Name: stimulation of cytoplasmic dna sensing pathways in vitro and in vivo
Uploaded: 2014-09-18T13:00:00
Description: Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Yazarlar bildirimleri var.

1. Concatemerization <ol><li> Yeniden süspanse primerler Fw ve Rv&#39;nin Moleküler Biyoloji H2O içinde 10 mg / ml &#39;lik bir konsantrasyon (primer diziler Malzemesi Tablo) Daha sonra, 5 ul Fw ve 1.5 ml mikrosantrifüj tüpü içinde Rv primerin 5 ul karıştırın. </li><li> 15 dakika boyunca (burada tarif edilen primerler için 75 ° C) doğru tavlama sıcaklığına kadar ısıtılarak Tavlama primer karışımını içerir. Oda sıcaklığında (RT) soğumasını bankta bırakın. GKD 2 ...

<ol>
	<li>Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lethal+anemia+caused+by+interferon-beta+produced+in+mouse+embryos+carrying+undigested+DNA.">Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA.</a> Nat. Immunol. 6, 49-56 (2005).</li><li>Ishikawa, H., Ma, Z., Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+regulates+intracellular+DNA-mediated,+type+I+interferon-dependent+innate+immunity.">STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity.</a> Nature. 461, 788-792 (2009).</li><li>Ishii, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TANK-binding+kinase-1+delineates+innate+and+adaptive+immune+responses+to+DNA+vaccines.">TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines.</a> Nature. 451, 725-729 (2008).</li><li>Stetson, D. B., Medzhitov, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+cytosolic+DNA+activates+an+IRF3-dependent+innate+immune+response.">Recognition of cytosolic DNA activates an IRF3-dependent innate immune response.</a> Immunity. 24, 93-103 (2006).</li><li>Pichlmair, A., Reise Sousa, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+recognition+of+viruses.">Innate recognition of viruses.</a> Immunity. 27, 370-383 (2007).</li><li>Unterholzner, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IFI16+is+an+innate+immune+sensor+for+intracellular+DNA.">IFI16 is an innate immune sensor for intracellular DNA.</a> Nat. Immunol. 11, 997-1004 (2010).</li><li>Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-PK+is+a+DNA+sensor+for+IRF-3-dependent+innate+immunity.">DNA-PK is a DNA sensor for IRF-3-dependent innate immunity.</a> Elife. 1, e00047 (2012).</li><li>Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+GMP-AMP+synthase+is+a+cytosolic+DNA+sensor+that+activates+the+type+I+interferon+pathway.">Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.</a> Science. 339, 786-791 (2013).</li><li>Honda, K., Taniguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRFs:+master+regulators+of+signalling+by+Toll-like+receptors+and+cytosolic+pattern-recognition+receptors.">IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors.</a> Nat. Rev. Immunol. 6, 644-658 (2006).</li><li>Karayel, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+TLR-independent+DNA+recognition+pathway+in+murine+macrophages:+Ligand+features+and+molecular+signature.">The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature.</a> Eur. J. Immunol. 39, 1929-1936 (2009).</li></ol>

Burada açıklanan protokoller hücre tiplerinin geniş bir yelpazede ve in vivo olarak yeniden üretilebilir sonuçlar sitosolik doğuştan gelen bağışıklık tepkisi ortaya çıkarmak için dsDNA oluşturmak için kullanılır. Ikinci ana tabaka reaktif bir sentetik oligonükleotid olduğu, alternatif bir DNA sekanslarını veya kimyasal modifikasyonlar için, bu sistemde bir esneklik elde edilir. Bu, örneğin, bir flüoresan etiket veya lokalizasyonunu etiket ya da diğer biyomoleküllerle etkileşiminin...

DNA ökaryotlarda özel bölmelere tutmak tüm organizmalar ve hücrelerin, önemli bir bileşenidir. Bu bölmelere ayırır ya da zaman doğuştan gelen bağışıklık sistemi arasında bir fonksiyonu, tanımlanması için bir yabancı madde, fiziksel, dış engelleri ihlal ile organizma içine sokulduğunda. İnsan vücudunda doğru compartmentalization kaçabilir DNA&#39;nın küçük miktarlarda düşmesine yardımcı olmak için vardır proteinlerin bir dizi vardır; DNAz I, II ve III, plazma, endozoma ve sitozol içinde DNA break down. Ancak, doğuştan gelen bağışıklık sistemi ekstra nükleer DNA tepki verdiğini DNAz II eksik farenin düşündüren interferonlar 1 aşırı üretimine yol açtığı şiddetli anemi ölmektedir olduğu gösterilmiştir. Bu yanıt, daha da Toll-benzeri reseptör sinyal kapasitesi tamamen eksik olan farelerde görülür. Çeşitli çalışmalar şimdi interferon genleri (STING) 2 ve TANK-bağlayıcı kinaz 1 (TB olduğunu uyarıcı göstermiştirK1) 3 sitoplazmada DNA&#39;nın saptanması ve bu sinyal yolunun, interferon ayarlayıcı faktör (IRF) -3 4 aktive katılmaktadırlar. Sitokin, kemokin, ve interferon gen daha sonra IRF3 bağımlı transkripsiyon, bir patojen ya da tehlike ilişkili moleküler model (PAMP ya da ıslak) 5 ya da doğuştan gelen bağışıklık tepkisinin özelliğidir. Hücre içi nükleik asit algılama yollan araştırmak için arzu diğer doğal immün yanıtları aktive olmayan hücrelere DNA ya da RNA&#39;nın hücrelere verilmesi ile teşvik etmek için sağlam ve tekrarlanabilir yöntemler geliştirmeye ihtiyacına yol açmıştır. / Sokması TBK1 / IRF3 yolu uyarılabilir hangi bir yöntemi, bu, DNA-PK, IFI16 ve CGAS 6-8 gibi DNA sensörleri tarafından erişilebilir sitoplazmaya nükleik asit sağlamak üzere katyonik lipit transfeksiyon reaktifleri kullanılarak gereğidir. Şu anda eff izin vermek için anlaşılır DNA özellikleriDiğer yolların uyarımı olmaksızın sitoplazmik tabii immun cevabın aktivasyonu icient CpG uzunluğu, kütle, saflık ve eksik 4,7,9 motifleridir. Sentetik oligonükleotidlerin, optimize edilmiş DNA dizisi ve saf kimyasal türler gibi hazırlanabilir izin olarak doğuştan gelen bağışıklık tepkisi üretmek amacı için oldukça uygundurlar. Bir 45 baz çift immüno-uyarıcı DNA (ISD) dizisi, bu amaç için uygun bir CpG içermeyen sekans olarak şapkalı ve ark. 4 ile teşhis edildi. Bu dsDNA dizi aksi takdirde rastgele ve CpG motifleri onun eksikliği dışında hiçbir özel özellikleri vardır. Bu önemli ölçüde daha uzun şeritler haline ISD oligonükleotid concatemerizing tarafından uyarılması 7 büyüklüğünü arttırdığını bulduk. Concatemerized ISD Üretimi sitoplazmik bir doğuştan gelen bağışıklık tepkisinin uyarılması için faydalıdır. Burada bu reaktifinin hazırlanması için protokoller sunulmuş ve bu DNA algılama yolunu aktive etmek için kullanılabilir nasılin vivo ve in vitro. NOT: Tüm hayvan çalışmaları onaylanan kurumsal protokollere ve hayvan bakımı kurallar altında yapılmaktadır.

<table border="0" cellpadding="0" cellspacing="0" width="1066">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Forward Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td style="width:407px;">TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:295px;">Reverse Primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">PEG8000</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">P-4463</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Molecular biology grade water</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">W4502-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 Polynucleotide Kinase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M4101</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">T4 DNA Ligase</td>
			<td style="width:221px;">Promega</td>
			<td style="width:144px;">M1801</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Phenol:Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">BPE1752p-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Chloroform</td>
			<td style="width:221px;">Fisher Chemical</td>
			<td style="width:144px;">C/4960/PB08</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Ethanol</td>
			<td style="width:221px;">Sigma-Aldrich</td>
			<td style="width:144px;">32221-2.5L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">DNA gel loading buffer</td>
			<td style="width:221px;">New England biolabs</td>
			<td style="width:144px;">B7021S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Agarose</td>
			<td style="width:221px;">Bioline</td>
			<td style="width:144px;">BIO-41025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Optimem</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">11058021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TransIT-LT1&#160;</td>
			<td style="width:221px;">Mirus Bioscience</td>
			<td style="width:144px;">MIR 2300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Hamilton Syringe</td>
			<td style="width:221px;">Hamilton</td>
			<td style="width:144px;">80901 Model 1705</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">30G needles&#160;</td>
			<td style="width:221px;">BD bioscience</td>
			<td style="width:144px;">304000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SYBR Safe DNA gel stain</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">S33102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Rneasy Plus Mini Kit</td>
			<td style="width:221px;">Qiagen</td>
			<td style="width:144px;">74134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Oligo(dT) primer</td>
			<td style="width:221px;">Thermo Scientific</td>
			<td style="width:144px;">SO131</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">dNTP mix</td>
			<td style="width:221px;">Fermentas</td>
			<td style="width:144px;">R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Super Script III reverse transcriptase</td>
			<td style="width:221px;">Life Technologies</td>
			<td align="right" style="width:144px;">56575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">First strand cDNA synthesis buffer</td>
			<td style="width:221px;">Life Technologies</td>
			<td style="width:144px;">y02321</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SybrGreen qPCR Fast master mix</td>
			<td style="width:221px;">Applied Biosystems</td>
			<td align="right" style="width:144px;">4385612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>ACTGCATCCATATCGATGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">cxcl10 murine reverse primer</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>TTCATCGTGGCAATGATCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">il6 murine forward primer&#160;</td>
			<td style="width:221px;">Integrated DNA technologies</td>
			<td style="width:144px;">n/a</td>
			<td>GTAGCTATGGTACTCCAGAAGAC</td>
		</tr>
	</tbody>
</table>

stimulation of cytoplasmic dna sensing pathways in vitro and in vivo

Etkili bir doğuştan gelen bağışıklık tepkisini uyarmak için, DNA, yeterli uzunluk ve saflıkta olmalıdır. Biz, gerekli özelliklere sahip çift sarmallı DNA (dsDNA) algılama yolları ucuz ve kolaylıkla oluşturulabilir sitoplazmik DNA teşvik etmek için bir yöntem sunulmaktadır. Kısa sentetik oligonükleotidlerin (CpG motifleri eksik olan) en concatemerization ile, dsDNA sitosolik DNA algılama yolunu aktive etmek için yeterli bir uzunluğa sahip olması elde edilebilir. Bu protokol, etkili bir ligasyon meydana gelmesi için bir ortam sağlar polietilen glikol varlığında (PEG) içinde oligonükleotidlerin kör uç ligasyonu içerir. DsDNA karakterlerini, standart transfeksiyon protokolleri ile, in vitro olarak doğuştan gelen bağışıklık tepkisini için, fenol / kloroform ekstraksiyonu ile saflaştırma işleminden sonra, kullanılabilir. Bu DNA, aynı zamanda, örneğin, bir fare kulak kepçesine intradermal enjeksiyon yolu ile, in vivo doğal bağışıklığı uyarmak için kullanılabilir. Tarafındanconcatemerization işlemi ve daha sonraki stimülasyon protokolleri standartlaştırılması, doğuştan gelen bağışıklık sistemi, güvenilir ve yeniden üretilebilir bir aktivasyona üretilebilir.

<html> Aşağıdaki sonuçlar concatemerized DNA, nispeten kolay bir şekilde üretilebilir ve hücrelerde ve farelerde güçlü bir doğal bağışıklık tepkisini uyarabilen edilebileceğini gösterir. PEG8000 kullanımı ile, açık bir şekilde oluşturulan DNA uzunluğu önemli ölçüde daha uzun ve CXCL10 kopyalanmasının indükleme yeteneğine eşit olduğu görülebilir. Agaroz jel analizi ile görüldüğü gibi, PEG8000 ile numune için, DNA uzunluğu 10000 bp (Şekil 1A) aşan sarmallar da ...

Watch this Scientific Journal Video about Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo at JoVE.com

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

Sitoplazmik DNA Algılama Pathways uyarılması<em&gt; İn Vitro</em&gt; Ve<em&gt; In Vivo</em

Protokolün amacı hücrelerin in vivo ve in sitoplazmik DNA algılama yolları uyarılması için uygun yöntemler kullanılmasıdır. Bu uç ligasyonu içinde uzun bir çift şeritli DNA oluşumunu geliştirerek elde edilir. Hücreler daha sonra ya da farenin bir lipit transfeksiyon ayıracı kullanılarak transfekte edilir.

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA ...

Research

JoVE Journal

Biology

Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

In vitro ve in vivo Biyoparlaklık Reporter Gen Görüntüleme İnsan Embriyonik Kök Hücreleri

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

DNA Transfection of Mammalian Skeletal Muscles using In Vivo Electroporation

Memeli İskelet Kaslar kullanarak DNA Transfeksiyon In Vivo Elektroporasyon

 A growing interest in cell biology is to express transgenically modified forms of essential proteins (e.g. fluorescently tagged constructs and/or mutant ...

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo and in vitro Studies of Adaptor-clathrin Interaction

In vivo ve in vitro Adaptör-clathrin Etkileşim Çalışmaları

A major endocytic pathway initiates with the formation of clathrin-coated vesicles (CCVs) that transport cargo from the cell surface to endosomes1-6. CCVs ...

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

Visualization of MG53-mediated Cell Membrane Repair Using in vivo and in vitro Systems

MG53-aracılı Hücre Zarı Tamiri Görselleştirme In vivo Ve In vitro Sistemleri

Repair of acute injury to the cell membrane is an elemental process of normal cellular physiology, and defective membrane repair has been linked to many ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Sitokrom Sitoplazmik Mikroenjeksiyon Apoptoz aktivasyonu C</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

Ribozom Bağlı Doğan Polipeptitler İzolasyonu<em&gt; In vitro</em&gt; MRNA boyunca Translasyonel Duraklat Siteleri Belirleme

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

c-FOS Protein Immünohistolojik Algılama: Belirli Fizyolojik Yanıtları ilgilendim Merkez Pathways bir Marker Olarak Faydalı Aracı<em&gt; İn Vivo</em&gt; ve<em&gt; Ex Vivo</em

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

Nükleik Asitlerin süzülmesi İzolasyonu: basit ve hızlı DNA izolasyonu,

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glucose Uptake Measurement and Response to Insulin Stimulation in In Vitro Cultured Human Primary Myotubes

Glikoz Alımı Ölçümü ve İnsülin Uyarıcısına Yanıt<em&gt; In vitro</em&gt; Kültürlü İnsan Primer Miyotları

Skeletal muscle is the largest glucose deposit in mammals and largely contributes to glucose homeostasis. Assessment of insulin sensitivity of muscle ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

Vitro ve In Vivo yaklaşımlar Bağırsak epitel hücre geçirgenliği belirlemek için

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...