Name: stimulation of cytoplasmic dna sensing pathways in vitro and in vivo
Uploaded: 2014-09-18T13:00:00
Description: Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Forfatterne har ingen bekreftelser.

1. Concatemerization <ol><li> Suspender primere Fw og Rv (se tabell for material for primer sekvenser) til en konsentrasjon på 10 mikrogram / ​​mL i molekylærbiologi klasse H 2 O. Deretter blandes 5 pl av Fw og 5 pl av Rv primer i et 1,5 ml mikrosentrifugerør. </li><li> Anneal primerblanding ved oppvarming til den riktige annealing temperatur (75 ° C for de primere som er beskrevet her) i 15 min. La på benken for å kjøle seg ned i romtemperatur (RT). Klargjør 60% PEG8000 i løpet av denne inkuba...

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

De protokoller som er beskrevet her, blir brukt til å generere dsDNA å stimulere cytosoliske medfødte immunrespons med reproduserbare resultater i et stort utvalg av celletyper og in vivo. Siden den viktigste substrat reagens som anvendes er en syntetisk oligonukleotid, har det fleksibiliteten i dette system for å bruke alternative DNA-sekvenser eller kjemiske modifikasjoner. Det er mulig, for eksempel, for å erstatte den fremre otidet beskrevet i denne protokoll med en som inneholder en fluorescerende mar...

DNA er en viktig komponent i alle organismer og celler, som eukaryoter holder i bestemte avdelinger. En funksjon av den medfødte immunsystemet, er å identifisere når en slik compartmentalization bryter ned eller når fremmed materiale blir innført inn i organismen via et brudd på fysiske, ytre barrierer. I menneskekroppen er det en rekke proteiner som finnes å bidra til å degradere små mengder av DNA som kan unnslippe korrekt compartmentalization; DNAse I, II og III bryte ned DNA i plasma, endosome, og cytosol, respektivt. Imidlertid har det vist seg at mus som mangler DNAse II dør av alvorlig anemi forårsaket av overdreven produksjon av interferoner en som tyder på at det medfødte immunsystemet reagerer på ekstra-kjerne-DNA. Denne responsen skjer selv hos mus som er helt mangelfull i toll-like receptor signalkapasitet. Tallrike studier har nå vist at stimulator av interferon gener (STING) 2 og TANK-bindende kinase 1 (TBK1) 3 er involvert i gjenkjenning av DNA i cytoplasma, og at denne signalveien aktiveres interferon regulerende faktor (IRF) -3 4. Den påfølgende IRF3 avhengige transkripsjon av cytokin, kjemokinet og interferon gener er karakteristisk for en medfødt immunrespons mot enten et patogen eller fare forbundet molekylær mønster (PAMP eller fuktig) 5. Ønsket om å studere intracellulære nukleinsyre sensing veier har ført til kravet om å utvikle robuste og reproduserbare metoder for å stimulere cellene ved å innføre DNA eller RNA inn i celler uten å aktivere andre medfødte immunresponser. En metode der STING / TBK1 / IRF3 pathway kan stimuleres er ved hjelp av kationiske lipid transfeksjon reagenser å levere nukleinsyre i cytoplasma hvor den kan nås av DNA-sensorer som DNA-PK, IFI16, og CGAS 6-8. Karakteristikken av DNA som nå er forstått å tillate efficient aktivering av cytoplasma medfødte immunrespons uten stimulering av andre banene er dens lengde, masse, renhet og mangel på CpG motiver 4,7,9. Syntetiske oligonukleotider er godt egnet for det formål å generere en medfødte immunrespons som de tillater at DNA-sekvensen som skal optimaliseres, og fremstilt som en ren kjemisk species. En 45 basepar immuno-stimulerende DNA (ISD) sekvensen ble identifisert ved Stetson et al. Fire som å være et egnet, CpG-fri sekvens for dette formål. Dette dsDNA sekvensen er ellers tilfeldig og har ingen spesifikke funksjoner utover sin mangel på CpG motiver. Vi har funnet at ved concatemerizing ISD oligonukleotid inn betydelig lengre tråder øker omfanget av stimulering 7. Generering av concatemerized ISD er derfor nyttig for å stimulere en cytoplasma medfødte immunrespons. Her presenterer vi protokoller for utarbeidelsen av denne reagensen og hvordan den kan brukes til å aktivere DNA sensing veien ivitro samt in vivo. MERK: Alle dyrestudier er utført under godkjente institusjonelle protokoller og retningslinjer dyr omsorg.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

For effektivt å stimulere en medfødte immunrespons, må DNA være av tilstrekkelig lengde og renhet. Vi presenterer en metode hvor dobbelt-trådet DNA (dsDNA), som har de nødvendige egenskaper for å stimulere cytoplasmisk DNA føler trasé kan genereres billig og på en enkel måte. Ved concatemerization av korte, syntetiske oligonukleotider (som mangler CpG motiver), kan dsDNA bli generert til å være av tilstrekkelig lengde for å aktivere den cytosoliske DNA føle pathway. Denne protokoll omfatter butt ende ligering av oligonukleotidene i nærvær av polyetylenglykol (PEG), som gir et effektivt miljø for ligering til å forekomme. De dsDNA concatemers kan anvendes, etter rensing ved fenol / kloroform ekstraksjon, for å simulere den medfødte immunrespons in vitro ved hjelp av standard protokoller transfeksjon. Dette DNA kan også brukes til å stimulere medfødt immunitet in vivo ved intradermal injeksjon i øret pinna av en mus, for eksempel. Avstandardisere concatemerization prosessen og den etterfølgende stimuleringsregimer, kan en pålitelig og reproduserbar aktivering av den medfødte immunsystemet bli produsert.

<html> Resultatene nedenfor viser at concatemerized DNA kan bli generert relativt enkelt, og er i stand til å stimulere en robust medfødte immunrespons i celler og hos mus. Med bruk av PEG8000, kan det tydelig ses at lengden av DNA som genereres er vesentlig lengre og like i stand til å indusere transkripsjon av Cxcl10. Som det fremgår av agarosegel-analyse, har standard concatemerization lengder av DNA på opp til 800 basepar (bp), mens det for prøven med PEG8000, lengden av DNA omfatter tråder i overkant av 10 00...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

Stimulering av cytoplasmatiske DNA Sensing Pathways<em&gt; In Vitro</em&gt; Og<em&gt; In Vivo</em

Formålet med protokollen er å bruke optimale fremgangsmåter for å stimulere de cytoplasmiske DNA føler trasé i celler og in vivo. Dette oppnås ved å forbedre genereringen av lange, dobbeltkjedet DNA ved butt-ende ligering. Celler eller mus blir deretter transfektert ved hjelp av en lipid transfeksjon reagens.

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo and in vitro Studies of Adaptor-clathrin Interaction

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolering av ribosome Innbundne begynnende polypeptider<em&gt; In vitro</em&gt; For å identifisere translasjonelle Pause steder langs mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

C-FOS Protein Immunohistologisk Detection: Et nyttig verktøy som en markør av Central Pathways involvere seg i det fysiologiske responser<em&gt; I Vivo</em&gt; og<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

Filtrering Isolering av nukleinsyrer: En enkel og Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glukoseopptaksmåling og respons på insulinstimulering i<em&gt; I Vitro</em&gt; Dyrket humant primært myotubes

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...