Name: a microfluidic-based electrochemical biochip for label-free dna hybridization analysis
Uploaded: 2014-09-10T13:00:00
Description: Watch this Scientific Journal Video about A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis at JoVE.com

Os autores agradecem o Robert W. Deutsch Foundation, a Agência de Redução de Ameaças à Defesa (DTRA) ea National Science Foundation Emerging Frontiers in Investigação e Inovação (EFRI) pelo apoio financeiro. Os autores também agradecem a NanoCenter Maryland e sua Fablab para suporte instalação de sala limpa.

1. Microfabricação do chip microfluídico <ol><li> Prepare Eletroquímica Chip <ol><li> Padrão Ouro Eletrodos <ol><li> Lavar a 4 &#39;wafer de silício em branco (qualidade prime) com acetona, metanol e isopropanol (&quot;AMI&quot; limpo). Lavar o isopropanol a partir da bolacha com água desionizada (DI), seguida por secagem com N2 arma. </li><li> Crescer uma espessa camada de SiO2 passivation 1 mícron com deposição química a vapor assistida por plasma (PECVD) ferramenta. Deposite um 200 ...

<ol>
	<li>Hong, J., Edel, J. B., deMello, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micro-+and+nanofluidic+systems+for+high-throughput+biological+screening.">Micro- and nanofluidic systems for high-throughput biological screening.</a> Drug Discov. Today. 14, 134-146 (2009).</li><li>Sun, Y., Kwok, Y. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymeric+microfluidic+system+for+DNA+analysis.">Polymeric microfluidic system for DNA analysis.</a> Anal. Chim. Acta. 556, 80-96 (2006).</li><li>Xu, Y., Yang, X., Wang, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review:+aptamers+in+microfluidic+chips.">Review: aptamers in microfluidic chips.</a> Anal. Chim. Acta. 683, 12-20 (2010).</li><li>Yang, W., Woolley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+multiprocess+microfluidic+systems+for+automating+analysis.">Integrated multiprocess microfluidic systems for automating analysis.</a> J. Lab. Automat. 15, 198-209 (2010).</li><li>Gervais, T., Jensen, K. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mass+transport+and+surface+reactions+in+micro&#64258;uidic+systems.">Mass transport and surface reactions in micro&#64258;uidic systems.</a> Chem. Eng. Sci. 61, 1102-1121 (2006).</li><li>Song, H., Ismagilov, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond+kinetics+on+a+microfluidic+chip+using+nanoliters+of+reagents.">Millisecond kinetics on a microfluidic chip using nanoliters of reagents.</a> J. Am. Chem. Soc. 125, 14613-14619 (2003).</li><li>Jiang, H., Weng, X. A., Li, D. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+whole-blood+immunoassays.">Microfluidic whole-blood immunoassays.</a> Microfluid. Nanofluid. 10, 941-964 (2011).</li><li>Dutse, S. W., Yusof, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics-based+lab-on-chip+systems+in+DNA-based+biosensing:+an+overview.">Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview.</a> Sensors. 11, 5754-5768 (2011).</li><li>Dittrich, P. S., Manz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lab-on-a-chip:+microfluidics+in+drug+discovery.">Lab-on-a-chip: microfluidics in drug discovery.</a> Nat. Rev. Drug Discov. 5, 210-218 (2006).</li><li>Craighead, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Future+lab-on-a-chip+technologies+for+interrogating+individual+molecules.">Future lab-on-a-chip technologies for interrogating individual molecules.</a> Nature. 442, 387-393 (2006).</li><li>Hunt, H. K., Armani, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+biological+and+chemical+sensors.">Label-free biological and chemical sensors.</a> Nanoscale. 2, 1544-1559 (2010).</li><li>Dukkipati, V. R., Pang, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+microfluidic+system+for+DNA+analysis.">Integrated microfluidic system for DNA analysis.</a> IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).</li><li>Fang, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+microfluidic+devices+with+concurrent+electrochemical+detection.">Real-time PCR microfluidic devices with concurrent electrochemical detection.</a> Biosens. Bioelectron. 24, 2131-2136 (2009).</li><li>Pavlovic, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+device+architecture+for+electrochemical+patterning+and+detection+of+multiple+DNA+sequences.">Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences.</a> Langmuir. 24, 1102-1107 (2008).</li><li>Xu, X., Zhang, S., Chen, H., Kong, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+electrochemistry+in+micro-total+analysis+systems+for+biochemical+assays:+recent+developments.">Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments.</a> Talanta. 80, 8-18 (2009).</li><li>Cai, H., Lee, T. M. -. H., Hsing, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+protein+recognition+using+an+aptamer-based+impedance+measurement+assay.">Label-free protein recognition using an aptamer-based impedance measurement assay.</a> Sensor. Actuat. B-Chem. 114, 433-437 (2006).</li><li>Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic+device+for+impedance+spectroscopy+analysis+of+biological+samples.">A Microfluidic device for impedance spectroscopy analysis of biological samples.</a> Sensor. Actuat. B-Chem. 123, 168-176 (2007).</li><li>Prakash, S. B., Abshire, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+cancer+cell+proliferation+on+a+CMOS+capacitance+sensor+chip.">Tracking cancer cell proliferation on a CMOS capacitance sensor chip.</a> Biosens. Bioelectron. 23, 1449-1457 (2008).</li><li>Yamaguchi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+fabrication+of+electrochemical+enzyme+sensor+chip+using+polydimethylsiloxane+microfluidic+channel.">Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel.</a> Anal. Chim. Acta. 468, 143-152 (2002).</li><li>Beebe, D. J., Mensing, G. A., Walker, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physics+and+applications+of+microfluidics+in+biology.">Physics and applications of microfluidics in biology.</a> Annu. Rev. Biomed. Eng. 4, 261-286 (2002).</li><li>Mariella, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sample+preparation:+the+weak+link+in+microfluidics-based+biodetection.">Sample preparation: the weak link in microfluidics-based biodetection.</a> Biomed. Microdevices. 10, 777-784 (2008).</li><li>Bhushan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Springer handbook of nanotechnology. , (2010).</li><li>Ghallab, Y. H., Badawy, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lab-on-a-chip: Techniques, circuits, and biomedical applications. , (2010).</li><li>Chee, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accessing+genetic+information+with+high-density+DNA+arrays.">Accessing genetic information with high-density DNA arrays.</a> Science. 25, 610-614 (1996).</li><li>Ma, K. -. S., Zhou, H., Zoval, J., Madou, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+hybridization+detection+by+label+free+versus+impedance+amplifying+label+with+impedance+spectroscopy.">DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy.</a> Sensor. Actuat. B-Chem. 114, 58-64 (2006).</li><li>Ito, T., Hosokawa, K., Maeda, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+single-base+mismatch+at+distal+end+of+DNA+duplex+by+electrochemical+impedance+spectroscopy.">Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy.</a> Biosens. Bioelectron. 22, 1816-1819 (2007).</li><li>Kao, L. T. -. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+detection+and+differentiation+of+the+DNA+strains+for+influenza+A+(H1N1+2009)+using+a+silicon-based+microfluidic+system.">Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system.</a> Biosens. Bioelectron. 26, 2006-2011 (2011).</li><li>Li, J., Chen, S., Evans, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Typing+and+subtyping+influenza+virus+using+DNA+microarrays+and+multiplex+reverse+transcriptase+PCR.">Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR.</a> J. Clin. Microbiol. 39, 696-704 (2001).</li><li>Gautier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybridization-induced+interfacial+changes+detected+by+non-faradaic+impedimetric+measurements+compared+to+faradaic+approach.">Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach.</a> J. Electroanal. Chem. 610, 227-233 (2007).</li><li>Ma, Y., Jiao, K., Yang, T., Sun, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sensitive+PAT+gene+sequence+detection+by+nano-SiO2/p-aminothiophenol+self-assembled+films+DNA+electrochemical+biosensor+based+on+impedance+measurement.">Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement.</a> Sensor. Actuat. B-Chem. 131, 565-571 (2008).</li><li>Kim, J. H. -. S., Marafie, A., Jia, X. -. Y., Zoval, J. V., Madou, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+DNA+hybridization+kinetics+in+a+microfluidic+flow+channel.">Characterization of DNA hybridization kinetics in a microfluidic flow channel.</a> Sensor. Actuat. B-Chem. 113, 281-289 (2006).</li><li>Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+electrochemical+sensor+array+for+characterizing+protein+interactions+with+various+functionalized+surfaces.">Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces.</a> Anal. Chem. 83, 5920-5927 (2011).</li><li>Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic-based+electrochemical+biochip+for+label-free+diffusion-restricted+DNA+hybridization+analysis.">A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis.</a> Biosens. Bioelectron. 38, 114-120 (2012).</li><li>Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-assembled+monolayers+for+biosensors.">Self-assembled monolayers for biosensors.</a> Analyst. 122, 43R-50R (1997).</li><li>McEwen, G. D., Chen, F., Zhou, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization,+hybridization,+and+oxidation+of+synthetic+DNA+on+gold+surface:+Electron+transfer+investigated+by+electrochemistry+and+scanning+tunneling+microscopy.">Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy.</a> Anal. Chim. Acta. 643, 26-37 (2009).</li><li>Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+surface+charging+during+the+coadsorption+of+mercaptohexanol+to+DNA+layers+on+gold:+Direct+observation+of+desorption+and+layer+reorientation.">The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation.</a> Langmuir. 22, 5560-5562 (2006).</li><li>Katz, E., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+biomolecular+interactions+at+conductive+and+semiconductive+surfaces+by+impedance+spectroscopy:+Routes+to+impedimetric+immunosensors,+DNA-sensors,+and+enzyme+biosensors.">Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors.</a> Electroanalysis. 15, 913-947 (2003).</li></ol>

Nossos procedimentos demonstram a fabricação de um biochip eletroquímico baseado em microfluídica e sua utilização para a análise de eventos de hibridização DNA. Através de um processo de alto rendimento microfabricação controlada desenvolvemos um dispositivo composto por canais em microescala integrados com uma matriz de transdutores electroquímicos. Nós planejamos parâmetros de processamento controlados para o procedimento de fotolitografia do chip eletroquímica eo molde canal microfluídicos através ...

Lab-on-a-chip dispositivos microfluídicos (LOC) oferecem inúmeras vantagens em diagnósticos clínicos, monitoramento ambiental e pesquisa biomédica. Estes dispositivos utilizam canais de microfluidos para controlar o fluxo do fluido às regiões do chip em que uma variedade de processos pode ocorrer incluindo a mistura de reagente, a afinidade de ligação com base, a transdução de sinal, e a cultura de células 1-4. Microfluídica oferece muitas vantagens sobre as ferramentas de diagnóstico clínicos convencionais, tais como leitores de microplaca ou eletroforéticos testes de desvio de gel. Dispositivos de microfluidos requerem 2 a 3 ordens de magnitude (em oposição nanolitros a microlitros) menos reagentes para efectuar ensaios semelhantes. Além disso, estes dispositivos podem aumentar a velocidade com que alguns eventos biológicos ocorrer devido ao menor confinamento das espécies dentro dos canais 5,6. Em terceiro lugar, os sensores podem ser integrados dentro de dispositivos microfluídicos usando técnicas de litografia e gravura, que podem fornecer detectio sem rótulon. Finalmente, estes dispositivos são de produção barata e exigem pouco trabalho por parte do técnico para operar 7-10. Detecção livre de marcador é tipicamente realizada usando um transdutor óptico ou eléctrico. Dispositivos ópticos podem apresentar um melhor desempenho de detecção devido a menor interferência com analitos presentes na amostra. No entanto, seu desempenho fica comprometida nos casos em que o fundo da amostra tem o mesmo comprimento de onda ressonante como o sensor 11. Há muitas vantagens em usar sinais elétricos para realizar a detecção biológica e química em sistemas microfluídicos. A fabricação é inerentemente menos complicada, uma vez que estes sensores geralmente requerem apenas eléctrodos padronizados para operar. Além disso, os sinais eléctricos podem ser directamente em interface com a maioria do equipamento de medição, enquanto outras modalidades de sinalização pode exigir um transdutor para converter o sinal de 12-15. Sensores elétricos comumente medir as mudanças na impedance 16,17, capacitância 18, ou redox atividade 19. No entanto, novos desafios são apresentados como estes sistemas são miniaturizados. Os desafios mais importantes para superar incluem: preparação de amostras e mistura de fluidos (devido ao baixo volume de amostra e número de Reynolds), efeitos físicos e químicos (incluindo forças capilares, rugosidade da superfície, interações químicas entre materiais de construção e analitos), de baixo sinal para-ruído (produzido pela redução da área de superfície e volume) 20-23, e a interferência potencial de analitos electroactivas em amostras biológicas complexas (por exemplo, de sangue e de saliva). Outras investigações destes efeitos resultarão em diretrizes para uma fabricação precisa e operação destes dispositivos de forma reproduzível que iria melhorar em seu desempenho geral. A detecção de hibridação de ADN é usado extensivamente para o diagnóstico de doenças genéticas 24,25 e várias formas de cancer 26. Todos os anos, várias cepas de influenza são identificados em pacientes que utilizam os resultados de técnicas de hibridização DNA 27. O vírus da gripe responde sozinho por 36 mil mortes por ano nos Estados Unidos 28. Tais exemplos poderiam beneficiar de uma bancada dispositivo de microfluidos, que pode executar as mesmas técnicas de teste como um teste de desvio de leitor de placas ou de gel com baixo volume de amostra e a uma fracção do custo, sem sacrificar a sensibilidade ou especificidade. Devido às muitas vantagens da detecção electroquímica livre de marcador, tem sido amplamente utilizado para a detecção de eventos de hibridação de ADN 29,30. A configuração em que os eléctrodos de macro-escala (na gama de milímetro) são imersas em provetas com a solução de interesse pode ser utilizado para proporcionar dados muito sensíveis em relação à cinética de ligação de sequências de ADN de cadeia simples, que correspondem às suas sequências complementares. Recentemente, tem havido alguns avanços na incorporação de sensor eletroquímico em microfluidics para hibridação de ADN. Estudos têm sido realizados sobre a cinética de hibridização 31 e integração de sensores para detecção de 15 em canais microfluídicos. No entanto, continua a existir a necessidade de um dispositivo de microfluidos de alto rendimento e que pode analisar eventos de hibridação de ADN em paralelo, sem complicados passos de preparação de amostra. O dispositivo apresentado neste trabalho fornece uma plataforma que permite múltiplas interações para ser exibido em paralelo e sem complicadas etapas de preparação da amostra. Nosso protocolo apresenta como microfluídicos baseados em biochips eletroquímicos são microfabricados com sistemas micro-eletromecânicos (MEMS) 32,33. Descreve-se o processo de fabricação, tanto o chip de microfluidos, feita de polidimetilsiloxano (PDMS), e o chip de electroquímica, composta por uma matriz de eléctrodos. A funcionalização química do biochip com sondas ssDNA também é abordada. Finalmente, o abildade do biossensor para detectar especificamente e analisar alvos de ADNcs é demonstrada. Em geral, o biochip electroquímica à base de microfluidos é uma técnica rápida e análises de elevado rendimento. Ele pode ser usado para investigar interacções entre moléculas biológicas e realizando transdutores, e pode ser utilizado em uma variedade de aplicações lab-on-a-chip.

<table border="0" cellpadding="0" cellspacing="0" width="765">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:155px;">Company</td>
			<td style="width:227px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Material</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">4&#39;&#39; Silicon wafer</td>
			<td style="width:155px;">Ultrasil</td>
			<td style="width:227px;">4-5664</td>
			<td>Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm*cm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Shipley 1813 photoresist (&#34;PR1&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">AZ5214 photoresist (&#34;PR2&#34;)</td>
			<td style="width:155px;">Hoechst Celanse</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SU-8 50 photoresist (&#34;PR3&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">negative photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gold etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">TFA</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chromium etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">1020AC</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS elastomer</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097366 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS curing agent</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097358 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Biopsy punching tool</td>
			<td style="width:155px;">Healthlink</td>
			<td style="width:227px;">BP20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible tubing</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">R 3603</td>
			<td>.015&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible adapter</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">06417-41</td>
			<td>.0625&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">1 mL syringe</td>
			<td style="width:155px;">Beckton-Dickenson</td>
			<td align="right" style="width:227px;">301025</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Monobasic potassium phosphate</td>
			<td style="width:155px;">Fluka</td>
			<td align="right" style="width:227px;">1551139</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium phosphate dibasic anhydrous</td>
			<td style="width:155px;">Sigma</td>
			<td style="width:227px;">RES20765-A7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium chloride</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:227px;">S7653</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">tris(2-carboxyethyl)phosphine</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">C4706</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">6-mercapto-1-hexanol</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">451088</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">20x concentrated saline-sodium citrate buffer</td>
			<td style="width:155px;">Sigma</td>
			<td align="right" style="width:227px;">93017</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium hexacyanoferrate(III)</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">455946</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium ferrocyanide</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">CDS001589</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/AAAGCTCCGATAGCGCTCCG 
			TGGACGTCCC-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-GGGACGTCCACGGAGCGCTA 
			TCGGAGCTTT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA 
			ATCGATGAGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-ACTCATCGATTCGTCAATGA 
			CCTGACCCGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA 
			CCCATGATGA-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-TCATCATGGGTCTAACTACT 
			GGATCTAGGT-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Instrument</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Plasma Enhanced Chemical Vapor Deposition (PECVD)</td>
			<td style="width:155px;">Oxford Instruments</td>
			<td style="width:227px;">PlasmaLab System 100</td>
			<td>Chamber pressure 1000 mTorr, Tempreture 200 celsius degrees, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Angstrom/minute.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DC sputtering unit</td>
			<td style="width:155px;">AJA International</td>
			<td style="width:227px;">ATC 1800-V</td>
			<td>For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">E-beam evaporation system</td>
			<td style="width:155px;">Denton</td>
			<td style="width:227px;">Custom-built</td>
			<td>For Titanium: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 6-10 Angstrom/second. For Platinum: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 2-3 Angstrom/second.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Potentiostat</td>
			<td style="width:155px;">CH Instruments</td>
			<td style="width:227px;">660D</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Syringe pump</td>
			<td style="width:155px;">KD Scientific</td>
			<td style="width:227px;">KDS230</td>
			<td></td>
		</tr>
	</tbody>
</table>

a microfluidic-based electrochemical biochip for label-free dna hybridization analysis

A miniaturização de procedimentos analíticos de bancada para a micro-escala fornece vantagens significativas em relação ao tempo de reacção, o custo, e a integração dos passos de pré-processamento. Utilizando estes dispositivos para a análise de eventos de hibridação de ADN é importante porque oferece uma tecnologia para a avaliação em tempo real dos marcadores no ponto de atendimento para várias doenças. No entanto, quando a pegada dispositivo diminui o domínio de vários aumentos de fenômenos físicos. Estes fenómenos influenciar a precisão de fabrico e a fiabilidade de operação do dispositivo. Portanto, há uma grande necessidade de fabricar e operar com precisão estes dispositivos de uma maneira reprodutível, a fim de melhorar o desempenho global. Aqui, descrevemos os protocolos e os métodos utilizados para a fabricação e operação de um biochip eletroquímica microfluídica à base para a análise precisa de eventos de hibridização DNA. O biochip é composto por duas partes: um chip de microfluidos comtrês micro-canais paralelos feitos de polidimetilsiloxano (PDMS), e um 3 x 3 dispostas electroquímica de micro-chip. Os eventos de hibridização DNA são detectados através da análise de espectroscopia de impedância eletroquímica (EIS). A análise EIS permite variações de monitoramento das propriedades do sistema eletroquímico que são dominantes nessas escalas de comprimento. Com a capacidade de monitorar as alterações de ambos e de transferência de carga com a resistência à difusão do biossensor, que demonstram a selectividade para alvos de ADNcs complementares, calculado um limite de detecção de 3,8 nM, e uma reactividade cruzada de 13% com outro ADNcs não complementar a seguir 20 min de incubação. Esta metodologia pode melhorar o desempenho dos dispositivos miniaturizados por elucidar sobre o comportamento de difusão no regime de micro-escala e por permitir o estudo de eventos de hibridação de ADN.

Um processo de fabricação controlado e preciso para o dispositivo experimental é essencial para a investigação. Ela permite ao pesquisador obter experimentos reprodutíveis rendimento e alta. Aqui demonstramos um rendimento elevado, o processo de microfabricação alta reprodutibilidade de um biochip electroquímica microfluidos-base (Figura 1). Com uma taxa de falha baixa, alguns dispositivos têm mostrado problemas de ligação que conduzem a fugas de solução. De modo a validar a actividade ele...

Watch this Scientific Journal Video about A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis at JoVE.com

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Nós apresentamos um biochip electroquímica à base de microfluidos para a detecção de hibridação de ADN. Após a funcionalização ADNcs sonda, a especificidade, a sensibilidade, e o limite de detecção são estudadas com alvos de ADNcs complementares e não complementares. Os resultados ilustram a influência dos eventos de hibridação de ADN no sistema electroquimico, com um limite de detecção de 3,8 nM.

A Biochip eletroquímica microfluídica à base de Análise de hibridação DNA livre-Label

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

Research

JoVE Journal

Bioengineering

A Microfluidic-based Hydrodynamic Trap for Single Particles

A Armadilha hidrodinâmica microfluídicos baseados em partículas individuais

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Bioengenharia

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

Fabricação de Eletroquímica-DNA Biossensores para Detecção Reagentless de ácidos nucléicos, proteínas e pequenas moléculas

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Non-contact, Label-free Monitoring of Cells and Extracellular Matrix using Raman Spectroscopy

Sem contato, Monitoramento Label livre de células e matriz extracelular utilizando Espectroscopia Raman

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, ...

Hollow Microneedle-based Sensor for Multiplexed Transdermal Electrochemical Sensing

Sensor de microagulhas baseado oco para Multiplexed Transdermal Eletroquímica Sensing

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Bacterial Detection & Identification Using Electrochemical Sensors

Bacteriana Detecção e Identificação Utilizando sensores eletroquímicos

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Multi-analyte Biochip (MAB) Based on All-solid-state Ion-selective Electrodes (ASSISE) for Physiological Research

Multi-analyte Biochip MAB Based on All-solid-state Ion-selective Electrodes ASSISE for Physiological Research

Multi-analito Biochip (MAB) Com base em eletrodos íon-seletivos All-solid-state (ASSISE) para a pesquisa fisiológica

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) ...

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans' Locomotion

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans' Locomotion

Electrotaxis baseados em microfluídica para análise quantitativa On-demand de<em&gt; Caenorhabditis elegans</em&gt; &#39;Locomotion

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and ...

A Label-free Technique for the Spatio-temporal Imaging of Single Cell Secretions

A técnica de livre-Label para a imagem espaço-temporal do Secreções única célula

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning ...

Label-free Single Molecule Detection Using Microtoroid Optical Resonators

Único Detecção de Moléculas livre-Label Usando Microtoroid ópticos Resonators

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental ...

PIP-on-a-chip: A Label-free Study of Protein-phosphoinositide Interactions

PIP-on-a-chip: um estudo livre de rótulos de Interações Proteína-fosfoinositide

Numerous cellular proteins interact with membrane surfaces to affect essential cellular processes. These interactions can be directed towards a specific ...