Name: sublingual immunotherapy as an alternative to induce protection against acute respiratory infections
Uploaded: 2014-08-30T14:00:00
Duration: 16 min 56 s
Description: Watch this Scientific Journal Video about Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections at JoVE.com

We acknowledge Dr. Jean-Claude Sirard from the Center for Infection and Immunity of Lille, Institute Pasteur de Lille-France, for kindly providing the purified flagellin and Dr. Teresa Camou, Director of the National Reference Laboratory, Ministry of Health of Uruguay for kindly providing the pneumococcal strain. 
The authors would like to express their acknowledgement to Mr. Diego Acosta and Mr. Ignacio Turel form BichoFeo Producciones-Uruguay for their commitment and hard work during the entire video production and edition. 
This work was supported by the grants PR_FCE_2009_1_2783 and BE_POS_2010_1_2544 from the National Agency of Research and Innovation, ANII from Uruguay, the Program for Development of Basic Sciences, PEDECIBA of Uruguay and Sectoral Commission of Scientific research, CSIC-Universidad de la Rep&#250;blica, Uruguay.

<ol>
	<li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+vaccines+WHO+position+paper--2012.">Pneumococcal vaccines WHO position paper--2012.</a> Weekly Epidemiological Record. 14, 129-144 (2012).</li><li>Appelbaum, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carriage+of+antibiotic-resistant+Streptococcus+pneumoniae+by+children+in+eastern+and+central+Europe-a+multicenter+study+with+use+of+standardized+methods.">Carriage of antibiotic-resistant Streptococcus pneumoniae by children in eastern and central Europe-a multicenter study with use of standardized methods.</a> Clin Infect Dis. 23, 712-717 (1996).</li><li>Ramirez, J. A., Anzueto, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+needs+of+community-acquired+pneumonia.">Changing needs of community-acquired pneumonia.</a> J Antimicrob Chemother. 66, 3-9 (2011).</li><li>Cuburu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+immunization+induces+broad-based+systemic+and+mucosal+immune+responses+in+mice.">Sublingual immunization induces broad-based systemic and mucosal immune responses in mice.</a> Vaccine. 25, 8598-8610 (2007).</li><li>Pedersen, G. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+sublingual+route+for+administration+of+influenza+H5N1+virosomes+in+combination+with+the+bacterial+second+messenger+c-di-GMP.">Evaluation of the sublingual route for administration of influenza H5N1 virosomes in combination with the bacterial second messenger c-di-GMP.</a> PLoS One. 25, 1-12 (2011).</li><li>Song, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+vaccination+with+influenza+virus+protects+mice+against+lethal+viral+infection.">Sublingual vaccination with influenza virus protects mice against lethal viral infection.</a> Proc Natl Acad Sci USA. 105, 1644-1649 (2008).</li><li>Cogo, R., Ramponi, A., Scivoletto, G., Rippoli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prophylaxis+for+acute+exacerbations+of+chronic+bronchitis+using+an+antibacterial+sublingual+vaccine+obtained+through+mechanical+lysis:+a+clinical+and+pharmacoeconomic+study.">Prophylaxis for acute exacerbations of chronic bronchitis using an antibacterial sublingual vaccine obtained through mechanical lysis: a clinical and pharmacoeconomic study.</a> Acta Biomed. 74, 76-87 (2003).</li><li>Rosaschino, F., Cattaneo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimizing+compliance+of+paediatric+patients+for+seasonal+antibacterial+vaccination+with+sublingually+administered+Polyvalent+Mechanical+Bacterial+Lysates+(PMBL).">Strategies for optimizing compliance of paediatric patients for seasonal antibacterial vaccination with sublingually administered Polyvalent Mechanical Bacterial Lysates (PMBL).</a> Acta Biomed. 75, 171-178 (2004).</li><li>Senna, G., Caminati, M., Canonica, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Safety+and+tolerability+of+sublingual+immunotherapy+in+clinical+trials+and+real+life.">Safety and tolerability of sublingual immunotherapy in clinical trials and real life.</a> Curr Opin Allergy Clin Immunol. 13, 656-662 (2013).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+dendritic+cells+mediate+antigen-specific+tolerance+by+stimulating+TH1+and+regulatory+CD4++T+cells.">Oral dendritic cells mediate antigen-specific tolerance by stimulating TH1 and regulatory CD4+ T cells.</a> J Allergy Clin Immunol. 122, 603-609 (2008).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+the+lingual+immune+system+reveals+the+presence+of+both+regulatory+and+effector+CD4++T+cells.">Mapping of the lingual immune system reveals the presence of both regulatory and effector CD4+ T cells.</a> Clin Exp Allergy. 39, 1910-1919 (2009).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+macrophage-like+cells+play+a+key+role+in+tolerance+induction+following+sublingual+immunotherapy+of+asthmatic+mice.">Oral macrophage-like cells play a key role in tolerance induction following sublingual immunotherapy of asthmatic mice.</a> Mucosal Immunology. 4, 638-647 (2011).</li><li>Hervouet, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen-bearing+dendritic+cells+from+the+sublingual+mucosa+recirculate+to+distant+systemic+lymphoid+organs+to+prime+mucosal+CD8+T+cells.">Antigen-bearing dendritic cells from the sublingual mucosa recirculate to distant systemic lymphoid organs to prime mucosal CD8 T cells.</a> Mucosal Immunology. 7, 280-291 (2014).</li><li>Munoz, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+administration+of+flagellin+protects+mice+from+Streptococcus+pneumoniae+lung+infection.">Mucosal administration of flagellin protects mice from Streptococcus pneumoniae lung infection.</a> Infect Immun. 78, 4226-4233 (2010).</li><li>Hayashi, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+innate+immune+response+to+bacterial+flagellin+is+mediated+by+Toll-like+receptor+5.">The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5.</a> Nature. 410, 1099-1103 (2001).</li><li>Lightfield, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+function+for+Naip5+in+inflammasome+activation+by+a+conserved+carboxy-terminal+domain+of+flagellin.">Critical function for Naip5 in inflammasome activation by a conserved carboxy-terminal domain of flagellin.</a> Nature Immunology. 9, 1171-1178 (2008).</li><li>Lightfield, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+requirements+for+NAIP5+in+activation+of+the+NLRC4+inflammasome.">Differential requirements for NAIP5 in activation of the NLRC4 inflammasome.</a> Infect Immun. 79, 1606-1614 (2011).</li><li>Honko, A. N., Mizel, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+administration+of+flagellin+induces+innate+immunity+in+the+mouse+lung.">Mucosal administration of flagellin induces innate immunity in the mouse lung.</a> Infect Immun. 72, 6676-6679 (2004).</li><li>Janot, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radioresistant+cells+expressing+TLR5+control+the+respiratory+epithelium's+innate+immune+responses+to+flagellin.">Radioresistant cells expressing TLR5 control the respiratory epithelium's innate immune responses to flagellin.</a> Eur J Immunol. 39 (6), 1587-1596 (2009).</li><li>Van Maele, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TLR5+signaling+stimulates+the+innate+production+of+IL-17+and+IL-22+by+CD3(neg)CD127++immune+cells+in+spleen+and+mucosa.">TLR5 signaling stimulates the innate production of IL-17 and IL-22 by CD3(neg)CD127+ immune cells in spleen and mucosa.</a> J Immunol. 185, 1177-1185 (2010).</li><li>Lee, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurologic+adverse+events+following+influenza+A+(H1N1)+vaccinations+in+children.">Neurologic adverse events following influenza A (H1N1) vaccinations in children.</a> Pediatrics international: official journal of the Japan Pediatric Society. 54, 325-330 (2012).</li><li>Lewis, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+facial+nerve+paralysis+(Bell's+palsy)+following+intranasal+delivery+of+a+genetically+detoxified+mutant+of+Escherichia+coli+heat+labile+toxin.">Transient facial nerve paralysis (Bell's palsy) following intranasal delivery of a genetically detoxified mutant of Escherichia coli heat labile toxin.</a> PLoS One. 4, e6999 (2009).</li><li>Mutsch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+the+inactivated+intranasal+influenza+vaccine+and+the+risk+of+Bell's+palsy+in+Switzerland.">Use of the inactivated intranasal influenza vaccine and the risk of Bell's palsy in Switzerland.</a> N Engl J Med. 350, 896-903 (2004).</li><li>Kuo, C. H., Wang, W. L., Chu, Y. T., Lee, M. S., Hung, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+immunotherapy+in+children:+an+updated+review.">Sublingual immunotherapy in children: an updated review.</a> Pediatr Neonatol. 50, 44-49 (2009).</li><li>Nempont, C., Cavet, D., Rumbo, M., Bompard, C., Villeret, V., Sirard, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deletion+of+flagellin's+hypervariable+region+abrogates+antibody-mediated+neutralization+and+systemic+activation+of+TLR5-dependent+immunity.">Deletion of flagellin's hypervariable region abrogates antibody-mediated neutralization and systemic activation of TLR5-dependent immunity.</a> J. Immunol. 181, 2036-2043 (2008).</li><li>Marques, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+Streptococcus+pneumoniae+serotype+1+acute+infection+shows+a+signature+of+Th17-+and+IFN-gamma-mediated+immunity.">Protection against Streptococcus pneumoniae serotype 1 acute infection shows a signature of Th17- and IFN-gamma-mediated immunity.</a> Immunobiology. 217, 420-429 (2012).</li><li>Stewart, C. C., Stewart, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Titering+antibodies.">Titering antibodies.</a> Current Protocols in Cytometry. 4, Unit 4.1 (2001).</li><li>Kubista, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+real-time+polymerase+chain+reaction.">The real-time polymerase chain reaction.</a> Molecular Aspects of Medicine. 27, 95-125 (2006).</li><li>Pedersen, G., Cox, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mucosal+vaccine+quandary:+intranasal+vs.+sublingual+immunization+against+influenza.">The mucosal vaccine quandary: intranasal vs. sublingual immunization against influenza.</a> Human Vaccines &amp; Immunotherapeutics. 8, 689-693 (2012).</li><li>Vitaliti, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+immunity+and+sublingual+immunotherapy+in+respiratory+disorders.">Mucosal immunity and sublingual immunotherapy in respiratory disorders.</a> Journal of Biological Regulators and Homeostatic Agents. 26, S85-S93 (2012).</li></ol>

The authors have nothing to disclose.

치료제의 설하 투여는 호흡 기관의 면역 반응을 조절하는 유용한 수단으로 입증되었습니다. 호흡 상태의 치료를위한 SLIT의 주요 장점은 비강 내 투여 (31)에 기초하여 치료보다 안전한 것으로, 폐 또는 콧 구멍으로 화합물의 직접 전달을 포함하지 않는다는 것이다. 설하 면역 요법이 어느 알러지 염증 및 천식 (32)의 증상을 개선하거나, 여기에 도시 된 바와 같이, 급성 폐 감염을 치료하기 위해 선천성 면역 메카니즘의 일시적 활성화를 유도하는 규제 반응의 유도를 위해, 다른 방법으로 면역 반응을 조절하는데 사용될 수있다. 이 비디오에 제시된 마우스 모델은 SLIT 치료제와 같은 다른 화합물의 스크리닝을위한 편리한 방법입니다. 이러한 동물 모델은 영향을 결정하는 유용한 수단을 구비폐 &#39;면역 반응뿐만 아니라 다른 장기 (예., 림프절 또는 원위 점막 사이트 배수) 시험 관내 모델을 사용하여 모방 할 수있는 슬릿. 설하 면역 요법을 사용하여 얻은 결과를 설명하는 여러 논문이 있지만, 설하 투여 절차에 대한 자세한 방법은 아직 제공되지 않았습니다. 또한, 모델은 호흡기 조직에서뿐만 아니라 지역 보호를 부여하는 것을 목표 설하 백신의 평가를 위해 사용될 수있다. 첨부 된 영상에 도시 된 바와 같이, 화합물의 투여는 설하 쉽게 광범위한 훈련의 필요없이 수행 될 수있는 간단한 과정이다. 일반적으로 동물 처리에 능숙 사람은이 프로토콜의 설명에 따라 주 사용 마취제를 사용하여 10 쥐의 그룹에 슬릿을 수행하는 데 1 시간이 필요합니다. 폐렴 구균은 도전뿐만 수행되면, 추가로 90 분을 준비해야한다박테리아 서스펜션과 동물의 비강 도전을 수행합니다. 여기에 제시된 FACS 프로토콜은 폐 &#39;세포 역학 림프절뿐만 아니라 효과를 배출, 관리의 로컬 사이트에서 SLIT의 영향을 편리하게 특성화 할 수 있습니다. 기관지 내용과 폐 실질의 별도의 분석은기도 면역 거주자 및 조직 내에서 남아있는 것과 종류의 세포 침투를 구별하는 것이 중요합니다. BAL 내용의 분석은 폐포 대 식세포 매출의 연구뿐만 아니라 다른 치료에 의해 ​​유도 된 폐포 공간, 예를 들면., 백혈구, 호산구, 단핵구 세포에 모집의 역학을 할 수 있습니다. BAL은 효소 면역 분석법 (ELISA) 또는 설하 백신 후 유도 분비되는 IgA 항체의 검출에 의해 분비되는 사이토 카인 및 케모카인의 존재를 평가하는데 사용될 수있다. 폐 &#39;조직의 연구다른 세포 유형, 고전 수상 세포, T 세포 및 B 세포의 특성화를 허용 할 것이다. FACS 분석을위한 BAL 샘플 및 림프절의 준비는 간단합니다. 시료 채취 후, 일반적으로 60 분 ~ 20 샘플 염색 프로토콜을 완료하는 데 필요합니다. 세포 외 기질의 분해가 요구되기 때문에 반대로, 설하 또는 폐 조직으로부터 세포의 분리는 더 많은 시간을 필요로 할 것이다. 설하 경로에 의해 전달되는 치료제의 흡수는 생체 내 이미징 시스템에서 사용하는 형광 또는 방사성 표지 된 분자의 추적에 의해 해결 될 수있다. 설하 면역 효과적으로 면역 호흡기 반응뿐만 아니라 치료 또는 호흡 상태를 방지하기 위해 사용될 수있다 전신적을 유도하는 매력적인 방법이다. SLIT 나는 후 호흡기에서 면역 반응의 활성화를 허용 대 결정 메카니즘의 해명다른 조건으로부터 호흡 가능한 치료법으로 단독으로 또는 조합하여 사용될 수있는 새로운 치료 전략의 합리적인 설계를 허용하는 결정적이야.

The overall goal of this work is to illustrate the benefits of sublingual immunotherapy for the treatment of acute respiratory infections (ARI) and present the advantages of this delivery route compared to other routes of administration, namely intranasal.
ARI cause millions of deaths every year especially in children under five. Streptococcus pneumoniae remains as one of the major etiological agents of bacterial pneumonia in infants and the elderly1,2. To present, the main available treatment relies on the use of antibiotics but resistant strains are continuously arising3,4.
SLIT induces broad responses at systemic and also mucosal level, particularly at the respiratory tract5. It has proven effectiveness against influenza infection, promoting long term protection with production of humoral and cellular responses6,7. Besides, it has been shown that prophylactic treatment with bacterial lysates delivered by sublingual route reduced exacerbations of chronic obstructive bronchitis in the elderly8 and prevented recurrent respiratory infections in children9. SLIT has been widely used for the treatment of allergies and asthma. Clinical studies had not only demonstrated its efficacy to modulate the immune response in the respiratory tract but also its safety10. Despite the growing interest of pharmaceutical companies and researchers in SLIT, the mechanisms involved in the induction of mucosal immune responses after sublingual delivery of compounds remain obscure. Recently, attention has been focused on the mechanisms promoting tolerance associated with allergen desensitization. It has been proposed that resident and recruited cells at the sublingual mucosa, like dendritic cells and macrophages, can promote tolerance after SLIT11-13. Dendritic cells of the oral mucosa can promote IFN-gamma and IL-10 producing T helper cells11 as well as recirculate to the distal genital mucosa and promote CD8+ T cells14. However, little is known about the impact of SLIT on innate cells or its capacity to improve pathogen clearance during acute respiratory infections.
The natural control of pneumococcal infection in the lungs greatly depends on the efficient and swift activation of local innate defences. We previously showed that enhancement of lungs&#8217; innate immunity by a single intranasal dose of flagellin (FliC), a TLR5 and NLRC4 agonist, protects 75-100% of mice challenged with a lethal dose of a clinical isolate of Streptococcus pneumoniae serotype 1. This protection was shown to be dependent on local recruitment of GR1+ cells (likely polymorphonuclear neutrophils, PMNs) and not dependent on antibodies, B or T cells15. 
Flagellin is the structural component of the bacterial flagellum. In its monomeric form it is recognized by two Pathogen Recognition Receptors (PRRs), TLR5 that senses extracellular FliC16 and NLRC4/NAIP5 inflammasome that detects intracellular flagellin17,18. When FliC is sensed by the PRRs an important inflammatory response is triggered. We and others have demonstrated that instillation of purified FliC from Salmonella enterica serovar Typhimurium into the lungs drives swift production of chemokines and cytokines specially when recognized by the lungs&#8217; epithelium that in turn orchestrate the recruitment of immune cells into the airways, mainly PMNs15,19-21. Although transient, the substantial neutrophil infiltration that takes place into the airways after nasal delivery of FliC could be a concern if moving towards clinical therapies for human use. Excessive inflammation could be detrimental for the lungs&#8217; function. Moreover, it has been shown that intranasal delivery of immunostimulatory molecules may cause facial paralysis and/or brain toxicity22-24. 
Sublingual immunotherapy offers a safer alternative to modulate the immune response in the respiratory tract compared to the intranasal route. It is non-invasive, painless, simple and has good patient compliance25. Furthermore, as mentioned before, it can induce protective responses in the respiratory mucosa without the risks associated to direct intranasal or intrapulmonary delivery of formulations. Sublingual route could be alternatively used to deliver molecules that have great effects onto the lung&#8217;s immune system but that have been proven to be toxic or to elicit great inflammation when administered intranasally. Besides these advantages, formulations for sublingual immunotherapy have lower cost of manufacture since non-sterile products can be delivered by this route and endotoxic shock is not a concern for SLIT. On the other hand, it is worth noticing that higher doses of the immunostimulatory compounds compared to those used by intranasal or parenteral routes are necessary to induce an immune response in the lungs; also highly concentrated solutions are needed when using the mouse model of SLIT since the anatomical site where the formulations are deposited is small. 
Based on our previous published data, we developed a model of protection using sublingual immunotherapy with flagellin as model immunostimulant. We demonstrated that a single dose of flagellin induced 60% survival against invasive pneumococcal pneumonia caused by the serotype 1 strain while all mice in the control group died of infection within 5 days. Flow cytometry analysis showed that higher numbers of PMN are recruited into the airways of protected animals after sublingual treatment with flagellin suggesting that these cells might be involved in the mechanism of protection induced by sublingual immunotherapy. 
This video shows in detail how to perform sublingual immunotherapy and also how to recover relevant tissue from the sublingual mucosa, draining lymph nodes as well as lungs and airways to perform further analysis. Additionally, it illustrates the general technique of cell preparation for FACS analysis and briefly shows how to prepare Streptococcus pneumoniae suspensions and how to perform intranasal infections in mouse to set up the acute infection model.

<table border="0" cellpadding="0" cellspacing="0" width="992">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Name of Material/ Equipment</td>
			<td style="width:212px;">Company</td>
			<td style="width:141px;">Catalog Number</td>
			<td style="width:245px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Ketamine solution (50 mg/ml)</td>
			<td style="width:212px;">Pharma Service, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Xilacine solution (2 %)</td>
			<td style="width:212px;">Portinco S.A., Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Sterile 1ml syringe</td>
			<td style="width:212px;">Modern, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Sterile 27G needle</td>
			<td style="width:212px;">Modern, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">RPMI 1640</td>
			<td style="width:212px;">General Electric Health Care</td>
			<td style="width:141px;">E15885</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Fetal Bovine Serum</td>
			<td style="width:212px;">ATCC</td>
			<td style="width:141px;">302020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Penicillin/Streptimycin Solution</td>
			<td style="width:212px;">SIGMA</td>
			<td style="width:141px;">P4333</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:395px;">Sterile PBS without Ca2+/Mg2+</td>
			<td style="width:212px;">PAA</td>
			<td style="width:141px;">H21002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Type-I Collagenase</td>
			<td>Life Technologies/Gibco</td>
			<td style="width:141px;">17100017</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Deoxyribonuclease I (DNAse-I)</td>
			<td>SIGMA</td>
			<td style="width:141px;">D4513</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Dispase</td>
			<td>Life Technologies/Gibco</td>
			<td>17105041</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">PerCP-Cy5.5 conjugated rat anti mouse IgG2b anti CD11b</td>
			<td style="width:212px;">BD</td>
			<td style="width:141px;">550993</td>
			<td style="width:245px;">Clone M1/70</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">APC conjugated hamster anti mouse IgG1 anti CD11c</td>
			<td style="width:212px;">BD</td>
			<td style="width:141px;">550261</td>
			<td style="width:245px;">Clone HL3&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">APC-Cy7 conjugated rat anti mouse IgG2a anti Ly6G</td>
			<td style="width:212px;">BD</td>
			<td style="width:141px;">560600</td>
			<td style="width:245px;">Clone 1A8</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:395px;">Sterile Saline Solution</td>
			<td style="width:212px;">Laboratorio Farmaco Uruguayo, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td style="width:245px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Tryptic Soy Agar</td>
			<td style="width:212px;">BD Difco, France</td>
			<td style="width:141px;">236950</td>
			<td style="width:245px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Defibrinated Sheep Blood</td>
			<td style="width:212px;">Biokey, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Sterile Petri Dishes</td>
			<td style="width:212px;">Greiner</td>
			<td style="width:141px;">633180</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">p10 Pipette</td>
			<td style="width:212px;">Gilson</td>
			<td style="width:141px;">F144802</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">P20 Pipette</td>
			<td>Eppendorf</td>
			<td style="width:141px;">3120000097</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p200 Pipette</td>
			<td style="width:212px;">Gilson</td>
			<td style="width:141px;">F123601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p200 Pipette</td>
			<td style="width:212px;">Capp</td>
			<td style="width:141px;">C200</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p200 Pipette</td>
			<td>Eppendorf</td>
			<td style="width:141px;">3120000054</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p1000 Pipette</td>
			<td>Eppendorf</td>
			<td style="width:141px;">3120000062</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Filter Tips P10</td>
			<td>Greiner</td>
			<td>771288</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Filter Tips P200</td>
			<td>Greiner</td>
			<td>739288</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Filter Tips P1000</td>
			<td>Greiner</td>
			<td>750288</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vortex</td>
			<td>BIOSAN</td>
			<td>V1-plus</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stainless steel fine tip forceps&#160;</td>
			<td>SIGMA</td>
			<td>Z168785/Z168777</td>
			<td>curved and straight</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dressing tissue forceps</td>
			<td>SIGMA</td>
			<td>F4392</td>
			<td>length 8 inches</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-dissecting forceps</td>
			<td>SIGMA</td>
			<td>F4017</td>
			<td>straight&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-dissecting forceps</td>
			<td>SIGMA</td>
			<td>F4142&#160;</td>
			<td>Curved</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mayo Scissors</td>
			<td>SIGMA</td>
			<td>Z265993&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Scalpel</td>
			<td>SAKIRA MEDICAL</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Biopsy Punch &#216; 3mm</td>
			<td>Stiefel Laboratories Ltd.</td>
			<td>2079D</td>
			<td>5mm diameter can also be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 1.5ml Tubes</td>
			<td>Deltalab</td>
			<td>200400P</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 15ml Tubes</td>
			<td>Greiner</td>
			<td>188271</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 50ml Tubes</td>
			<td>Greiner</td>
			<td>227261</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile serological pipettes 5 ml</td>
			<td>Greiner</td>
			<td>606160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile serological pipettes 10 ml</td>
			<td>Greiner</td>
			<td>607160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile serological pipettes 25 ml</td>
			<td>Greiner</td>
			<td>760180</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biological safety cabinet, class II</td>
			<td>Thermo Scientific</td>
			<td>1300 series, type A2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-Isolator&#160;Rack</td>
			<td>RAIR&#160;IsoSystem&#160;</td>
			<td>76144W</td>
			<td>Super&#160;Mouse&#160;1800 AllerZone&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Refrigerated Microcentfifuge</td>
			<td>Eppendorf</td>
			<td>Legend Micro 21R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Microcentfifuge</td>
			<td>Heraeus</td>
			<td>Biofuge-pico</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge</td>
			<td>Thermo Scientific</td>
			<td>Sorval ST40R</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CO2 Incubator&#160;</td>
			<td>Thermo Scientific</td>
			<td>Model&#160; 3111</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Thin-tip pasteur pipettes</td>
			<td>Deltalab</td>
			<td>D210022</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile pasteur pipettes</td>
			<td>Deltalab</td>
			<td>200007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 24-well plate</td>
			<td>Greiner</td>
			<td>662160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypan Blue Solution&#160;</td>
			<td>Life Technologies</td>
			<td>T10282</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Automatic Cell Counter - Cuntess</td>
			<td>Life Technologies</td>
			<td>C10227&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Countess Cell Counting Chamber Slides</td>
			<td>Life Technologies</td>
			<td>C10312</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flow Cytometry Tubes</td>
			<td>BD</td>
			<td>343675</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flow Cytometer - FACS Canto-II</td>
			<td>BD</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real Time PCR Instrument - Rotor Gene Q or ABI 7900</td>
			<td>Qiagen / Applied Biosystems</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trizol Reagent</td>
			<td>Life Technologies</td>
			<td>15596-026</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAse-I</td>
			<td>Life Technologies</td>
			<td>18068-015</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAse-I Buffer 10X</td>
			<td>Life Technologies</td>
			<td>18068015</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EDTA 25 mM</td>
			<td>Life Technologies</td>
			<td>18068015</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultra-Pure Water</td>
			<td>Life Technologies</td>
			<td>10977</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNAse Out</td>
			<td>Life Technologies</td>
			<td>100000840</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rndom Hexamer Primers</td>
			<td>Life Technologies</td>
			<td>N8080127</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">M-MLV-RT buffer</td>
			<td>Life Technologies</td>
			<td>18057-018</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">M-MLV-RT enzime</td>
			<td>Life Technologies</td>
			<td>28025-021</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantiTect Syber Green PCR Kit</td>
			<td>Qiagen</td>
			<td>204143</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Specific primers&#160;</td>
			<td>Life Technologies</td>
			<td style="width:141px;">N/A</td>
			<td>Molecular Biology Grade</td>
		</tr>
	</tbody>
</table>

sublingual immunotherapy as an alternative to induce protection against acute respiratory infections

Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been shown to effectively induce humoral and cellular responses at systemic and mucosal sites, namely the lungs and urogenital tract. Sublingual vaccination can promote protection against infections at the lower and upper respiratory tract; it can also promote tolerance to allergens and ameliorate asthma symptoms. Modulation of lung&#8217;s immune response by sublingual immunotherapy (SLIT) is safer than direct administration of formulations by intranasal route because it does not require delivery of potentially harmful molecules directly into the airways. In contrast to intranasal delivery, side effects involving brain toxicity or facial paralysis are not promoted by SLIT. The immune mechanisms underlying SLIT remain elusive and its use for the treatment of acute lung infections has not yet been explored. Thus, development of appropriate animal models of SLIT is needed to further explore its potential advantages. 
This work shows how to perform sublingual administration of therapeutic agents in mice to evaluate their ability to protect against acute pneumococcal pneumonia. Technical aspects of mouse handling during sublingual inoculation, precise identification of sublingual mucosa, draining lymph nodes and isolation of tissues, bronchoalveolar lavage and lungs are illustrated. Protocols for single cell suspension preparation for FACS analysis are described in detail. Other downstream applications for the analysis of the immune response are discussed. Technical aspects of the preparation of Streptococcus pneumoniae inoculum and intranasal challenge of mice are also explained.
SLIT is a simple technique that allows screening of candidate molecules to modulate lungs&#8217; immune response. Parameters affecting the success of SLIT are related to molecular size, susceptibility to degradation and stability of highly concentrated formulations.

설하 면역 성공적 폐 &#39;면역 반응을 조절하는데 사용될 수있다. 우리는 편모, TLR5 및 NLRC4 작용제의 단일 투여 량은, 케모카인의 CXCL1, CCL20 및 염수 처리 된 대조군과 비교 사이토 카인 IL-6 mRNA의 코딩의 중요한 상향 조절을 유도 할 수 있음을 보여 주었다. mRNA 수준의 유도 SLIT 후 8 시간에서 정점을 접고 20 시간 (그림 1) 이후 기저 수준으로 돌아갑니다. 슬릿 S. 폐렴으로 2 시간 전에 비강 내 감염을 수행 할 때 그러나, Cxcl1 및 IL6의 mRNA 수준은 상당히 비 처리 된 동물 (그림 2)에 비해 SLIT 후에도 24 시간을 상향 조절 남아 있었다. FACS에 의해 BAL의 세포 집단과 폐 조직의 분석은 설하 경로로 플릭으로 처리 동물이 폐 &#39;조직 (그림 3)에서기도에 호중구의 수를 증가하지만 한 것으로 나타났습니다. 그림 4에 나타낸 바와 같이, 편모와 SLIT 보호를 추진 급성 폐렴 구균 폐렴에 생존을 증가했다. <img alt="그림 1" fo:content-width="6.7in" src="/files/ftp_upload/52036/52036fig1highresV2.jpg" width="680" /> 편모와 설하 면역 요법 후 그림 폐 &#39;전사 프로파일의 1 속도론. 8 ~ 10 주령 BALB / c 마우스는 (N = 4) 마취 설하 경로로 편모 또는 식염수를 10 μg 처리 하였다. 폐는 상이한 시점에서 수집하고, 핵산 방부제에 넣었다. 전체 RNA 추출을 수행하고, cDNA를 합성 하였다. mRNA 수준은 Tabl에 나열된 특정 프라이머를 사용하여 실시간 PCR에 의해 평가 하였다예 1 상대 정량화 정상화 ACTB mRNA 수준을 사용 ΔCT 방법에 따라 수행 하였다. 결과는 SEM ± 중간으로 생리 식염수 투여군에 비해 배 증가로 표시됩니다. 별표는 맨 - 휘트니 테스트에 따라 계산 통계적으로 유의 한 차이 (p &lt;0.05)를 나타냅니다. 이 결과는 독립적 인 실험의 대표이다. <img alt="그림이" fo:content-width="6.2in" src="/files/ftp_upload/52036/52036fig2highresV2.jpg" width="660" /> 와 편모. 8 ~ 10 주령 BALB / c 마우스 (N = 4 대조군이고, n = 7 치료 그룹) 설하 면역 요법 후 폐렴 구균 성 폐렴 중 그림 2 폐 &#39;전사 프로파일에 의해 편모 또는 식염수를 10 μg 처리 하였다 마취 설하 경로. 2 시간 후 마우스는 10의 원인이되는 최소 치사량 (MLD)와 비강 내 경로로 감염시켰다S.의 임상 분리의 0 % 사망률 4 × 5 CFU / 50 μL에 해당하는 폐렴 구균 혈청 형 1 E1585. 폐는 공격 후 24 시간을 수집하고, RNA 추출 및 cDNA의 합성을 행 하였다까지 핵산 방부제에 저장 하였다. 실시간 PCR을 행했다 (표 1의 프라이머 목록 참조)과 상대적 정량화를위한 ​​표준화 ACTB mRNA 수준을 사용 ΔCT 방법에 따라 수행 하였다. 결과는 SEM ± 중간으로 생리 식염수 투여군에 비해 배 증가로 표시됩니다. 별표는 맨 - 휘트니 테스트에 따라 계산 통계적으로 유의 한 차이 (p &lt;0.05)를 나타냅니다. <img alt="그림 3" fo:content-width="6.5in" src="/files/ftp_upload/52036/52036fig3highresV2.jpg" width="680" /> 다형 핵 호중구의 그림 3과 분석 (PMN) SLIT 후 폐 &#39;조직과기도의 모집. 여덟에10 주 BALB / c 마우스는 (N = 4) 마취하에 설하 경로에 의해 편모 또는 식염수를 10 μg으로 처리 하였다. 2 시간 후 마우스를 S.의 MLD와 비강 내 경로로 감염시켰다 폐렴 구균 혈청 형 1 E1585. 공격 후 24 시간은, BAL을 수행하고 폐 FACS 분석을 위해 처리 하였다. PMN은 Ly6G 고 / CD11b를 고 /의 CD11c 음성 세포로 확인하고 FCS-SSC 프로필을 기반으로 하였다. 결과는 BAL 또는 폐에 총 세포 수의 대한 PMN의 백분율로 표시됩니다. 바 SEM ± 평균을 나타냅니다. 별표는 편도 만 - 휘트니 (Mann-Whitney) 테스트에 따라 계산 통계적으로 유의 한 차이 (p &lt;0.05)를 나타냅니다. <img alt="그림 4" fo:content-width="5.3in" src="/files/ftp_upload/52036/52036fig4highresV2.jpg" width="530" /> 편모 그림 4 SLIT 급성 폐렴 구균 폐렴에 대한 쥐를 보호합니다. </strong&gt; 8 ~ 10 주령 BALB / c 마우스는 (N = 8) 마취 설하 경로로 편모 또는 식염수를 10 μg 처리 하였다. 2 시간 후 마우스를 S.의 MLD와 비강 내 경로로 감염시켰다 폐렴 구균 혈청 형 1 E1585. 생존은 매일 평가 하였다. 카플란 - 마이어 곡선은 로그인 랭크 (벽난로 - 콕스) 검사에 따라 비교 하​​였다. 별표는 통계적으로 유의 한 차이 (p &lt;0.05) .Results는이 독립적 인 실험의 대표 나타냅니다. <table align="center" border="1" cellpadding="0" cellspacing="0"><tbody align="center"><tr><td> 이름 </td><td> 서열 5&#39;-3 &#39; </td><td> PCR 제품 길이 (BP) </td></tr><tr><td> MB-actin_F </td><td> GCTTCTTTGCAGCTCCTTCGT </td><td rowspan="2"> 68 </td></tr><tr><td> MB-actin_R </td><td> CGTCATCCATGGCGAACTG </td></tr><tr><td>mCCL20_F </td><td> TTTTGGGATGGAATTGGACAC </td><td rowspan="2"> 69 </td></tr><tr><td> mCCL20_R </td><td> TGCAGGTGAAGCCTTCAACC </td></tr><tr><td> mCXCL1_F </td><td> CTTGGTTCAGAAAATTGTCCAAAA </td><td rowspan="2"> 84 </td></tr><tr><td> mCXCL1_R </td><td> ACGGTGCCATCAGAGCAGTCT </td></tr><tr><td> MIL-6_F </td><td> GTTCTCTGGGAAATCGTGGAAA </td><td rowspan="2"> 78 </td></tr><tr><td> MIL-6_R </td><td> AAGTGCATCATCGTTGTTCATACA </td></tr><tr><td> mTNFalpha_F </td><td> CATCTTCTCAAAATTCGAGTGACAA </td><td rowspan="2"> 63 </td></tr><tr><td> mTNFalpha_R </td><td> CCTCCACTTGGTGGTTTGCT </td></tr><tr><td> mCxcl2_F </td><td> CCCTCAACGGAAGAACCAAA </td><td rowspan="2"> 72 </td></tr><tr><td> mCxcl2_R </td><td> CACATCAGGTACGATCCAGGC </td></tr></tbody></table> 실시간 PCR 분석을 위해 사용되는 표 1 프라이머리스트. qPCR의 분석에 사용되는 특정 프라이머 서열. 앞으로 및 마우스 ACTB에 대한 역방향 프라이머, Cccl20, Cxcl1, IL6, Tnfa 및 Cxcl1는 5&#39;-3 &#39;서열로 표시하고 제품의 기대 길이는 기본 쌍 (BP)에 표시됩니다.

Watch this Scientific Journal Video about Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections at JoVE.com

Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections

The present work illustrates the convenience of using sublingual immunotherapy to boost the innate immune response in the lungs and confer protection against acute pneumococcal pneumonia in mouse.

대안으로 설하 면역 요법은 급성 호흡기 감염에 대한 보호를 유도하기 위해

Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been ...

Research

JoVE Journal

Medicine

Pseudofracture: An Acute Peripheral Tissue Trauma Model

Pseudofracture : 급성 주변 조직 외상 모델

Following trauma there is an early hyper-reactive inflammatory response that can lead to multiple organ dysfunction and high mortality in trauma patients; ...

연구

의학

Pressure Controlled Ventilation to Induce Acute Lung Injury in Mice

마우스의 급성 폐 상해를 유발하는 압력 제어 환기

Murine models are extensively used to investigate acute injuries of different organs systems (1-34). Acute lung injury (ALI), which occurs with prolonged ...

Bilateral Common Carotid Artery Occlusion as an Adequate Preconditioning Stimulus to Induce Early Ischemic Tolerance to Focal Cerebral Ischemia

초점 대뇌 국소 빈혈에 조기 허혈성 공차를 유도하기 위해 적절한 전처리 자극으로 양측 경동맥 동맥 폐색

There is accumulating evidence, that ischemic preconditioning - a non-damaging ischemic challenge to the brain - confers a transient protection to a ...

Pharmacologic Induction of Epidermal Melanin and Protection Against Sunburn in a Humanized Mouse Model

인간 답게 된 마우스 모델에서 표피 멜라닌 및 보호에 대하여 햇볕의 약물 유도

Fairness of skin, UV sensitivity and skin cancer  risk all correlate with the physiologic function of the melanocortin 1  receptor, a Gs-coupled signaling ...

Lavage-induced Surfactant Depletion in Pigs As a Model of the Acute Respiratory Distress Syndrome (ARDS)

Lavage-induced Surfactant Depletion in Pigs As a Model of the Acute Respiratory Distress Syndrome ARDS

급성 호흡 곤란 증후군의 모델로서 돼지의 세척에 의한 계면 활성제 고갈 (ARDS)

Various animal models of lung injury exist to study the complex pathomechanisms of human acute respiratory distress syndrome (ARDS) and evaluate future ...

Oleic Acid-Injection in Pigs As a Model for Acute Respiratory Distress Syndrome

올레산 급성 호흡 곤란 증후군에 대 한 모델로 돼지에 주입

The acute respiratory distress syndrome is a relevant intensive care disease with an incidence ranging between 2.2% and 19% of intensive care unit ...

Subclavian Vein Puncture As an Alternative Method of Blood Sample Collection in Rats

쥐에서 혈액 샘플 컬렉션의 대체 방법으로 빵 꾸 하 정 맥

Blood collection with enough blood volume is essential in animal experiments. Blood collection from the tail vein of rats is popular and less stressful ...

Implantation of an Isoproterenol Mini-Pump to Induce Heart Failure in Mice

마우스에서 심부전을 유도하는 이소프로테레놀 미니 펌프 의 이식

Isoproterenol (ISO), is a non-selective beta-adrenergic agonist, that is used widely to induce cardiac injury in mice. While the acute model mimics ...

The Rigid Tube as an Alternative in Controlling the Problematic Airway

문제가 있는 기도를 제어하는 대안으로 있는 경질 튜브

The unexpected problematic airway represents a large proportion of anesthesia-related morbidity and mortality. The retromolar or paraglossal approach is ...

Halogenated Agent Delivery in Porcine Model of Acute Respiratory Distress Syndrome via an Intensive Care Unit Type Device

Acute respiratory distress syndrome (ARDS) is a common cause of hypoxemic respiratory failure and death in critically ill patients, and there is an urgent ...