Name: stimulation of cytoplasmic dna sensing pathways in vitro and in vivo
Uploaded: 2014-09-18T13:00:00
Description: Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

लेखकों कोई पावती है.

1 Concatemerization <ol><li> Resuspend प्राइमरों परिवार कल्याण और आर.वी. आणविक जीव विज्ञान ग्रेड एच 2 ओ में 10 माइक्रोग्राम / μl के एक एकाग्रता के लिए (प्राइमर दृश्यों के लिए सामग्री की तालिका देखें) तो, परिवार कल्याण के 5 μl और ए...

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

यहाँ वर्णित प्रोटोकॉल सेल प्रकार की एक विस्तृत रेंज में और vivo में प्रतिलिपि प्रस्तुत करने योग्य परिणामों के साथ साइटोसोलिक सहज प्रतिरक्षा प्रतिक्रिया को प्रोत्साहित करने के लिए dsDNA उत्पन्न करने क?...

डीएनए यूकैर्योसाइटों विशिष्ट डिब्बों में रखने के जो सब जीवों और कोशिकाओं का एक महत्वपूर्ण घटक है. ऐसे compartmentalization टूट जाती है या जब सहज प्रतिरक्षा प्रणाली के एक समारोह की पहचान है विदेशी सामग्री शारीरिक, बाहरी बाधाओं का उल्लंघन के माध्यम से जीव में पेश किया जाता है. मानव शरीर में सही compartmentalization बच सकता है जो डीएनए की छोटी मात्रा में नीचा मदद के लिए मौजूद हैं कि प्रोटीन के एक नंबर रहे हैं; DNase मैं, द्वितीय, और तृतीय क्रमशः, प्लाज्मा, endosome, और cytosol में डीएनए टूट. हालांकि, यह सहज प्रतिरक्षा प्रणाली अतिरिक्त परमाणु डीएनए का जवाब है कि DNase द्वितीय कमी चूहों सुझाव इंटरफेरॉन 1 के अत्यधिक उत्पादन की वजह से गंभीर एनीमिया से मर जाते हैं कि दिखाया गया है. यह प्रतिक्रिया भी टोल की तरह रिसेप्टर संकेतन क्षमता में पूरी तरह से कमी है, जो चूहों में पाया जाता है. कई अध्ययनों से अब इंटरफेरॉन जीन (डंक) 2 और टैंक बाध्यकारी काइनेज 1 (टीबी की कि उत्तेजक पता चला हैK1) 3 कोशिका द्रव्य में डीएनए का पता लगाने में और इस संकेतन मार्ग इंटरफेरॉन विनियामक कारक (आईआरएफ) -3 4 सक्रिय करता है शामिल हैं. साइटोकाइन, केमोकाइन, और इंटरफेरॉन जीन के बाद IRF3 निर्भर प्रतिलेखन एक रोगज़नक़ या खतरे जुड़े आणविक पैटर्न (PAMP या नम) 5 या तो एक सहज प्रतिरक्षा प्रतिक्रिया की विशेषता है. intracellular न्यूक्लिक एसिड संवेदन रास्ते का अध्ययन करने की इच्छा अन्य सहज प्रतिरक्षा प्रतिक्रिया को सक्रिय करने के बिना कोशिकाओं में डीएनए या आरएनए शुरू करने से कोशिकाओं उत्तेजक के लिए मजबूत और प्रतिलिपि प्रस्तुत करने के तरीकों को विकसित करने की आवश्यकता के लिए प्रेरित किया. डंक / TBK1 / IRF3 मार्ग प्रेरित किया जा सकता है जिसके द्वारा एक विधि यह इस तरह के डीएनए पी, IFI16, और CGAS 6-8 के रूप में डीएनए सेंसर से पहुँचा जा सकता है जहां कोशिका द्रव्य में न्यूक्लिक एसिड देने के लिए cationic लिपिड अभिकर्मक अभिकर्मकों उपयोग कर रहा है. वर्तमान में EFF अनुमति देने के लिए समझ रहे हैं, जो डीएनए की विशेषताओंअन्य रास्ते की उत्तेजना के बिना cytoplasmic सहज प्रतिरक्षा प्रतिक्रिया के icient सक्रियण CPG की इसकी लंबाई, जन, पवित्रता, और कमी 4,7,9 रूपांकनों हैं. सिंथेटिक oligonucleotides वे डीएनए अनुक्रम अनुकूलित और एक शुद्ध रासायनिक प्रजाति के रूप में तैयार करने की अनुमति के रूप में एक सहज प्रतिरक्षा प्रतिक्रिया पैदा करने के उद्देश्य के लिए अत्यधिक उपयुक्त हैं. एक 45 आधार जोड़ी इम्युनो उत्तेजक डीएनए (आईएसडी) अनुक्रम इस उद्देश्य के लिए एक उपयुक्त, CPG मुक्त अनुक्रम होने के रूप में स्टेटसन एट अल. 4 द्वारा की पहचान की थी. इस dsDNA अनुक्रम अन्यथा यादृच्छिक है और CPG रूपांकनों की कमी से परे कोई विशेष सुविधाओं की है. हम काफी लंबे समय तक किस्में में आईएसडी oligonucleotide concatemerizing द्वारा उत्तेजना 7 की भयावहता बढ़ जाती है कि मिल गया है. Concatemerized आईएसडी की पीढ़ी के एक cytoplasmic सहज प्रतिरक्षा प्रतिक्रिया उत्तेजक के लिए इसलिए भी उपयोगी है. यहाँ हम इस अभिकर्मक की तैयारी के लिए प्रोटोकॉल के वर्तमान और उस में डीएनए संवेदन मार्ग को सक्रिय करने के लिए इस्तेमाल किया जा सकता हैvivo में के रूप में अच्छी तरह से इन विट्रो. नोट: सभी जानवरों के अध्ययन अनुमोदित संस्थागत प्रोटोकॉल और जानवरों की देखभाल के दिशा निर्देशों के तहत प्रदर्शन कर रहे हैं.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

कुशलतापूर्वक एक सहज प्रतिरक्षा प्रतिक्रिया को प्रोत्साहित करने के लिए, डीएनए पर्याप्त लंबाई और पवित्रता का होना चाहिए. हम अपेक्षित विशेषताओं है जो डबल असहाय डीएनए (dsDNA) संवेदन रास्ते सस्ते और आसानी से उत्पन्न किया जा सकता cytoplasmic डीएनए को प्रोत्साहित करने के लिए जहां एक विधि प्रस्तुत करते हैं. संक्षेप में, सिंथेटिक oligonucleotides (CPG रूपांकनों जो कमी) की concatemerization करके, dsDNA साइटोसोलिक डीएनए संवेदन मार्ग को सक्रिय करने के लिए पर्याप्त लंबाई का होना उत्पन्न किया जा सकता. इस प्रोटोकॉल कुशल बंधाव घटित करने के लिए एक वातावरण प्रदान करता है, जो पॉलीथीन ग्लाइकोल की उपस्थिति (खूंटी), में oligonucleotides की कुंद अंत बंधाव शामिल है. dsDNA concatemers मानक अभिकर्मक प्रोटोकॉल द्वारा इन विट्रो में सहज प्रतिरक्षा प्रतिक्रिया अनुकरण, फिनोल / क्लोरोफॉर्म निष्कर्षण द्वारा शुद्धि के बाद, इस्तेमाल किया जा सकता है. यह डीएनए भी उदाहरण के लिए, एक माउस के कान पंख में अंतर्त्वचीय इंजेक्शन द्वारा vivo में सहज प्रतिरक्षा को प्रोत्साहित करने के लिए इस्तेमाल किया जा सकता है. तकconcatemerization प्रक्रिया और बाद में उत्तेजना प्रोटोकॉल का मानकीकरण, सहज प्रतिरक्षा प्रणाली का एक विश्वसनीय और प्रतिलिपि प्रस्तुत करने योग्य सक्रियण का उत्पादन किया जा सकता है.

<html> नीचे दिए गए परिणामों concatemerized डीएनए रिश्तेदार आसानी से उत्पन्न होता है और कोशिकाओं में और चूहों में एक मजबूत सहज प्रतिरक्षा प्रतिक्रिया उत्तेजक में सक्षम है किया जा सकता है कि संकेत मिलता है. PEG8000 के उपय?...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

Cytoplasmic डीएनए सेंसिंग रास्ते की उत्तेजना<em&gt; इन विट्रो</em&gt; और<em&gt; इन विवो</em

प्रोटोकॉल के उद्देश्य कोशिकाओं में और vivo में cytoplasmic डीएनए संवेदन रास्ते उत्तेजक के लिए इष्टतम तरीकों का उपयोग करने के लिए है. इस कुंद अंत बंधाव दौरान लंबे, डबल असहाय डीएनए की पीढ़ी में सुधार के द्वारा हासिल की है. कोशिकाओं या चूहे तो एक लिपिड अभिकर्मक अभिकर्मक का उपयोग ट्रांसफ़ेक्ट हैं.

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

इन विट्रो में और vivo में मानव भ्रूण स्टेम कोशिकाओं के bioluminescence रिपोर्टर जीन इमेजिंग में

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

स्तनधारी कंकाल का उपयोग स्नायु के डीएनए अभिकर्मक Vivo में Electroporation

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo and in vitro Studies of Adaptor-clathrin Interaction

Vivo में और अडैप्टर क्लैथ्रिन इंटरेक्शन की इन विट्रो अध्ययन में

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

MG53 मध्यस्थता सेल झिल्ली का प्रयोग मरम्मत के विज़ुअलाइज़ेशन Vivo में और इन विट्रो में सिस्टम

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Apoptosis साइटोक्रोम के cytoplasmic Microinjection द्वारा सक्रियकरण ग</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Ribosome बाध्य नवजात polypeptides का अलगाव<em&gt; इन विट्रो में</em&gt; MRNA के साथ translational रोकें ब्लॉग की पहचान के लिए

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

सी-FOS प्रोटीन Immunohistological जांच: एक उपयोगी उपकरण केंद्रीय रास्ते विशिष्ट शारीरिक प्रतिक्रियाओं में शामिल की एक मार्कर के रूप में<em&gt; Vivo</em&gt; और<em&gt; पूर्व विवो</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

न्यूक्लिक एसिड की छानने का अलगाव: एक सरल और तेजी डीएनए निष्कर्षण विधि

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

ग्लूकोज अपटेक मापन और इनसुलिन उत्तेजना के प्रति प्रतिक्रिया<em&gt; विट्रो में</em&gt; संवर्धित मानव प्राथमिक म्यूट्यूब्स

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

इन विट्रो में और Vivo में आंतों उपकला कोशिका पारगम्यता का निर्धारण करने के लिए दृष्टिकोण

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...