Name: stimulation of cytoplasmic dna sensing pathways in vitro and in vivo
Uploaded: 2014-09-18T13:00:00
Description: Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Авторы не имеют подтверждения.

1 Concatemerization <ol><li> Ресуспендируйте праймеры Fw и Rv (см таблицу материалов для последовательностей праймеров) до концентрации 10 мкг / мкл в биологически очищенной H 2 O. Тогда, смешайте 5 мкл Fw и 5 мкл Rv грунтовки в 1,5 мл микроцентрифужных трубки. </li><li> Отжиг смесь праймер путем нагрева до ?...

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

Протоколы, описанные здесь, используются для создания двухцепочечной ДНК, чтобы стимулировать цитозольного врожденной иммунной реакции с воспроизводимые результаты в широком диапазоне типов клеток и в естественных условиях. Так как основной реагент субстрат используется синте...

ДНК является жизненно важным компонентом всех организмов и клеток, которые эукариоты держать в определенных отсеков. Одна из функций иммунной системы, чтобы определить, когда такое компартментализация ломается или когда инородный материал вводится в организм через нарушение физических, внешних барьеров. В человеческом организме существует целый ряд белков, которые существуют, чтобы помочь ухудшить небольших количеств ДНК, которые могут избежать правильный дробления; ДНКазы I, II и III, сломать ДНК в плазме, эндосомы и цитозоле, соответственно. Тем не менее, было показано, что мыши, лишенные ДНКазу II умирает от тяжелой анемии, вызванной чрезмерным продукции интерферонов 1, предполагая, что врожденная иммунная система реагирует на экстра-ядерная ДНК. Этот ответ имеет место даже у мышей, которые полностью дефицит платной, как мощности передачи сигнала рецептором. Многочисленные исследования показали, что в настоящее время стимулятор генов интерферона (жало) 2 и БАК-связывания киназы 1 (ТБК1) 3 участвуют в обнаружении ДНК в цитоплазму и что этот сигнальный путь включает интерферон регуляторного фактора (МАФ) -3 4. Последующее IRF3-зависимой транскрипции цитокина, хемокина, и генов интерферона характерна для врожденного иммунного ответа к любой патогена или опасности, связанной молекулярной картины (ПАМП или влажные) 5. Желание изучать внутриклеточные пути нуклеиновые кислоты зондирования привело к требованию, чтобы разработать надежные и воспроизводимые способы стимулирования клеток путем введения ДНК или РНК в клетки без активации другие врожденные иммунные ответы. Один из способов, с помощью которых жало / TBK1 / IRF3 путь может быть стимулировано путем использование катионных липидов реагентов трансфекции для доставки нуклеиновой кислоты в цитоплазму, где он может получить доступ с помощью датчиков, таких как ДНК, ДНК-ПК, IFI16, и CGAS 6-8. Характеристики ДНК, которая в настоящее время поняты, чтобы позволить эффАктивация циент цитоплазматической врожденного иммунного ответа без стимуляции других путей являются его длина, масса, чистота, и отсутствие CpG мотивы 4,7,9. Синтетические олигонуклеотиды хорошо подходит для цели получения врожденной иммунной реакции, поскольку они позволяют последовательность ДНК, чтобы быть оптимизированы и получают в виде чистых химических соединений. 45 пар оснований иммуно-стимулирующий ДНК (ИСД) последовательность была определена Стетсоном и соавт. 4 как подходит, CpG-последовательности, свободной для этой цели. Эта последовательность двухцепочечной ДНК является в противном случае случайный и не имеет особенностей вне его отсутствия CpG мотивов. Мы обнаружили, что по concatemerizing ИСД олигонуклеотида в значительно более нитей увеличивает величину стимуляции 7. Генерация concatemerized ИСД Поэтому полезно для стимулирования цитоплазматический врожденный иммунный ответ. Здесь мы представляем протоколы за подготовку этого реагента и как он может быть использован для активации зондирования ДНК путь впробирке, а также в естественных условиях. ПРИМЕЧАНИЕ: Все исследования на животных проводятся по утвержденным институциональных протоколов и руководств по уходу за животными.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

Для того чтобы эффективно стимулировать врожденную иммунную реакцию, ДНК должна быть достаточной длины и чистоты. Мы представляем метод, где двухцепочечной ДНК (дц), который имеет все необходимые характеристики, чтобы стимулировать цитоплазматический ДНК пути зондирования могут быть сгенерированы дешево и с легкостью. К concatemerization коротких синтетических олигонуклеотидов, которые не имеют (CpG мотивы), дцДНК могут быть получены, чтобы иметь достаточную длину, чтобы активировать цитозольного зондирования ДНК пути. Этот протокол включает в себя тупым концом лигирование олигонуклеотидов в присутствии полиэтиленгликоля (ПЭГ), который обеспечивает среду для эффективного лигирования произойти. В concatemers дцДНК могут быть использованы, следующие очистки экстракцией фенолом / хлороформом, чтобы имитировать врожденного иммунного ответа в пробирке с помощью стандартных протоколов трансфекции. Эта ДНК может быть также использован для стимуляции врожденного иммунитета в естественных условиях внутрикожной инъекцией в ушной раковины мыши, например. Постандартизации процесса concatemerization и последующие протоколы стимуляции, надежным и воспроизводимым активации иммунной системы могут быть получены.

<html> Приведенные ниже результаты показывают, что concatemerized ДНК могут быть получены с относительной легкостью и способен стимулировать надежную врожденной иммунной реакции в клетках, и у мышей. При использовании PEG8000, это хорошо видно, что длина ДНК генерируется значительно больше и в равн...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

Стимуляция цитоплазматической ДНК зондирования Пути<em&gt; In Vitro</em&gt; И<em&gt; В Vivo</em

Целью протокола является использование оптимальные способы стимулирования цитоплазматические пути зондирования ДНК в клетках и в естественных условиях. Это достигается за счет улучшения поколение долгого, двухцепочечной ДНК во тупым концом перевязки. Клетки или мышей затем трансфицируют с использованием реагента для трансфекции липидов.

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

В пробирке и в естественных Биолюминесценция Reporter Гена изображений из человеческих эмбриональных стволовых клеток

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

Трансфекция ДНК млекопитающих скелетных мышц использованием В Vivo Электропорация

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo and in vitro Studies of Adaptor-clathrin Interaction

В естественных условиях и в пробирке исследования Адаптер-клатрин Взаимодействие

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Визуализация MG53-опосредованной клеточной мембраны Ремонт Использование В естественных условиях И В пробирке Системы

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Активация апоптоза Цитоплазматическая Микроинъекция цитохрома С</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Выделение Рибосома связанных стадии становления Полипептиды<em&gt; В пробирке</em&gt;, Чтобы определить Поступательное сайтов Пауза Наряду мРНК

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

C-FOS белка Обнаружение иммуногистохимического: Полезный инструмент в качестве маркера Центральной путей, участвующих в конкретных физиологических реакций<em&gt; В Vivo</em&gt; и<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

Фильтрация Выделение нуклеиновых кислот: Простой и быстрый ДНК Метод экстракции

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Измерение поглощения глюкозы и ответ на стимуляцию инсулина в<em&gt; In Vitro</em&gt; Культурные человеческие первичные миопуты

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro и In Vivo подходы для определения проницаемости кишечной эпителиальных клеток

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...