Name: stimulation of cytoplasmic dna sensing pathways in vitro and in vivo
Uploaded: 2014-09-18T13:00:00
Description: Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

저자는 수신 확인이 없습니다.

1 Concatemerization <ol><li> 재현 탁 프라이머의 Fw 및 오락 용 차 (RV)은 분자 생물학 학년 H 2 O에서 10 μg / μL의 농도로 (프라이머 서열 재료의 표 참조) 그런 다음의 Fw의 5 μL와 1.5 ㎖의 microcentrifuge 관에서, 계 프라이머의 5 μl를 섞는다. </li><li> 15 분 (여기에 설명 된 프라이머 75 ° C) 정확한 열처리 온도에 가열하여 단련 프라이머 믹스. 실온 (RT)에서 냉각 벤치에 둡니다. DDH 2 O.에 용해하?...

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

여기에 설명 된 프로토콜은 세포 유형의 넓은 범위에서와 생체 내에서 재현 가능한 결과와 세포질 선천성 면역 반응을 자극하는 dsDNA를 생성하는 데 사용된다. 사용 된 주 기판 시약 합성 올리고 뉴클레오티드이므로, 다른 DNA 서열 또는 화학적 변형을 이용하여 본 시스템의 유연성이있다. 그것은 예를 들어 형광 라벨 또는 현지화를 추적 또는 다른 생체 분자와의 상호 작용을 평가하기 위해...

DNA는 진핵 생물이 특정 구획 유지 모든 생물 세포의 중요한 구성 요소입니다. 이러한 구획화가 고장 경우 또는 선천성 면역 시스템의 한 기능을 확인하는 것입니다 이물질은 실제 외부 장벽의 위반을 통해 생물체에 도입 될 때. 인체 올바른 구획화 벗어날 수도 DNA의 소량이 저하 돕기 위해 존재하는 단백질들이있다; DNase의 I, II 및 III는 각각, 플라즈마, 엔도 솜 및 세포질에서 DNA를 분해. 그러나, 선천성 면역 시스템이 추가 핵 DNA에 응답하는지 DNase의 II를 결핍 된 마우스는 제안 인터페론 하나의 과도한 생산으로 인한 심한 빈혈 죽는 것이 보였다. 이 응답은 심지어 수신자 같은 수용체 신호 용량을 완전히 결핍 아르 쥐에서 발생합니다. 많은 연구는 지금 인터페론 유전자 (STING) 2 TANK 결합 키나제 1 (TB의 자극을 보여 주었다K1) 3은 세포질에서 DNA의 검출에이 신호 전달 경로는 인터페론 조절 인자 (IRF) -3 사를 활성화하는 것이 포함된다. 사이토 카인, 케모카인, 및 인터페론 유전자의 후속 IRF3 의존적 전사가 병원체 또는 위험 관련 분자 패턴 (PAMP 또는 DAMP) (5) 중 하나에 대한 선천성 면역 반응의 특징이다. 세포 내 핵산 검출 경로를 연구하는 욕구는 다른 선천성 면역 반응을 활성화하지 않고 세포 내로 DNA 또는 RNA를 도입하여 세포를 자극 견고하고 재생 가능한 방법을 개발할 필요하게되었다. STING / TBK1 / IRF3 경로를 자극 할 수있는 한 가지 방법은이 같은 DNA-PK, IFI16 및 CGAS 6-8로 DNA 센서에 의해 액세스 할 수있는 세포질로 핵산을 제공하는 양이온 성 지질 형질 전환 시약을 사용하는 것입니다. 현재 EFF을 허용하는 것으로 이해되는 DNA의 특성다른 경로의 자극없이 세포질 선천성 면역 반응의 icient 활성화 된 CpG의 길이, 질량, 순도, 및 부족 4,7,9 모티프입니다. 합성 올리고 뉴클레오티드가 DNA 서열 최적화 및 순수한 화학 종으로 제조 할 수 있도록 같은 선천성 면역 반응을 생성하는 목적에 매우 적합하다. 45 염기쌍 면역 자극 DNA (ISD) 서열은 이러한 목적에 적합 된 CpG 서열이없는 것으로 홍길동 외. (4)에 의해 확인되었다. 이 dsDNA 순서는, 그렇지 않으면 무작위와의 CpG 모티프의 부족을 넘어 특별한 기능이 없습니다. 우리는 훨씬 더 긴 가닥으로 ISD 올리고 뉴클레오타이드를 concatemerizing 의해 자극 (7)의 크기를 증가 시킨다는 것을 발견 하였다. concatemerized ISD의 세대는 세포질 선천성 면역 반응을 자극하므로 유용합니다. 여기에서는이 시약을 제조하는 프로토콜을 제시하고는 DNA에서 감지 경로를 활성화 할 수있는 방법생체 내에서뿐만 아니라 체외. 참고 : 모든 동물 연구 승인 기관 프로토콜 및 동물 관리 지침에 따라 수행된다.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

효율적 선천성 면역 반응을 자극하기 위해, DNA는 충분한 길이 여야 순도. 우리는 필요한 특성을 갖는 이중 가닥 DNA (dsDNA)를 검출 경로가 저렴하고 용이하게 생성 할 수있는 세포 내 DNA를 자극하는 방법을 제시한다. 단, 합성 올리고 뉴클레오티드 (않은 CpG 모티프를 결여한다)의 concatemerization으로 dsDNA는 세포질 DNA 감지 경로를 활성화하기에 충분한 길이로 생성 될 수있다. 이 프로토콜은 효율적인 결찰 발생하기위한 환경을 제공하는 폴리에틸렌 글리콜의 존재 (PEG)의 올리고 뉴클레오티드의 블런트 엔드 라이 게이션을 포함한다. dsDNA concatemers의 표준 프로토콜에 의해 형질 전환 체외에서 선천성 면역 반응을 시뮬레이션하기 위해, 페놀 / 클로로포름 추출에 의해 정제하여 다음을 사용할 수있다. 이 DNA는 또한 예를 들어, 마우스의 귀에 귓바퀴에 피내 주사함으로써 생체 내에서의 선천성 면역을 자극하는 데 사용될 수있다. 으로concatemerization 프로세스 및 후속 자극 프로토콜을 표준화하고, 선천성 면역계의 신뢰성 및 재현성 활성화가 제조 될 수있다.

<html> 아래 결과는 concatemerized DNA가 상대적으로 쉽게 생성 세포와 마우스에서 강력한 선천성 면역 반응을 자극 할 수 있음을 나타낸다. PEG8000의 사용으로, 명확 생성되는 DNA의 길이가 상당히 길어 CXCL10의 전사를 유도 할 수있는 동등 함을 알 수있다. 아가 로즈 겔 분석으로 알 수있는 바와 같이 PEG8000과 샘플, DNA의 길이가 10000 BP (도 1a)을 초과하는 가닥을 포함하는 반면, 표준 concatemerizati...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

세포질 DNA 검출 진학의 자극<em&gt; 체외</em&gt;와<em&gt; 생체</em

프로토콜의 목적은 세포 및 생체 내에서 세포 내 DNA의 촬상 경로를 자극하는 최적의 방법을 사용하는 것이다. 이것은 블런트 엔드 라이 게이션시 긴 이중 가닥 DNA의 생성을 향상시킴으로써 달성된다. 세포 또는 마우스는 지질 형질 감염 시약을 이용하여 형질 전환된다.

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

체외에서 인간 배아 줄기 세포의 생체내의 Bioluminescence 리포터 진 영상에

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

연구

생물학

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

사용 포유류 골격 근육의 유전자 Transfection VIVO에서 Electroporation

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo and in vitro Studies of Adaptor-clathrin Interaction

생체내 및 아답터 - clathrin 상호 작용의 체외 연구에서

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

사용 MG53 - 중재 세포막 수리의 시각화 생체내에과 체외에서 시스템

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

시토크롬의 세포질 Microinjection 의한 Apoptosis의 활성화 C</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Ribosome 바운드 초기 Polypeptides의 분리<em&gt; 체외에서</em&gt; mRNA 함께 Translational 일시 중지 사이트를 식별하려면

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

은 C-FOS 단백질 면역 조직 검색 : 특정 생리적 반응에 관여 중앙 진학의 마커로서 유용한 도구<em&gt; 생체</em&gt; 및<em&gt; 전의 VIVO</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

핵산의 여과 분리 : 간단하고 신속한 DNA 추출 방법

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

포도당 섭취량 측정 및 인슐린 자극에 대한 반응<em&gt; In Vitro</em&gt; 배양 된 사람의 주요 근육 세포

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

생체 외에서 그리고 Vivo에서 접근 장 상피 세포 침투성을 결정 하

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...