Name: stimulation of cytoplasmic dna sensing pathways in vitro and in vivo
Uploaded: 2014-09-18T13:00:00
Description: Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Os autores não têm confirmações.

1. Concatemerization <ol><li> Ressuspender iniciadores Fw e Rv (ver Tabela de Materiais para as sequências de iniciadores) a uma concentração de 10 mg / mL em biologia molecular, grau de H 2 O. Em seguida, misturar 5 ul de Fw e 5 ul de iniciador Rv em um tubo de microcentrífuga de 1,5 ml. </li><li> Mistura de iniciadores de recozimento por meio de aquecimento para a temperatura de emparelhamento correcto (75 ° C para os iniciadores aqui descritos) para 15 min. Deixar no banco para esfriar em...

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

Os protocolos aqui descritos são utilizados para gerar dsDNA para estimular a resposta imune inata citosólica com resultados reprodutíveis em uma ampla gama de tipos de células e in vivo. Uma vez que o principal reagente de substrato utilizado é um oligonucleótido sintético, não há flexibilidade no presente sistema para a utilização de sequências de ADN alternativos ou modificações químicas. É possível, por exemplo, para substituir a cadeia de oligonucleótido descrito adiante neste protocolo c...

DNA é um componente vital de todos os organismos e células eucariontes, que manter em compartimentos específicos. Uma das funções do sistema imune inata é identificar quando tais compartimentalização quebra ou quando o material estranho é introduzido no organismo por meio de uma quebra de barreiras físicas externas. No corpo humano, há um certo número de proteínas que existem para ajudar a degradar pequenas quantidades de ADN, que pode escapar da compartimentação correcta; DNAse I, II, III e quebrar o DNA no plasma, endossoma, e citosol, respectivamente. No entanto, foi demonstrado que ratinhos que carecem de DNAse II morrem de anemia grave causada pela produção excessiva de uma interferões, sugerindo que o sistema imune inato responde ao ADN extra-nuclear. Esta resposta ocorre mesmo em ratinhos que são totalmente deficiente na capacidade de sinalização dos receptores do tipo Toll. Numerosos estudos têm mostrado agora que estimulador de genes interferon (STING) 2 e de ligação TANK quinase 1 (TBK1) 3 estão envolvidos na detecção de DNA no citoplasma e que esta via de sinalização activa o factor regulador de interferão (IRF) -3 4. A posterior transcrição dependente de IRF3 de citocinas, quimiocinas e genes interferon é característica de uma resposta imune inata, quer um patógeno ou perigo associado padrão molecular (PAMP ou DAMP) 5. O desejo de estudar intracelulares nucleicos vias sensoriais ácido levou à necessidade de desenvolver métodos consistentes e reprodutíveis para estimulação das células através da introdução de DNA ou RNA em células sem activar outras respostas imunitárias inatas. Um método pelo qual o aguilhão / TBK1 / via IRF3 pode ser estimulado é através da utilização de lípidos catiónicos os reagentes de transfecção para entregar ácidos nucleicos para o citoplasma, onde pode ser acedido por meio de sensores de ADN, tais como ADN-PK, IFI16, e cgas 6-8. As características de ADN que são correntemente considerados para permitir eficient activação da resposta imune inata citoplasmática sem estimulação de outras vias são o seu comprimento, de massa, pureza e falta de CpG motifs 4,7,9. Os oligonucleótidos sintéticos são altamente adequados para a finalidade de gerar uma resposta imune inata uma vez que permitem que a sequência de DNA a ser optimizado e preparado como uma espécie química pura. Um ADN (DSI) sequência de imuno-estimuladora 45 pares de bases foi identificado por Stetson et al. Quatro como sendo uma sequência adequada, CpG-livre para esse efeito. Esta seqüência dsDNA é outra forma aleatória e não tem características específicas para além de sua falta de motivos CpG. Verificou-se que o oligonucleótido por concatemerizing DSI em filamentos longos aumenta significativamente a magnitude da estimulação 7. Geração de ISD concatemerized é, portanto, útil para estimular uma resposta imune inata citoplasmática. Aqui apresenta-se os protocolos para a preparação deste reagente e como ela pode ser utilizada para activar a via de detecção de ADN emvitro, bem como in vivo. NOTA: Todos os estudos em animais são realizados no âmbito de protocolos institucionais aprovados e orientações de cuidados de animais.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

A fim de estimular eficazmente uma resposta imune inata, o DNA tem de ser de comprimento e pureza suficientes. Apresenta-se um método em que o ADN de cadeia dupla (dsDNA), que possui as características necessárias para estimular o ADN citoplasmática vias sensoriais pode ser gerada de forma barata e com facilidade. Pelo concatemerization de oligonucleótidos curtos, sintéticos (que não têm motivos CpG), dsDNA pode ser gerado para ser de comprimento suficiente para activar a via citosólica detecção de ADN. Este protocolo envolve a ligação de extremidades rombas de oligonucleótidos na presença de polietileno glicol (PEG), que proporciona um ambiente eficaz para a ligação ocorra. Os concatemeros dsDNA pode ser usado, após purificação por extracção com fenol / clorofórmio, para simular a resposta imune inata in vitro por protocolos de transfecção convencionais. Este ADN pode também ser utilizada para estimular a imunidade inata in vivo por injecção intradérmica no pavilhão auricular de um rato, por exemplo. Porpadronizar o processo concatemerization e os protocolos de estimulação posterior, uma activação fiável e reprodutível do sistema imune inato pode ser produzido.

<html> Os resultados abaixo indicam que o DNA concatemerized pode ser gerado com relativa facilidade e é capaz de estimular uma resposta imune inata e robusto nas células em ratinhos. Com o uso de PEG8000, que pode ser claramente visto que o comprimento do ADN a ser gerado é significativamente mais longa e igualmente capazes de induzir a transcrição de CXCL10. Como se pode ver pela análise em gel de agarose, o concatemerization padrão tem comprimentos de ADN de mais de 800 pares de bases (pb), enquanto que para a ...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

Estimulação da Citoplasmáticas DNA Sensing Pathways<em&gt; In Vitro</em&gt; E<em&gt; In Vivo</em

O objectivo do protocolo é a utilização de métodos mais eficientes para estimular as vias sensoriais citoplasmáticos de ADN em células e in vivo. Isto é conseguido através da melhoria da geração de ADN de comprimento, de cadeia dupla, durante a ligação das extremidades cegas. As células ou os ratinhos são depois transfectadas utilizando um reagente de transfecção de lípidos.

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

In vitro e in vivo de imagens Gene Reporter bioluminescência de células estaminais embrionárias humanas

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Biologia

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

Transfecção de DNA de mamíferos usando músculos esqueléticos In Vivo Eletroporação

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo e in vitro de Estudos Adaptor-clathrin Interação

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Visualização de MG53 mediada Repair Membrana Celular Usando In vivo E In vitro Sistemas

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Ativação da apoptose por microinjeção citoplasmática de citocromo C</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolamento de Ribossomos ligados a polipeptídeos nascentes<em&gt; In vitro</em&gt; Identificar Sites Pausa translacionais Junto mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

A proteína c-Fos Detecção imuno: Uma ferramenta útil como um marcador de vias centrais envolvidos em respostas fisiológicas específicas<em&gt; In Vivo</em&gt; e<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

Isolamento de filtração de Ácidos Nucleicos: Um Método de extracção de DNA simples e rápido

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Medição da captação de glicose e resposta à estimulação de insulina em miotubos primários humanos cultivados in vitro

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro e In Vivo de abordagens para determinar a permeabilidade da célula epitelial Intestinal

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...