Name: stimulation of cytoplasmic dna sensing pathways in vitro and in vivo
Uploaded: 2014-09-18T13:00:00
Description: Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

De auteurs hebben geen erkenningen.

1 Concatemerization <ol><li> Resuspendeer primers Fw en Rv (zie Tabel Materialen primer sequenties) tot een concentratie van 10 ug / ul in moleculaire biologie rang H2O Vervolgens Meng 5 gl Fw en 5 gl Rv primer in een 1,5 ml microcentrifugebuis. </li><li> Gloei primer mix door verhitting tot de juiste hybridisatietemperatuur (75 ° C voor de hier beschreven primers) gedurende 15 minuten. Laat op de bank te laten afkoelen bij kamertemperatuur (RT). Bereid de 60% ​​PEG8000 tijdens deze incubatie door het ...

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

De hier beschreven protocollen gebruikt om dsDNA genereren om de cytosolische aangeboren immuunrespons reproduceerbare resultaten in diverse celtypes en in vivo stimuleren. Aangezien het belangrijkste substraat reagens is een synthetisch oligonucleotide, flexibel wordt dit systeem gebruik van alternatieve DNA-sequenties of chemische modificaties. Het is bijvoorbeeld mogelijk om de voorwaartse streng oligonucleotide in dit protocol beschreven die een fluorescent label of een biotinegroep localisatie volgen of be...

DNA is een essentieel onderdeel van alle organismen en cellen, die eukaryoten specifieke compartimenten houden. Een functie van het aangeboren immuunsysteem is bepaald wanneer dergelijke compartimentering afbreekt of wanneer vreemd materiaal wordt geïntroduceerd in het organisme via een schending van fysieke, externe barrières. In het menselijk lichaam zijn er een aantal eiwitten die bestaan ​​om degraderen kleine hoeveelheden DNA die de juiste compartimentalisatie ontsnappen; DNAse I, II en III breken DNA in het plasma, endosoom en cytosol, respectievelijk. Echter is aangetoond dat muizen die DNAse II sterven aan ernstige anemie veroorzaakt door overmatige productie van interferonen 1, suggereert dat het aangeboren immuunsysteem reageert op extra-nucleair DNA. Deze reactie gebeurt zelfs bij muizen die volledig tekort aan toll-like receptor signalering capaciteit zijn. Talrijke studies hebben nu aangetoond dat de stimulator van interferon genen (STING) 2 en-TANK bindend kinase 1 (TBK1) 3 zijn betrokken bij de detectie van DNA in het cytoplasma en dat deze signaaltransductieweg activeert interferon regulerende factor (IRF) -3 4. De daaropvolgende IRF3-afhankelijke transcriptie van cytokine, chemokine, en interferon genen is kenmerkend voor een aangeboren immuunrespons op ofwel een pathogeen of gevaar in verband moleculaire patroon (PAMP of vochtig) 5. De wens om intracellulaire nucleïnezuur sensing pathways onderzoeken heeft geleid tot de behoefte aan robuuste en reproduceerbare werkwijzen voor het stimuleren van cellen door het introduceren van DNA of RNA in cellen zonder activering andere aangeboren immuunresponsen te ontwikkelen. Een methode waardoor de STING / TBK1 / IRF3 route kan worden gestimuleerd is door kationische lipiden transfectie reagentia nucleïnezuur leveren in de cytoplasma waar het toegankelijk is door DNA sensoren zoals DNA-PK, IFI16 en cgas 6-8. De kenmerken van DNA die momenteel verstaan ​​eff toestaanicient activatie van de cytoplasmatische aangeboren immuunrespons zonder stimulatie van andere routes zijn de lengte, massa, zuiverheid, en ontbreken van CpG motieven 4,7,9. Synthetische oligonucleotiden zijn zeer geschikt voor het opwekken van een aangeboren immuunrespons toelaten DNA-sequentie te optimaliseren en bereid als zuivere chemische species. Een 45 base paar immuno-stimulerende DNA (ISD) sequentie werd geïdentificeerd door Stetson et al. 4 als een geschikt CpG-free sequentie voor dit doel. Dit dsDNA sequentie is anders willekeurige en geen specifieke kenmerken buiten het ontbreken van CpG motieven. Wij hebben gevonden dat door concatemerizing de ISD oligonucleotide in aanzienlijk langere strengen verhoogt de grootte van de stimulatie 7. Generatie concatemerized ISD is daarom nuttig voor het stimuleren van een cytoplasmatisch aangeboren immuunrespons. Hier presenteren we protocollen voor de voorbereiding van dit reagens en hoe het kan worden gebruikt om de DNA sensing route in activerenalsmede vitro in vivo. OPMERKING: Alle dierproeven worden uitgevoerd op basis van goedgekeurde institutionele protocollen en verzorging van dieren richtlijnen.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

Om efficiënt te stimuleren van een aangeboren immuunrespons, moet het DNA van voldoende lengte en zuiverheid zijn. We presenteren een werkwijze waarbij dubbelstrengs DNA (dsDNA) de benodigde eigenschappen moet het cytoplasmatische DNA sensing pathways kan goedkoop en gemakkelijk worden gegenereerd stimuleren. Door de concatemerization van korte, synthetische oligonucleotiden (die CpG motieven ontbreekt), kan dsDNA worden gegenereerd te zijn van voldoende lengte om de cytosol DNA sensing pathway activeren. Dit protocol betreft ligatie van stompe uiteinden van de oligonucleotiden in de aanwezigheid van polyethyleenglycol (PEG), die een omgeving voor efficiënte ligatie optreden bepaalt. De dsDNA concatemeren kan worden gebruikt na zuivering door middel van fenol / chloroform extractie, voor de aangeboren immuunrespons in vitro door standaard transfectie protocollen simuleren. Het DNA kan ook worden gebruikt om aangeboren immuniteit in vivo door intradermale injectie aangemoedigd de oor oorschelp van een muis, bijvoorbeeld. Doorstandaardiseren het concatemerization proces en de daaropvolgende stimulatie protocollen kan een betrouwbare en reproduceerbare activering van het aangeboren immuunsysteem worden geproduceerd.

<html> De onderstaande resultaten geven aan dat concatemerized DNA kan worden gemaakt met relatief gemak en kan stimuleren een robuuste aangeboren immuunrespons in cellen en in muizen. Met het gebruik van PEG8000, is duidelijk te zien dat de lengte van DNA worden gegenereerd aanzienlijk langere en even geschikt induceren transcriptie van CXCL10. Zoals gezien door agarosegel-analyse, standaard concatemerization heeft een lengte van DNA van 800 baseparen (bp), terwijl het monster met PEG8000, de lengte van DNA strengen omv...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

Stimulatie van Cytoplasmatische DNA Sensing Pathways<em&gt; In Vitro</em&gt; En<em&gt; In Vivo</em

Het doel van het protocol optimale methoden voor het stimuleren van het cytoplasmatische DNA sensing trajecten in cellen en in vivo. Dit wordt verwezenlijkt door het genereren van lange, dubbelstrengs DNA tijdens blunt-end ligatie. Cellen of muizen worden vervolgens getransfecteerd met een lipide transfectie reagens.

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

In vitro en in vivo bioluminescente reportergen-beeldvorming van menselijke embryonale stamcellen

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

DNA Transfectie van zoogdieren skeletspieren met behulp van In Vivo Elektroporatie

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo en in vitro studies van Adapter-clathrine Interactie

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Visualisatie van MG53-gemedieerde celmembraan Reparatie gebruik In vivo En In vitro Systemen

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Activering van apoptose door Cytoplasmatische micro-injectie van Cytochroom C</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolatie van Ribosoom Bound Nascent Polypeptiden<em&gt; In vitro</em&gt; Om Translationeel Pauze plaatsen langs mRNA identificeren

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

De c-FOS Protein Immunohistologische Detection: Een handig hulpmiddel als een marker van Central Pathways betrokken bij specifieke fysiologische reacties<em&gt; In Vivo</em&gt; en<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

Filtratie Isolatie van nucleïnezuren: Een eenvoudige en snelle DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glucoseopname-meting en respons op insuline stimulatie in<em&gt; In Vitro</em&gt; Cultured Human Primary Myotubes

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro en In Vivo benaderingen te bepalen van intestinale epitheliale cel permeabiliteit

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...