Name: stimulation of cytoplasmic dna sensing pathways in vitro and in vivo
Uploaded: 2014-09-18T13:00:00
Description: Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

אי לנו תודות.

.1 Concatemerization <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> פריימרים Resuspend Fw וRv (ראו טבלה של חומרים לרצפי פריימר) לריכוז של 10 מיקרוגרם / μl בH הכיתה ביולוגיה מולקולרית 2 O. לאחר מכן, לערבב 5 μl של Fw ו5 μl של פריימר Rv בצינור 1.5 מ&quot;ל microcentrifuge. </li><li style=";text-align:right;direction:rtl"> ?...

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

הפרוטוקולים המתוארים כאן משמשים ליצירת dsDNA כדי לעורר את התגובה החיסונית המולדת cytosolic עם תוצאות לשחזור במגוון רחב של סוגי התאים וin vivo. מאז מגיב המצע העיקרי המשמשים הוא oligonucleotide סינטטי, יש גמישות במערכת זו לשימוש ברצפי DNA חלופיים או שינויים כימיים. זה אפשרי, למשל, לה...

DNA הוא מרכיב חיוני של כל היצורים והתאים, שאאוקריוטים לשמור בתאים ספציפיים. פונקציה אחת של מערכת החיסון המולדת היא לזהות כאשר מידור כזה מתקלקל או כאשר חומר זר מוחדר האורגניזם באמצעות הפרת מחסומים פיזיים, חיצוניים. בגוף האדם יש מספר החלבונים שקיימים כדי לעזור לבזות כמויות קטנות של DNA שעשויה לברוח המידור הנכון; DNAse I, II, III ולשבור DNA בפלזמה, endosome, וcytosol, בהתאמה. עם זאת, זה כבר הראה כי עכברים חסרי DNAse השני למות מאנמיה קשה שנגרמה על ידי ייצור מוגבר של האינטרפרונים 1 מצביעים על כך שמערכת החיסון המולדת מגיבה לDNA במיוחד גרעיני. תגובה זו מתרחשת גם בעכברים שהם לגמרי חסרי יכולת איתות קולט חיוג כמו. מחקרים רבים כעת מוצגים ממריץ שגני אינטרפרון (סטינג) 2 וקינאז מחייב TANK 1 (TBK1) 3 מעורבים בזיהוי של DNA בציטופלסמה ושמסלול איתות זה מפעיל גורם אינטרפרון רגולציה (IRF) -3 4. שעתוק IRF3 תלוי הבא של ציטוקין, chemokine, וגני אינטרפרון הוא אופייני לתגובה חיסונית מולדת או פתוגן או סכנה הקשורים דפוס מולקולרי (PAMP או לח) 5. הרצון ללמוד מסלולי חישת חומצות גרעין תאיים הוביל לדרישה לפתח שיטות חזקות ושחזור לגירוי תאים על ידי החדרת דנ&quot;א או רנ&quot;א לתוך תאים ללא הפעלת תגובה חיסונית מולדת אחרת. שיטה אחת שבאמצעותו יכול להיות מגורה את העוקץ / TBK1 / מסלול IRF3 היא באמצעות חומרים כימיים transfection שומנים בדם קטיוני כדי לספק חומצות גרעין לתוך הציטופלסמה שבו ניתן להגיע על ידי חיישני DNA כגון DNA-PK, IFI16, וcGAS 6-8. המאפיינים של DNA שהם הבינו כעת כדי לאפשר effהפעלת icient של תגובת החיסון המולדת cytoplasmic ללא גירוי של מסלולים אחרים שלה אורך, מסה, טוהר, וחוסר CPG מוטיבי 4,7,9. oligonucleotides סינטטי מתאים ביותר לצורך הפקת תגובה חיסונית מולדת מאחר שהם מאפשרים את רצף DNA להיות מותאמים ומוכן כמו לתרכובות כימיות טהורות. רצף חיסוני גירוי 45 זוג בסיס DNA (ISD) זוהה על ידי et al כובע רחב שולי. 4 כרצף מתאים, CPG ללא למטרה זו. רצף dsDNA זה אחרת אקראי ואין לו תכונות ספציפיות מעבר לחוסר המוטיבים CPG. מצאנו כי על ידי concatemerizing oligonucleotide ISD לגדילים ארוכים יותר מגביר באופן משמעותי את גודל הגירוי 7. דור של ISD concatemerized לכן הוא שימושי עבור גירוי תגובה חיסונית מולדת cytoplasmic. כאן אנו מציגים פרוטוקולים להכנה מגיב זה וכיצד ניתן להשתמש בו כדי להפעיל את מסלול חישת DNA במבחנה, כמו גם in vivo. הערה: כל המחקרים בבעלי החיים מתבצעים תחת פרוטוקולים מוסדיים אושרו והנחיות טיפול בבעלי החיים.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

כדי לעורר תגובה חיסונית מולדת ביעילות, DNA חייב להיות באורך ובטהרה מספיק. אנו מציגים שיטה בי גדילי הדנ&quot;א כפול (dsDNA) שבו יש את המאפיינים הדרושים כדי לעורר את DNA cytoplasmic יכולים להיות שנוצר מסלולי חישה במחיר זול ובקלות. על ידי concatemerization של oligonucleotides הקצר, סינטטי (אשר חסרים מוטיבים CPG), יכול להיות שנוצר dsDNA להיות באורך מספיק כדי להפעיל את מסלול חישת DNA cytosolic. פרוטוקול זה כרוך קשירת קצה קהה של oligonucleotides בנוכחות פוליאתילן גליקול (PEG), המספקת סביבה לקשירה יעילה להתרחש. ניתן להשתמש concatemers dsDNA, הבא לטיהור על ידי מיצוי פנול / כלורופורם, כדי לדמות את התגובה החיסונית המולדת במבחנה על ידי פרוטוקולי transfection סטנדרטיים. גם DNA זה יכול לשמש כדי לעורר חסינות מולדת in vivo על ידי הזרקת intradermal לתוך אפרכסת אוזנו של עכבר, למשל. על ידיתקנון תהליך concatemerization ופרוטוקולי גירוי שלאחר מכן, הפעלה אמינה ושחזור של מערכת החיסון המולדת יכולה להיות מיוצר.

<html> התוצאות להלן מצביעות על כך שDNA concatemerized יכול להיות שנוצר בקלות יחסית, והוא מסוגל גירוי תגובה חיסונית מולדת חזקה בתאים ובעכברים. עם השימוש בPEG8000, זה ניתן לראות בבירור כי אורך DNA שנוצר הוא באופן משמעותי יותר ומסוגל גרימת שעתוק של Cxcl10 באותה מידה. כפי שניתן לראות על ידי נ...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

גירוי של cytoplasmic מסלולי חישה DNA<em&gt; במבחנה</em&gt; ו<em&gt; בVivo</em

מטרת הפרוטוקול היא להשתמש בשיטות אופטימליות לגירוי מסלולי חישת DNA cytoplasmic בתאי in vivo. זו מושגת על ידי שיפור הדור של DNA הארוך, פעמיים תקועים בקשירה בוטה סוף. תאים או עכברים אז transfected באמצעות מגיב transfection שומנים בדם.

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

במבחנה פליטת אור הדמיה vivo ג&#39;ין הכתב של בתאי גזע עובריים אנושיים

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

ה-DNA transfection של שרירי השלד היונקים באמצעות In vivo Electroporation

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo ו במבחנה של אינטראקציה מתאם-clathrin

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

ויזואליזציה של תיקון MG53 בתיווך קרום התא באמצעות In vivo ו במבחנה מערכות

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

הפעלה של אפופטוזיס על ידי Microinjection cytoplasmic של ציטוכרום ג</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

הבידוד של הריבוזום פוליפפטידים המתהווה כרוכים<em&gt; במבחנה</em&gt; כדי לזהות אתרים השהה של תרגום לאורך ה-mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

חלבון C-FOS איתור immunohistological: כלי שימושי כסמן של מסלולים מרכזיים המעורבים בתגובות פיסיולוגיות ספציפיות<em&gt; In vivo</em&gt; ו<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

בידוד סינון של חומצות גרעין: שיטת הפקת DNA פשוטה ומהירה

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

גלוקוז ספיגה מדידה ותגובה גירוי אינסולין ב<em&gt; במבחנה</em&gt; מיוטובים ראשוניים אדם מתורבת

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

במבחנה , גישות In Vivo כדי לקבוע חדירות תאים אפיתל המעי

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...