING) 2 og tank-bindende kinase 1 (TBK1) 3 er involveret i påvisning af DNA i cytoplasmaet, og at denne signalvej aktiverer interferon regulatorisk faktor (IRF) -3 4. Den efterfølgende IRF3-afhængig transskription af cytokin, kemokin, og interferon-gener er karakteristisk for en reaktion på enten et patogen eller fare forbundet molekylær mønster (PAMP eller DAMP) 5 medfødte immunreaktion. Ønsket om at studere intracellulære nukleinsyre sensing veje har ført til krav om at udvikle solide og reproducerbare metoder til stimulering af celler ved at indføre DNA eller RNA i celler uden at aktivere andre medfødte immunrespons. En metode, som STING / TBK1 / IRF3 vej kan stimuleres, er ved hjælp af kationiske lipid transfektionsreagenser at levere nukleinsyre i cytoplasmaet, hvor det kan tilgås af DNA-sensorer, såsom DNA-PK, IFI16 og cGAS 6-8. Egenskaberne af DNA, som i øjeblikket forstås at tillade efficient aktivering af reaktion den cytoplasmiske medfødte immunsystem uden stimulering af andre veje er dens længde, masse, renhed og manglende CpG motifs 4,7,9. Syntetiske oligonukleotider er meget velegnet til det formål at generere en medfødte immunreaktion, da de tillader den DNA-sekvens, der skal optimeres, og fremstilles som et rent kemisk art. En 45 basepar immunstimulerende DNA (ISD) sekvens blev identificeret ved Stetson et al. 4 som værende et egnet CpG-fri sekvens til dette formål. Denne dsDNA sekvens er ellers tilfældig og har ingen særlige kendetegn ud over sin mangel på CpG-motiver. Vi har fundet, at ved concatemerizing ISD oligonukleotid i betydeligt længere tråde forøger størrelsen af stimulering 7. Generering af concatemerized ISD er derfor nyttig til at stimulere en respons cytoplasmatisk medfødte immunforsvar. Her præsenterer vi protokoller for at forberede dette reagens, og hvordan det kan bruges til at aktivere DNA sensing vej iin vitro såvel som in vivo. BEMÆRK: Alle dyreforsøg udføres under godkendte institutionelle protokoller og retningslinjer dyreplejepraksis.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

For effektivt at stimulere en respons medfødte immunforsvar, skal DNA være af tilstrækkelig længde og renhed. Vi præsenterer en metode, hvor dobbeltstrenget DNA (dsDNA), som har de fornødne egenskaber til at stimulere den cytoplasmatiske DNA-sensing veje kan genereres billigt og med lethed. Ved concatemerization af korte, syntetiske oligonukleotider (som mangler CpG-motiver), kan dsDNA genereres for at være tilstrækkelig lang til at aktivere cytosoliske DNA-sensing vej. Denne protokol omfatter stumpendeligering af oligonucleotiderne i nærværelse af polyethylenglycol (PEG), der skaber et miljø til effektiv ligering at forekomme. De dsDNA concatemerer kan anvendes efter oprensning ved phenol / chloroform-ekstraktion, for at simulere immunresponset medfødte in vitro ved standard transfektionsprotokoller. Dette DNA kan også anvendes til at stimulere medfødte immunitet in vivo ved intradermal injektion i øret pinna af en mus, f.eks. Vedstandardisere concatemerization processen og efterfølgende stimulering protokoller kan en pålidelig og reproducerbar aktivering af det medfødte immunsystem blive produceret.

<html> Resultaterne nedenfor viser, at concatemerized DNA kan genereres med relativ lethed og er i stand til at stimulere en robust immunrespons medfødt i celler og i mus. Med brugen af ​​PEG8000, kan det tydeligt ses, at længden af ​​DNA, der genereres, er væsentligt længere og lige stand til at inducere transkription af CXCL10. Som det ses ved agarosegel-analyse standard concatemerization har længder af DNA på op til 800 basepar (bp), mens der for prøven med PEG8000, længden af DNA indbefatter tråde p?...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

Stimulering af Cytoplasmatiske DNA Sensing Pathways<em&gt; In Vitro</em&gt; Og<em&gt; In Vivo</em

Formålet med protokollen er at anvende optimale metoder til stimulering af de cytoplasmatiske DNA sensing veje i celler og in vivo. Dette opnås ved at forbedre dannelsen af ​​lange, dobbeltstrenget DNA under stumpendeligering. Celler eller mus transficeres derefter ved hjælp af et lipid transfektionsreagens.

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo and in vitro Studies of Adaptor-clathrin Interaction

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolering af ribo Bundet Gryende polypeptider<em&gt; In vitro</em&gt; Til at identificere Translationelle Pause steder langs mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

C-FOS Protein Immunohistologisk Detection: Et nyttigt værktøj som en markør for Central involverede veje i specifikke fysiologiske reaktioner<em&gt; In vivo</em&gt; og<em&gt; Ex vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

Filtrering Isolering af nukleinsyrer: en enkel og hurtig DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Måling af glukoseoptagelse og reaktion på insulinstimulering i<em&gt; In Vitro</em&gt; Cultured Human Primary Myotubes

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...