Name: sublingual immunotherapy as an alternative to induce protection against acute respiratory infections
Uploaded: 2014-08-30T14:00:00
Duration: 16 min 56 s
Description: Watch this Scientific Journal Video about Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections at JoVE.com

We acknowledge Dr. Jean-Claude Sirard from the Center for Infection and Immunity of Lille, Institute Pasteur de Lille-France, for kindly providing the purified flagellin and Dr. Teresa Camou, Director of the National Reference Laboratory, Ministry of Health of Uruguay for kindly providing the pneumococcal strain. 
The authors would like to express their acknowledgement to Mr. Diego Acosta and Mr. Ignacio Turel form BichoFeo Producciones-Uruguay for their commitment and hard work during the entire video production and edition. 
This work was supported by the grants PR_FCE_2009_1_2783 and BE_POS_2010_1_2544 from the National Agency of Research and Innovation, ANII from Uruguay, the Program for Development of Basic Sciences, PEDECIBA of Uruguay and Sectoral Commission of Scientific research, CSIC-Universidad de la Rep&#250;blica, Uruguay.

<ol>
	<li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+vaccines+WHO+position+paper--2012.">Pneumococcal vaccines WHO position paper--2012.</a> Weekly Epidemiological Record. 14, 129-144 (2012).</li><li>Appelbaum, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carriage+of+antibiotic-resistant+Streptococcus+pneumoniae+by+children+in+eastern+and+central+Europe-a+multicenter+study+with+use+of+standardized+methods.">Carriage of antibiotic-resistant Streptococcus pneumoniae by children in eastern and central Europe-a multicenter study with use of standardized methods.</a> Clin Infect Dis. 23, 712-717 (1996).</li><li>Ramirez, J. A., Anzueto, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+needs+of+community-acquired+pneumonia.">Changing needs of community-acquired pneumonia.</a> J Antimicrob Chemother. 66, 3-9 (2011).</li><li>Cuburu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+immunization+induces+broad-based+systemic+and+mucosal+immune+responses+in+mice.">Sublingual immunization induces broad-based systemic and mucosal immune responses in mice.</a> Vaccine. 25, 8598-8610 (2007).</li><li>Pedersen, G. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+sublingual+route+for+administration+of+influenza+H5N1+virosomes+in+combination+with+the+bacterial+second+messenger+c-di-GMP.">Evaluation of the sublingual route for administration of influenza H5N1 virosomes in combination with the bacterial second messenger c-di-GMP.</a> PLoS One. 25, 1-12 (2011).</li><li>Song, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+vaccination+with+influenza+virus+protects+mice+against+lethal+viral+infection.">Sublingual vaccination with influenza virus protects mice against lethal viral infection.</a> Proc Natl Acad Sci USA. 105, 1644-1649 (2008).</li><li>Cogo, R., Ramponi, A., Scivoletto, G., Rippoli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prophylaxis+for+acute+exacerbations+of+chronic+bronchitis+using+an+antibacterial+sublingual+vaccine+obtained+through+mechanical+lysis:+a+clinical+and+pharmacoeconomic+study.">Prophylaxis for acute exacerbations of chronic bronchitis using an antibacterial sublingual vaccine obtained through mechanical lysis: a clinical and pharmacoeconomic study.</a> Acta Biomed. 74, 76-87 (2003).</li><li>Rosaschino, F., Cattaneo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimizing+compliance+of+paediatric+patients+for+seasonal+antibacterial+vaccination+with+sublingually+administered+Polyvalent+Mechanical+Bacterial+Lysates+(PMBL).">Strategies for optimizing compliance of paediatric patients for seasonal antibacterial vaccination with sublingually administered Polyvalent Mechanical Bacterial Lysates (PMBL).</a> Acta Biomed. 75, 171-178 (2004).</li><li>Senna, G., Caminati, M., Canonica, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Safety+and+tolerability+of+sublingual+immunotherapy+in+clinical+trials+and+real+life.">Safety and tolerability of sublingual immunotherapy in clinical trials and real life.</a> Curr Opin Allergy Clin Immunol. 13, 656-662 (2013).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+dendritic+cells+mediate+antigen-specific+tolerance+by+stimulating+TH1+and+regulatory+CD4++T+cells.">Oral dendritic cells mediate antigen-specific tolerance by stimulating TH1 and regulatory CD4+ T cells.</a> J Allergy Clin Immunol. 122, 603-609 (2008).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+the+lingual+immune+system+reveals+the+presence+of+both+regulatory+and+effector+CD4++T+cells.">Mapping of the lingual immune system reveals the presence of both regulatory and effector CD4+ T cells.</a> Clin Exp Allergy. 39, 1910-1919 (2009).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+macrophage-like+cells+play+a+key+role+in+tolerance+induction+following+sublingual+immunotherapy+of+asthmatic+mice.">Oral macrophage-like cells play a key role in tolerance induction following sublingual immunotherapy of asthmatic mice.</a> Mucosal Immunology. 4, 638-647 (2011).</li><li>Hervouet, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen-bearing+dendritic+cells+from+the+sublingual+mucosa+recirculate+to+distant+systemic+lymphoid+organs+to+prime+mucosal+CD8+T+cells.">Antigen-bearing dendritic cells from the sublingual mucosa recirculate to distant systemic lymphoid organs to prime mucosal CD8 T cells.</a> Mucosal Immunology. 7, 280-291 (2014).</li><li>Munoz, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+administration+of+flagellin+protects+mice+from+Streptococcus+pneumoniae+lung+infection.">Mucosal administration of flagellin protects mice from Streptococcus pneumoniae lung infection.</a> Infect Immun. 78, 4226-4233 (2010).</li><li>Hayashi, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+innate+immune+response+to+bacterial+flagellin+is+mediated+by+Toll-like+receptor+5.">The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5.</a> Nature. 410, 1099-1103 (2001).</li><li>Lightfield, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+function+for+Naip5+in+inflammasome+activation+by+a+conserved+carboxy-terminal+domain+of+flagellin.">Critical function for Naip5 in inflammasome activation by a conserved carboxy-terminal domain of flagellin.</a> Nature Immunology. 9, 1171-1178 (2008).</li><li>Lightfield, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+requirements+for+NAIP5+in+activation+of+the+NLRC4+inflammasome.">Differential requirements for NAIP5 in activation of the NLRC4 inflammasome.</a> Infect Immun. 79, 1606-1614 (2011).</li><li>Honko, A. N., Mizel, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+administration+of+flagellin+induces+innate+immunity+in+the+mouse+lung.">Mucosal administration of flagellin induces innate immunity in the mouse lung.</a> Infect Immun. 72, 6676-6679 (2004).</li><li>Janot, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radioresistant+cells+expressing+TLR5+control+the+respiratory+epithelium's+innate+immune+responses+to+flagellin.">Radioresistant cells expressing TLR5 control the respiratory epithelium's innate immune responses to flagellin.</a> Eur J Immunol. 39 (6), 1587-1596 (2009).</li><li>Van Maele, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TLR5+signaling+stimulates+the+innate+production+of+IL-17+and+IL-22+by+CD3(neg)CD127++immune+cells+in+spleen+and+mucosa.">TLR5 signaling stimulates the innate production of IL-17 and IL-22 by CD3(neg)CD127+ immune cells in spleen and mucosa.</a> J Immunol. 185, 1177-1185 (2010).</li><li>Lee, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurologic+adverse+events+following+influenza+A+(H1N1)+vaccinations+in+children.">Neurologic adverse events following influenza A (H1N1) vaccinations in children.</a> Pediatrics international: official journal of the Japan Pediatric Society. 54, 325-330 (2012).</li><li>Lewis, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+facial+nerve+paralysis+(Bell's+palsy)+following+intranasal+delivery+of+a+genetically+detoxified+mutant+of+Escherichia+coli+heat+labile+toxin.">Transient facial nerve paralysis (Bell's palsy) following intranasal delivery of a genetically detoxified mutant of Escherichia coli heat labile toxin.</a> PLoS One. 4, e6999 (2009).</li><li>Mutsch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+the+inactivated+intranasal+influenza+vaccine+and+the+risk+of+Bell's+palsy+in+Switzerland.">Use of the inactivated intranasal influenza vaccine and the risk of Bell's palsy in Switzerland.</a> N Engl J Med. 350, 896-903 (2004).</li><li>Kuo, C. H., Wang, W. L., Chu, Y. T., Lee, M. S., Hung, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+immunotherapy+in+children:+an+updated+review.">Sublingual immunotherapy in children: an updated review.</a> Pediatr Neonatol. 50, 44-49 (2009).</li><li>Nempont, C., Cavet, D., Rumbo, M., Bompard, C., Villeret, V., Sirard, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deletion+of+flagellin's+hypervariable+region+abrogates+antibody-mediated+neutralization+and+systemic+activation+of+TLR5-dependent+immunity.">Deletion of flagellin's hypervariable region abrogates antibody-mediated neutralization and systemic activation of TLR5-dependent immunity.</a> J. Immunol. 181, 2036-2043 (2008).</li><li>Marques, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+Streptococcus+pneumoniae+serotype+1+acute+infection+shows+a+signature+of+Th17-+and+IFN-gamma-mediated+immunity.">Protection against Streptococcus pneumoniae serotype 1 acute infection shows a signature of Th17- and IFN-gamma-mediated immunity.</a> Immunobiology. 217, 420-429 (2012).</li><li>Stewart, C. C., Stewart, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Titering+antibodies.">Titering antibodies.</a> Current Protocols in Cytometry. 4, Unit 4.1 (2001).</li><li>Kubista, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+real-time+polymerase+chain+reaction.">The real-time polymerase chain reaction.</a> Molecular Aspects of Medicine. 27, 95-125 (2006).</li><li>Pedersen, G., Cox, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mucosal+vaccine+quandary:+intranasal+vs.+sublingual+immunization+against+influenza.">The mucosal vaccine quandary: intranasal vs. sublingual immunization against influenza.</a> Human Vaccines &amp; Immunotherapeutics. 8, 689-693 (2012).</li><li>Vitaliti, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+immunity+and+sublingual+immunotherapy+in+respiratory+disorders.">Mucosal immunity and sublingual immunotherapy in respiratory disorders.</a> Journal of Biological Regulators and Homeostatic Agents. 26, S85-S93 (2012).</li></ol>

The authors have nothing to disclose.

चिकित्सीय एजेंटों की sublingual प्रशासन श्वसन तंत्र में प्रतिरक्षा प्रतिक्रिया मिलाना एक उपयोगी साधन के रूप में साबित किया गया है. सांस की शर्तों के उपचार के लिए भट्ठा का मुख्य लाभ यह intranasal प्रशासन 31 के आधार पर उपचार की तुलना में सुरक्षित किया जा रहा है, फेफड़े या नाक में यौगिकों के प्रत्यक्ष प्रसव को शामिल नहीं करता है. Sublingual immunotherapy या तो एलर्जी सूजन और अस्थमा 32 के लक्षण उन्नति कर सकते हैं या जैसा कि यहाँ दिखाया गंभीर फेफड़ों में संक्रमण के इलाज के लिए सहज प्रतिरक्षा तंत्र की क्षणिक सक्रियण प्रेरित करने के लिए है कि विनियामक प्रतिक्रियाओं के शामिल होने के लिए, अलग अलग तरीकों से प्रतिरक्षा प्रतिक्रिया मिलाना करने के लिए इस्तेमाल किया जा सकता है. इस वीडियो में प्रस्तुत माउस मॉडल भट्ठा के लिए चिकित्सीय एजेंट के रूप में विभिन्न यौगिकों की जांच के लिए एक सुविधाजनक तरीका है. इस पशु मॉडल प्रभाव को निर्धारित करने के लिए एक उपयोगी साधन प्रदान करता हैफेफड़ों &#39;प्रतिरक्षा प्रतिक्रिया के साथ ही अन्य अंगों (जैसे., लिम्फ नोड्स या बाहर का mucosal साइटों draining) में इन विट्रो मॉडल के उपयोग से मजाक उड़ाया नहीं किया जा सकता कि में भट्ठा की. Sublingual immunotherapy का उपयोग कर प्राप्त परिणामों का वर्णन है कि कई कागजात हालांकि वहाँ, मांसल प्रशासन की प्रक्रियाओं के लिए विस्तृत तरीके अभी तक उपलब्ध नहीं किया गया है. इसके अतिरिक्त, मॉडल श्वसन तंत्र में प्रणालीगत के साथ ही स्थानीय संरक्षण प्रदान करने का लक्ष्य मांसल टीके के मूल्यांकन के लिए इस्तेमाल किया जा सकता है. साथ वीडियो में दिखाया गया है, यौगिकों के मांसल प्रशासन आसानी से गहन प्रशिक्षण की आवश्यकता के बिना किया जा सकता है कि एक साधारण प्रक्रिया है. आमतौर पर, पशुओं के प्रबंध में कुशल एक व्यक्ति इस प्रोटोकॉल में वर्णित के रूप में इंजेक्शन anesthetics का उपयोग कर 10 चूहों के एक समूह में भट्ठा प्रदर्शन करने के लिए 1 घंटे की आवश्यकता होगी. न्यूमोकोकल चुनौती के रूप में अच्छी तरह से किया जाता है, तो 90 अतिरिक्त मिनट तैयार करने के लिए आवश्यक हो जाएगाजीवाणु निलंबन और जानवरों की intranasal चुनौती प्रदर्शन करते हैं. यहाँ प्रस्तुत FACS प्रोटोकॉल फेफड़ों &#39;सेल गतिशीलता पर लिम्फ नोड्स के साथ ही उनके प्रभाव draining, प्रशासन के स्थानीय स्थल पर भट्ठा के प्रभाव की सुविधाजनक लक्षण वर्णन अनुमति देते हैं. ब्रोन्कोएल्वियोलर सामग्री और फेफड़ों पैरेन्काइमा की अलग विश्लेषण एयरवेज के प्रतिरक्षा निवासी और ऊतक के भीतर रहते हैं कि उन से सेल प्रकार घुसपैठ भेदभाव के लिए महत्वपूर्ण है. बाल सामग्री के विश्लेषण से वायुकोशीय मैक्रोफेज कारोबार के अध्ययन के साथ ही विभिन्न उपचार द्वारा प्रेरित वायुकोशीय रिक्त स्थान, उदा., PMNs, इयोस्नोफिल्स, monocytes में कोशिकाओं भर्ती की गतिशीलता की अनुमति देता है. बाल भी एंजाइम से जुड़ी immunosorbent परख (एलिसा) या मांसल टीकाकरण के बाद हासिल स्रावित IgA एंटीबॉडी का पता लगाने के द्वारा स्रावित साइटोकिन्स और chemokines की उपस्थिति का आकलन किया जा सकता है. फेफड़ों &#39;के ऊतकों का अध्ययनअन्य प्रकार की कोशिकाओं, प्रतिष्ठित वृक्ष के समान कोशिकाओं, टी कोशिकाओं और बी कोशिकाओं के लक्षण वर्णन अनुमति देगा. FACS विश्लेषण के लिए बाल के नमूने और लिम्फ नोड्स की तैयारी सरल है. नमूना संग्रह के बाद, सामान्य रूप से 60 मिनट में 10-20 नमूने के लिए धुंधला प्रोटोकॉल पूरा करना आवश्यक है. बाह्य मैट्रिक्स के पाचन के लिए आवश्यक है, क्योंकि इसके विपरीत, फेफड़ों या मांसल ऊतक से कोशिकाओं का अलगाव और अधिक समय की आवश्यकता होगी. मांसल मार्ग द्वारा दिया चिकित्सीय एजेंट के अवशोषण vivo इमेजिंग सिस्टम में उपयोग कर fluorescently या radioactively लेबल अणुओं की ट्रैकिंग से संबोधित किया जा सकता है. Sublingual immunotherapy प्रभावी रूप से प्रतिरक्षा श्वसन तंत्र में प्रतिक्रियाओं के रूप में अच्छी तरह से इलाज या सांस की शर्तों को रोकने के लिए इस्तेमाल किया जा सकता है कि प्रणालीबद्ध प्रेरित करने के लिए एक आकर्षक तरीका है. भट्ठा मैं के बाद श्वसन तंत्र में प्रतिरक्षा प्रतिक्रिया की सहनशीलता बनाम सक्रियण का निर्धारण तंत्र की व्याख्याविभिन्न सांस की शर्तों के खिलाफ उपलब्ध उपचार के साथ अकेले या संयोजन में इस्तेमाल किया जा सकता है कि नए चिकित्सीय रणनीतियों का तर्कसंगत डिजाइन की अनुमति के लिए महत्वपूर्ण है.

The overall goal of this work is to illustrate the benefits of sublingual immunotherapy for the treatment of acute respiratory infections (ARI) and present the advantages of this delivery route compared to other routes of administration, namely intranasal.
ARI cause millions of deaths every year especially in children under five. Streptococcus pneumoniae remains as one of the major etiological agents of bacterial pneumonia in infants and the elderly1,2. To present, the main available treatment relies on the use of antibiotics but resistant strains are continuously arising3,4.
SLIT induces broad responses at systemic and also mucosal level, particularly at the respiratory tract5. It has proven effectiveness against influenza infection, promoting long term protection with production of humoral and cellular responses6,7. Besides, it has been shown that prophylactic treatment with bacterial lysates delivered by sublingual route reduced exacerbations of chronic obstructive bronchitis in the elderly8 and prevented recurrent respiratory infections in children9. SLIT has been widely used for the treatment of allergies and asthma. Clinical studies had not only demonstrated its efficacy to modulate the immune response in the respiratory tract but also its safety10. Despite the growing interest of pharmaceutical companies and researchers in SLIT, the mechanisms involved in the induction of mucosal immune responses after sublingual delivery of compounds remain obscure. Recently, attention has been focused on the mechanisms promoting tolerance associated with allergen desensitization. It has been proposed that resident and recruited cells at the sublingual mucosa, like dendritic cells and macrophages, can promote tolerance after SLIT11-13. Dendritic cells of the oral mucosa can promote IFN-gamma and IL-10 producing T helper cells11 as well as recirculate to the distal genital mucosa and promote CD8+ T cells14. However, little is known about the impact of SLIT on innate cells or its capacity to improve pathogen clearance during acute respiratory infections.
The natural control of pneumococcal infection in the lungs greatly depends on the efficient and swift activation of local innate defences. We previously showed that enhancement of lungs&#8217; innate immunity by a single intranasal dose of flagellin (FliC), a TLR5 and NLRC4 agonist, protects 75-100% of mice challenged with a lethal dose of a clinical isolate of Streptococcus pneumoniae serotype 1. This protection was shown to be dependent on local recruitment of GR1+ cells (likely polymorphonuclear neutrophils, PMNs) and not dependent on antibodies, B or T cells15. 
Flagellin is the structural component of the bacterial flagellum. In its monomeric form it is recognized by two Pathogen Recognition Receptors (PRRs), TLR5 that senses extracellular FliC16 and NLRC4/NAIP5 inflammasome that detects intracellular flagellin17,18. When FliC is sensed by the PRRs an important inflammatory response is triggered. We and others have demonstrated that instillation of purified FliC from Salmonella enterica serovar Typhimurium into the lungs drives swift production of chemokines and cytokines specially when recognized by the lungs&#8217; epithelium that in turn orchestrate the recruitment of immune cells into the airways, mainly PMNs15,19-21. Although transient, the substantial neutrophil infiltration that takes place into the airways after nasal delivery of FliC could be a concern if moving towards clinical therapies for human use. Excessive inflammation could be detrimental for the lungs&#8217; function. Moreover, it has been shown that intranasal delivery of immunostimulatory molecules may cause facial paralysis and/or brain toxicity22-24. 
Sublingual immunotherapy offers a safer alternative to modulate the immune response in the respiratory tract compared to the intranasal route. It is non-invasive, painless, simple and has good patient compliance25. Furthermore, as mentioned before, it can induce protective responses in the respiratory mucosa without the risks associated to direct intranasal or intrapulmonary delivery of formulations. Sublingual route could be alternatively used to deliver molecules that have great effects onto the lung&#8217;s immune system but that have been proven to be toxic or to elicit great inflammation when administered intranasally. Besides these advantages, formulations for sublingual immunotherapy have lower cost of manufacture since non-sterile products can be delivered by this route and endotoxic shock is not a concern for SLIT. On the other hand, it is worth noticing that higher doses of the immunostimulatory compounds compared to those used by intranasal or parenteral routes are necessary to induce an immune response in the lungs; also highly concentrated solutions are needed when using the mouse model of SLIT since the anatomical site where the formulations are deposited is small. 
Based on our previous published data, we developed a model of protection using sublingual immunotherapy with flagellin as model immunostimulant. We demonstrated that a single dose of flagellin induced 60% survival against invasive pneumococcal pneumonia caused by the serotype 1 strain while all mice in the control group died of infection within 5 days. Flow cytometry analysis showed that higher numbers of PMN are recruited into the airways of protected animals after sublingual treatment with flagellin suggesting that these cells might be involved in the mechanism of protection induced by sublingual immunotherapy. 
This video shows in detail how to perform sublingual immunotherapy and also how to recover relevant tissue from the sublingual mucosa, draining lymph nodes as well as lungs and airways to perform further analysis. Additionally, it illustrates the general technique of cell preparation for FACS analysis and briefly shows how to prepare Streptococcus pneumoniae suspensions and how to perform intranasal infections in mouse to set up the acute infection model.

<table border="0" cellpadding="0" cellspacing="0" width="992">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Name of Material/ Equipment</td>
			<td style="width:212px;">Company</td>
			<td style="width:141px;">Catalog Number</td>
			<td style="width:245px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Ketamine solution (50 mg/ml)</td>
			<td style="width:212px;">Pharma Service, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Xilacine solution (2 %)</td>
			<td style="width:212px;">Portinco S.A., Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Sterile 1ml syringe</td>
			<td style="width:212px;">Modern, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Sterile 27G needle</td>
			<td style="width:212px;">Modern, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">RPMI 1640</td>
			<td style="width:212px;">General Electric Health Care</td>
			<td style="width:141px;">E15885</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Fetal Bovine Serum</td>
			<td style="width:212px;">ATCC</td>
			<td style="width:141px;">302020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Penicillin/Streptimycin Solution</td>
			<td style="width:212px;">SIGMA</td>
			<td style="width:141px;">P4333</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:395px;">Sterile PBS without Ca2+/Mg2+</td>
			<td style="width:212px;">PAA</td>
			<td style="width:141px;">H21002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Type-I Collagenase</td>
			<td>Life Technologies/Gibco</td>
			<td style="width:141px;">17100017</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Deoxyribonuclease I (DNAse-I)</td>
			<td>SIGMA</td>
			<td style="width:141px;">D4513</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Dispase</td>
			<td>Life Technologies/Gibco</td>
			<td>17105041</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">PerCP-Cy5.5 conjugated rat anti mouse IgG2b anti CD11b</td>
			<td style="width:212px;">BD</td>
			<td style="width:141px;">550993</td>
			<td style="width:245px;">Clone M1/70</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">APC conjugated hamster anti mouse IgG1 anti CD11c</td>
			<td style="width:212px;">BD</td>
			<td style="width:141px;">550261</td>
			<td style="width:245px;">Clone HL3&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">APC-Cy7 conjugated rat anti mouse IgG2a anti Ly6G</td>
			<td style="width:212px;">BD</td>
			<td style="width:141px;">560600</td>
			<td style="width:245px;">Clone 1A8</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:395px;">Sterile Saline Solution</td>
			<td style="width:212px;">Laboratorio Farmaco Uruguayo, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td style="width:245px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Tryptic Soy Agar</td>
			<td style="width:212px;">BD Difco, France</td>
			<td style="width:141px;">236950</td>
			<td style="width:245px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Defibrinated Sheep Blood</td>
			<td style="width:212px;">Biokey, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Sterile Petri Dishes</td>
			<td style="width:212px;">Greiner</td>
			<td style="width:141px;">633180</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">p10 Pipette</td>
			<td style="width:212px;">Gilson</td>
			<td style="width:141px;">F144802</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">P20 Pipette</td>
			<td>Eppendorf</td>
			<td style="width:141px;">3120000097</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p200 Pipette</td>
			<td style="width:212px;">Gilson</td>
			<td style="width:141px;">F123601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p200 Pipette</td>
			<td style="width:212px;">Capp</td>
			<td style="width:141px;">C200</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p200 Pipette</td>
			<td>Eppendorf</td>
			<td style="width:141px;">3120000054</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p1000 Pipette</td>
			<td>Eppendorf</td>
			<td style="width:141px;">3120000062</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Filter Tips P10</td>
			<td>Greiner</td>
			<td>771288</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Filter Tips P200</td>
			<td>Greiner</td>
			<td>739288</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Filter Tips P1000</td>
			<td>Greiner</td>
			<td>750288</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vortex</td>
			<td>BIOSAN</td>
			<td>V1-plus</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stainless steel fine tip forceps&#160;</td>
			<td>SIGMA</td>
			<td>Z168785/Z168777</td>
			<td>curved and straight</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dressing tissue forceps</td>
			<td>SIGMA</td>
			<td>F4392</td>
			<td>length 8 inches</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-dissecting forceps</td>
			<td>SIGMA</td>
			<td>F4017</td>
			<td>straight&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-dissecting forceps</td>
			<td>SIGMA</td>
			<td>F4142&#160;</td>
			<td>Curved</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mayo Scissors</td>
			<td>SIGMA</td>
			<td>Z265993&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Scalpel</td>
			<td>SAKIRA MEDICAL</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Biopsy Punch &#216; 3mm</td>
			<td>Stiefel Laboratories Ltd.</td>
			<td>2079D</td>
			<td>5mm diameter can also be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 1.5ml Tubes</td>
			<td>Deltalab</td>
			<td>200400P</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 15ml Tubes</td>
			<td>Greiner</td>
			<td>188271</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 50ml Tubes</td>
			<td>Greiner</td>
			<td>227261</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile serological pipettes 5 ml</td>
			<td>Greiner</td>
			<td>606160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile serological pipettes 10 ml</td>
			<td>Greiner</td>
			<td>607160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile serological pipettes 25 ml</td>
			<td>Greiner</td>
			<td>760180</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biological safety cabinet, class II</td>
			<td>Thermo Scientific</td>
			<td>1300 series, type A2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-Isolator&#160;Rack</td>
			<td>RAIR&#160;IsoSystem&#160;</td>
			<td>76144W</td>
			<td>Super&#160;Mouse&#160;1800 AllerZone&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Refrigerated Microcentfifuge</td>
			<td>Eppendorf</td>
			<td>Legend Micro 21R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Microcentfifuge</td>
			<td>Heraeus</td>
			<td>Biofuge-pico</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge</td>
			<td>Thermo Scientific</td>
			<td>Sorval ST40R</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CO2 Incubator&#160;</td>
			<td>Thermo Scientific</td>
			<td>Model&#160; 3111</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Thin-tip pasteur pipettes</td>
			<td>Deltalab</td>
			<td>D210022</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile pasteur pipettes</td>
			<td>Deltalab</td>
			<td>200007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 24-well plate</td>
			<td>Greiner</td>
			<td>662160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypan Blue Solution&#160;</td>
			<td>Life Technologies</td>
			<td>T10282</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Automatic Cell Counter - Cuntess</td>
			<td>Life Technologies</td>
			<td>C10227&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Countess Cell Counting Chamber Slides</td>
			<td>Life Technologies</td>
			<td>C10312</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flow Cytometry Tubes</td>
			<td>BD</td>
			<td>343675</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flow Cytometer - FACS Canto-II</td>
			<td>BD</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real Time PCR Instrument - Rotor Gene Q or ABI 7900</td>
			<td>Qiagen / Applied Biosystems</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trizol Reagent</td>
			<td>Life Technologies</td>
			<td>15596-026</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAse-I</td>
			<td>Life Technologies</td>
			<td>18068-015</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAse-I Buffer 10X</td>
			<td>Life Technologies</td>
			<td>18068015</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EDTA 25 mM</td>
			<td>Life Technologies</td>
			<td>18068015</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultra-Pure Water</td>
			<td>Life Technologies</td>
			<td>10977</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNAse Out</td>
			<td>Life Technologies</td>
			<td>100000840</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rndom Hexamer Primers</td>
			<td>Life Technologies</td>
			<td>N8080127</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">M-MLV-RT buffer</td>
			<td>Life Technologies</td>
			<td>18057-018</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">M-MLV-RT enzime</td>
			<td>Life Technologies</td>
			<td>28025-021</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantiTect Syber Green PCR Kit</td>
			<td>Qiagen</td>
			<td>204143</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Specific primers&#160;</td>
			<td>Life Technologies</td>
			<td style="width:141px;">N/A</td>
			<td>Molecular Biology Grade</td>
		</tr>
	</tbody>
</table>

sublingual immunotherapy as an alternative to induce protection against acute respiratory infections

Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been shown to effectively induce humoral and cellular responses at systemic and mucosal sites, namely the lungs and urogenital tract. Sublingual vaccination can promote protection against infections at the lower and upper respiratory tract; it can also promote tolerance to allergens and ameliorate asthma symptoms. Modulation of lung&#8217;s immune response by sublingual immunotherapy (SLIT) is safer than direct administration of formulations by intranasal route because it does not require delivery of potentially harmful molecules directly into the airways. In contrast to intranasal delivery, side effects involving brain toxicity or facial paralysis are not promoted by SLIT. The immune mechanisms underlying SLIT remain elusive and its use for the treatment of acute lung infections has not yet been explored. Thus, development of appropriate animal models of SLIT is needed to further explore its potential advantages. 
This work shows how to perform sublingual administration of therapeutic agents in mice to evaluate their ability to protect against acute pneumococcal pneumonia. Technical aspects of mouse handling during sublingual inoculation, precise identification of sublingual mucosa, draining lymph nodes and isolation of tissues, bronchoalveolar lavage and lungs are illustrated. Protocols for single cell suspension preparation for FACS analysis are described in detail. Other downstream applications for the analysis of the immune response are discussed. Technical aspects of the preparation of Streptococcus pneumoniae inoculum and intranasal challenge of mice are also explained.
SLIT is a simple technique that allows screening of candidate molecules to modulate lungs&#8217; immune response. Parameters affecting the success of SLIT are related to molecular size, susceptibility to degradation and stability of highly concentrated formulations.

Sublingual immunotherapy सफलतापूर्वक फेफड़ों &#39;प्रतिरक्षा प्रतिक्रिया मिलाना करने के लिए इस्तेमाल किया जा सकता है. हम flagellin, TLR5 और NLRC4 एगोनिस्ट की एक खुराक, chemokines CXCL1, CCL20 और खारा इलाज नियंत्रण की तुलना साइटोकाइन आईएल -6 एन्कोडिंग mRNA की महत्वपूर्ण upregulation पैदा कर सकते हैं कि पता चला है. MRNA स्तर की प्रेरण भट्ठा के बाद 8 घंटे पर नुकीला गुना और 20 घंटा (चित्रा 1) के बाद बेसल स्तर पर लौटने. भट्ठा एस. निमोनिया के साथ 2 घंटे पूर्व intranasal संक्रमण प्रदर्शन किया गया था हालांकि, जब Cxcl1 और Il6 mRNA के स्तर में काफी गैर इलाज जानवरों (चित्रा 2) की तुलना में भट्ठा के बाद भी 24 घंटे upregulated रहे. FACS द्वारा बाल में सेल आबादी और फेफड़े के ऊतकों का विश्लेषण मांसल मार्ग से Flic साथ इलाज जानवरों फेफड़ों &#39;ऊतक (चित्रा 3) में वायुमार्ग में neutrophils की संख्या में वृद्धि हुई है, लेकिन नहीं था कि पता चला. चित्रा 4 में दिखाया गया है, flagellin साथ भट्ठा संरक्षण को बढ़ावा दिया और तीव्र न्यूमोकोकल निमोनिया के खिलाफ अस्तित्व में वृद्धि हुई. <img alt="चित्रा 1" fo:content-width="6.7in" src="/files/ftp_upload/52036/52036fig1highresV2.jpg" width="680" /> Flagellin साथ sublingual immunotherapy के बाद चित्रा फेफड़ों &#39;ट्रांसक्रिप्शनल प्रोफाइल की 1 काइनेटिक्स. आठ से 10 सप्ताह पुरानी BALB / ग चूहों (n = 4) संज्ञाहरण के तहत मांसल मार्ग द्वारा flagellin या खारा के 10 माइक्रोग्राम के साथ इलाज किया गया. फेफड़ों अलग समय बिंदुओं पर एकत्र और न्यूक्लिक एसिड परिरक्षक में रखा गया था. कुल शाही सेना निष्कर्षण प्रदर्शन किया था और सीडीएनए संश्लेषित किया गया था. mRNA स्तर Tabl में सूचीबद्ध विशिष्ट प्राइमरों का उपयोग वास्तविक समय पीसीआर द्वारा मूल्यांकन किया गयाई 1 सापेक्ष मात्रा का ठहराव सामान्य बनाने के लिए Actb mRNA स्तर का उपयोग ΔCt विधि अनुसार किया गया था. परिणाम ± SEM के मंझला के रूप में खारा इलाज समूह की तुलना में गुना वृद्धि के रूप में दिखाया जाता है. तारक मान व्हिटनी परीक्षण के अनुसार गणना सांख्यिकीय महत्वपूर्ण मतभेद (पी &lt;0.05) से संकेत मिलता है. परिणाम 2 स्वतंत्र प्रयोगों के प्रतिनिधि हैं. <img alt="चित्रा 2" fo:content-width="6.2in" src="/files/ftp_upload/52036/52036fig2highresV2.jpg" width="660" /> साथ flagellin. आठ से 10 सप्ताह पुरानी BALB / ग चूहों (एन = 4 नियंत्रण समूह के लिए और एन = 7 इलाज समूह के लिए) sublingual immunotherapy के बाद न्यूमोकोकल निमोनिया के दौरान चित्रा 2 &#39;फेफड़ों ट्रांसक्रिप्शनल प्रोफ़ाइल से flagellin या खारा के 10 माइक्रोग्राम के साथ इलाज किया गया संज्ञाहरण के तहत मांसल मार्ग. 2 घंटे बाद चूहों 10 के कारण कम से कम घातक खुराक (एमएलडी) के साथ intranasal मार्ग द्वारा चुनौती दी थीएस के नैदानिक ​​अलग से 0% मृत्यु 4x10 5 CFU / 50 μl के लिए इसी निमोनिया सीरोटाइप 1 E1585,. फेफड़े चुनौती के बाद 24 घंटा एकत्र की है और शाही सेना निष्कर्षण और सीडीएनए संश्लेषण से बाहर किया गया जब तक न्यूक्लिक एसिड परिरक्षक में जमा थे. वास्तविक समय पीसीआर बाहर किया गया था (1 टेबल में प्राइमर सूची देखें) और रिश्तेदार मात्रा का ठहराव सामान्य बनाने के लिए Actb mRNA स्तर का उपयोग ΔCt विधि अनुसार किया गया था. परिणाम ± SEM के मंझला के रूप में खारा इलाज समूह की तुलना में गुना वृद्धि के रूप में दिखाया जाता है. तारक मान व्हिटनी परीक्षण के अनुसार गणना सांख्यिकीय महत्वपूर्ण मतभेद (पी &lt;0.05) से संकेत मिलता है. <img alt="चित्रा 3" fo:content-width="6.5in" src="/files/ftp_upload/52036/52036fig3highresV2.jpg" width="680" /> Polymorphonuclear न्युट्रोफिल की चित्रा 3 विश्लेषण (PMN) भट्ठा के बाद फेफड़ों &#39;ऊतक और वायुमार्ग में भर्ती. आठ को10 सप्ताह पुरानी BALB / ग चूहों (n = 4) संज्ञाहरण के तहत मांसल मार्ग द्वारा flagellin या खारा के 10 माइक्रोग्राम के साथ इलाज किया गया. 2 घंटे बाद चूहों एस के एमएलडी साथ intranasal मार्ग द्वारा चुनौती दी थी निमोनिया सीरोटाइप 1 E1585. चुनौती के बाद 24 घंटा, बाल प्रदर्शन किया था और फेफड़ों FACS विश्लेषण के लिए प्रोसेस किया गया. PMN Ly6G उच्च / CD11b उच्च / CD11c नकारात्मक कोशिकाओं के रूप में पहचान की है और FCS-एसएससी प्रोफाइल पर आधारित थे. परिणाम बाल या फेफड़ों में कुल सेल नंबर के सम्मान के साथ PMN के प्रतिशत के रूप में व्यक्त कर रहे हैं. बार्स ± SEM के बीच का प्रतिनिधित्व करते हैं. तारों के एक तरह से मान व्हिटनी परीक्षण के अनुसार गणना सांख्यिकीय महत्वपूर्ण मतभेद (पी &lt;0.05) से संकेत मिलता है. <img alt="चित्रा 4" fo:content-width="5.3in" src="/files/ftp_upload/52036/52036fig4highresV2.jpg" width="530" /> Flagellin साथ चित्रा 4 भट्ठा तीव्र न्यूमोकोकल निमोनिया के खिलाफ चूहों की रक्षा करता है. </strong&gt; आठ से 10 सप्ताह पुरानी BALB / ग चूहों (एन = 8) संज्ञाहरण के तहत मांसल मार्ग द्वारा flagellin या खारा के 10 माइक्रोग्राम के साथ इलाज किया गया. 2 घंटे बाद चूहों एस के एमएलडी साथ intranasal मार्ग द्वारा चुनौती दी थी निमोनिया सीरोटाइप 1 E1585. जीवन रक्षा के लिए एक दैनिक आधार पर मूल्यांकन किया गया था. कापलान-Meier घटता प्रवेश रैंक (मेंटल-कॉक्स) परीक्षण अनुसार तुलना में थे. तारों सांख्यिकीय महत्वपूर्ण मतभेद (पी &lt;0.05) .Results 2 स्वतंत्र प्रयोगों के प्रतिनिधि हैं संकेत मिलता है. <table align="center" border="1" cellpadding="0" cellspacing="0"><tbody align="center"><tr><td> नाम </td><td> अनुक्रम 5&#39;-3 &#39; </td><td> पीसीआर उत्पाद लंबाई (बीपी) </td></tr><tr><td> MB-actin_F </td><td> GCTTCTTTGCAGCTCCTTCGT </td><td rowspan="2"> 68 </td></tr><tr><td> MB-actin_R </td><td> CGTCATCCATGGCGAACTG </td></tr><tr><td>mCCL20_F </td><td> TTTTGGGATGGAATTGGACAC </td><td rowspan="2"> 69 </td></tr><tr><td> mCCL20_R </td><td> TGCAGGTGAAGCCTTCAACC </td></tr><tr><td> mCXCL1_F </td><td> CTTGGTTCAGAAAATTGTCCAAAA </td><td rowspan="2"> 84 </td></tr><tr><td> mCXCL1_R </td><td> ACGGTGCCATCAGAGCAGTCT </td></tr><tr><td> लाख 6_F </td><td> GTTCTCTGGGAAATCGTGGAAA </td><td rowspan="2"> 78 </td></tr><tr><td> लाख 6_R </td><td> AAGTGCATCATCGTTGTTCATACA </td></tr><tr><td> mTNFalpha_F </td><td> CATCTTCTCAAAATTCGAGTGACAA </td><td rowspan="2"> 63 </td></tr><tr><td> mTNFalpha_R </td><td> CCTCCACTTGGTGGTTTGCT </td></tr><tr><td> mCxcl2_F </td><td> CCCTCAACGGAAGAACCAAA </td><td rowspan="2"> 72 </td></tr><tr><td> mCxcl2_R </td><td> CACATCAGGTACGATCCAGGC </td></tr></tbody></table> वास्तविक समय पीसीआर विश्लेषण के लिए इस्तेमाल तालिका 1 प्राइमर सूची. QPCR विश्लेषण के लिए इस्तेमाल विशिष्ट प्राइमर दृश्यों. फॉरवर्ड और माउस actb के लिए प्राइमरों, रिवर्स Cccl20, Cxcl1, Il6, Tnfa और Cxcl1 5&#39;-3 &#39;दृश्यों के रूप में प्रस्तुत कर रहे हैं और उम्मीद है और उत्पाद की लंबाई आधार जोड़े (बीपी) में संकेत दिया है.

Watch this Scientific Journal Video about Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections at JoVE.com

Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections

The present work illustrates the convenience of using sublingual immunotherapy to boost the innate immune response in the lungs and confer protection against acute pneumococcal pneumonia in mouse.

एक विकल्प के रूप में sublingual Immunotherapy तीव्र श्वसन संक्रमण के खिलाफ संरक्षण प्रेरित करने के लिए

Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been ...

Research

JoVE Journal

Medicine

Pseudofracture: An Acute Peripheral Tissue Trauma Model

Pseudofracture: एक तीव्र परिधीय ऊतक ट्रामा मॉडल

Following trauma there is an early hyper-reactive inflammatory response that can lead to multiple organ dysfunction and high mortality in trauma patients; ...

Pressure Controlled Ventilation to Induce Acute Lung Injury in Mice

दबाव नियंत्रित चूहे में गंभीर फेफड़ों की चोट प्रेरित वेंटिलेशन

Murine models are extensively used to investigate acute injuries of different organs systems (1-34). Acute lung injury (ALI), which occurs with prolonged ...

Bilateral Common Carotid Artery Occlusion as an Adequate Preconditioning Stimulus to Induce Early Ischemic Tolerance to Focal Cerebral Ischemia

फोकल मस्तिष्क ischemia के लिए प्रारंभिक इस्केमिक सहिष्णुता पैदा करने के लिए एक पर्याप्त शर्त प्रोत्साहन के रूप में द्विपक्षीय आम मन्या धमनी आड़

There is accumulating evidence, that ischemic preconditioning - a non-damaging ischemic challenge to the brain - confers a transient protection to a ...

Pharmacologic Induction of Epidermal Melanin and Protection Against Sunburn in a Humanized Mouse Model

एक humanized माउस मॉडल में एपिडर्मल मेलेनिन और संरक्षण के खिलाफ सनबर्न की pharmacologic प्रेरण

Fairness of skin, UV sensitivity and skin cancer  risk all correlate with the physiologic function of the melanocortin 1  receptor, a Gs-coupled signaling ...

Lavage-induced Surfactant Depletion in Pigs As a Model of the Acute Respiratory Distress Syndrome (ARDS)

Lavage-induced Surfactant Depletion in Pigs As a Model of the Acute Respiratory Distress Syndrome ARDS

सूअर एक्यूट रेस्पिरेटरी डिस्ट्रेस सिंड्रोम की एक मॉडल के रूप में पानी से धोना प्रेरित Surfactant कमी (ARDS)

Various animal models of lung injury exist to study the complex pathomechanisms of human acute respiratory distress syndrome (ARDS) and evaluate future ...

Oleic Acid-Injection in Pigs As a Model for Acute Respiratory Distress Syndrome

ओलिक एसिड-तीव्र श्वसन संकट सिंड्रोम के लिए एक मॉडल के रूप में सूअरों में इंजेक्शन

The acute respiratory distress syndrome is a relevant intensive care disease with an incidence ranging between 2.2% and 19% of intensive care unit ...

Subclavian Vein Puncture As an Alternative Method of Blood Sample Collection in Rats

चूहों में रक्त नमूना संग्रह की एक वैकल्पिक विधि के रूप में अवजत्रुकी नस पंचर

Blood collection with enough blood volume is essential in animal experiments. Blood collection from the tail vein of rats is popular and less stressful ...

Implantation of an Isoproterenol Mini-Pump to Induce Heart Failure in Mice

चूहे में दिल की विफलता को प्रेरित करने के लिए एक Isoproterenol मिनी पंप का प्रत्यारोपण

Isoproterenol (ISO), is a non-selective beta-adrenergic agonist, that is used widely to induce cardiac injury in mice. While the acute model mimics ...

The Rigid Tube as an Alternative in Controlling the Problematic Airway

समस्याग्रस्त वायुमार्ग को नियंत्रित करने में एक विकल्प के रूप में कठोर ट्यूब

The unexpected problematic airway represents a large proportion of anesthesia-related morbidity and mortality. The retromolar or paraglossal approach is ...

Halogenated Agent Delivery in Porcine Model of Acute Respiratory Distress Syndrome via an Intensive Care Unit Type Device

एक गहन देखभाल इकाई प्रकार डिवाइस के माध्यम से तीव्र श्वसन संकट सिंड्रोम के पोर्सीन मॉडल में हैलोजेनेटेड एजेंट डिलिवरी

Acute respiratory distress syndrome (ARDS) is a common cause of hypoxemic respiratory failure and death in critically ill patients, and there is an urgent ...