Name: generation of genomic deletions in mammalian cell lines via crispr/cas9
Uploaded: 2015-01-03T14:00:00
Duration: 9 min 40 s
Description: Watch this Scientific Journal Video about Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9 at JoVE.com

Thanks to Jason Wright for suggesting the Golden Gate Assembly cloning strategy and Katherine Helming and members of Orkin lab, particularly Jian Xu, Guoji Guo, Elenoe Smith, and Partha Das for helpful discussions. This work was supported by NIH R01HL032259 and P30DK049216 (Center of Excellence in Molecular Hematology) to S.H.O. and NIDDK K08DK093705 to D.E.B.

1. Conception CRISPR <ol><li> Conception sgRNAs manuellement ou en utilisant des outils en ligne disponibles gratuitement 7. Utilisez ces outils pour aider à identifier les séquences de guidage qui minimisent matchs génomiques identiques ou quasi-matches pour réduire le risque de clivage loin de sites cibles (effets hors-cible). Se assurer que les séquences de guidage sont constitués d&#39;un 20-mère (&quot;séquence protospacer&quot;) en amont d&#39;une séquence &quot;NGG&quot; (&quot;protospacer à motifs adjacents» ou PAM) au niveau du site de reconnaissance génomique. REMARQUE: La figure 1 décrit les stratégies de suppression possibles pour les gènes et les éléments non-codants. Pour créer un KO génique, deux ARNsg situés dans exons enrichiront clones de deletion même monoalléliques la perte de fonction. Ce est en raison de la fréquence élevée des indels formés sur allèles non supprimé 12, qui sont susceptibles de provoquer des mutations du cadre de lecture conduisant à un non-sens médiation désintégration de l&#39;ARNm transcrit (figure 1B). </li><li> Utilisez leGuides d&#39;exemple pour la suppression de PIM1 destiné à souris (Mus musculus; tableau 1, figure 2A). NOTE: Dans cet exemple, la séquence et le PAM protospacer de ARNsg-A arrive de tomber sur le brin inférieur (Crick), tandis que la séquence et PAM protospacer de ARNsg-B tombent sur ​​le dessus (Watson) volet (figure 2A). Cependant, l&#39;ORD sera indépendante de l&#39;orientation de la séquence protospacer / PAM par rapport au brin haut ou en bas. </li><li> Déterminer le complément inverse (rc) de chaque séquence de guidage. Exemple inverse séquences complémentaires de l&#39;ARN sg PIM1 du tableau 1 figurent au tableau 2. </li><li> Obtenir 24 ou 25-mer oligos pour chaque guide et son complément inverse associé y compris des nucléotides supplémentaires à des fins de clonage et d&#39;expression. REMARQUE: Ici, nous discutons de l&#39;utilisation de la pSpCas9 (BB) plasmide (pX330) (Addgene plasmide ID 42230). Ce plasmide permet l&#39;simultanéexpression de ARNsg et SpCas9, mais ne contient pas de marqueurs de sélection 7. D&#39;autres constructions peuvent être utilisées, telles que pX458 (Addgene plasmide ID 48138) ou pX459 (Addgene plasmide ID 48139), qui comprend la GFP et la puromycine comme marqueurs sélectionnables, respectivement, ou dans lequel de multiples constructions sgRNAs peuvent être exprimés à partir d&#39;un seul plasmide. <ol><li> Ajouter &quot;CACC&quot; avant que la séquence de guidage 20-mer et «AAAC» avant complément inverse du guide pour le clonage dans le vecteur pX330 utilisant l&#39;enzyme de restriction Bbsl (tableau 3). </li><li> Ajouter un nucléotide G après la séquence CACC et avant la vingt-mer si la première position de la 20-mer ne est pas l&#39;expression G. ARNsg du promoteur U6 du vecteur pX330 est renforcée par l&#39;inclusion d&#39;un nucléotide G après la séquence CACC . Ajouter un C à l&#39;extrémité 3 &#39;du complément d&#39;oligo inverse (par exemple, ARN sg-A dans le tableau 4). Les oligos résultants seraient oligos 25-mer. </li><li> Commentjamais, si la première position de la 20-mer (séquence d&#39;protospacer) est G, ne pas ajouter un autre G (par exemple, ARN sg-B dans le Tableau 4) et ne pas ajouter C vers la position finale du complément d&#39;oligo inverse. Dans ce cas, les oligos résultants seraient oligos 24-mer (tableau 4). </li></ol></li></ol> 2. Conception de suppression amorces de dépistage <ol><li> Conception un jeu d&#39;amorces internes à la séquence à supprimer (&quot;bande non-suppression&quot;) et un autre ensemble d&#39;amorces amont et en aval des sites ARNsg de clivage (&quot;bande de suppression»; Figures 1-2). En l&#39;absence de deletion, la «bande de deletion&quot; est souvent trop grand pour amplifier efficacement. Typiquement, les amorces utiliser au moins 100 pb à partir du site de clivage prédit pour assurer la détection ne sera pas affecté par une petite insertion-délétion au niveau du site cible ARN sg. <ol><li> Concevoir des amorces supplémentaires pour analyser les cicatrices (petites indels produites au ARNsg cSite leavage sans suppression prévue). Utilisez une paire de marche avant et arrière des amorces flanquant chaque site cible ARNsg (dans les 150 à 350 pb) pour amplifier le site cible ARNsg à examiner pour la cicatrisation. Cela peut être utile pour caractériser les allèles non supprimée dans les clones de deletion monoalléliques. </li></ol></li><li> Pour de petites deletions (comme la «bande de deletion&quot; peut encore amplifier), résoudre amplicons sur un gel d&#39;agarose afin de déterminer si la taille est compatible avec la présence ou l&#39;absence de suppression. Pour cette approche, des amorces internes décrites à l&#39;étape 2.1 peuvent être omises. </li></ol> 3. CRISPR clonage <ol><li> Recuit et phosphoryler oligos. <ol><li> Resuspendre les oligos à une concentration de 100 uM dans ddH 2 O. </li><li> Préparer un mélange de 10 pi de réaction pour chaque guide et son complément inverse: 1,0 ul ARNsg 24 ou 25-mer oligo (100 M; voir l&#39;étape 1.4), 1,0 ul ARNsg 24 ou 25-mer complé inversert oligo (100 uM; voir l&#39;étape 1.4), 1,0 pi de tampon de ligation 10x T4, 6,5 pi ddH 2 O, et 0,5 pi de T4 polynucleotide kinase (PNK) (10 000 U / ml). NOTE: phosphorylée oligos peuvent être commandés à la place. Pour cette approche, l&#39;utilisation de PNK T4 est omise. </li><li> Recuit dans un thermocycleur en utilisant les paramètres suivants: 37 ° C pendant 30 min; 95 ° C pendant 5 minutes, puis descente de la rampe de 25 ° C à 5 ° C / min. </li><li> Diluer au 1/10 dans ddH oligos 2 O (par exemple, 1,0 ul oligos annelés + 9,0 ul ddH 2 O pour obtenir une concentration de 1 uM). </li></ol></li><li> Oligos recuits ligaturer dans pX330 utilisant un assemblage stratégie de clonage Golden Gate 26. <ol><li> Préparer un mélange de réaction de 50 ul: 100 vecteur ng circulaire pX330, 1,0 ul oligos annelés (1 uM; voir étape 3.1.4), le tampon d&#39;enzyme de restriction 5,0 pi (10x), 4,0 pi (20 U) Bbsl enzyme de restriction (5000 U / ml), 5,0 μl &#39;ATP (10 mM), 0,25 ul (5 ug) de BSA (20 mg / ml), 750 ul (0,375 U) d&#39;ADN ligase de T4 (2000000 U / ml) et H 2 O à volume final de 50 ul. Cette réaction peut être réduite jusqu&#39;à un volume final plus petit si nécessaire. </li><li> Échantillons se exécutent dans un thermocycleur en utilisant les paramètres suivants: Cycles 1-20 (37 ° C pendant 5 min, 20 ° C pendant 5 min); Cycle 21 (80 ° C pendant 20 min). Ces conditions permettent de cyclisme pour la digestion et la ligature de se produire dans une réaction (voir l&#39;étape 3.2). </li><li> Transformer 10 pi de DH5a E. coli cellules avec 1 pl de la réaction (de 3.2.1 - 3.2.2). </li><li> Plate sur un bouillon de lysogénie (LB) gélose avec 100 ug / ml d&#39;ampicilline et incuber O / N à 37 ° C. </li></ol></li><li> Choisissez 2-3 colonies et l&#39;inoculer dans une culture de mini-préparation. <ol><li> Effectuer mini-préparation pour chaque échantillon et séquencer chaque colonie en utilisant une amorce sens de promoteur U6: CGTAACTTGAAAGTATTTCGATTTCTTGGC. Il se agit d&#39;aramorce de séquençage epresentative; d&#39;autres amorces flanquantes peuvent être utilisés. </li></ol></li><li> Choisir une colonie de la séquence vérifiée et inoculer dans une culture de maxi-prep. taille de préparation peut être mise à l&#39;échelle en fonction du rendement de l&#39;ADN requis. </li><li> Effectuer maxi-prep pour chaque CRISPR / Cas9 construction. </li></ol> 4. transfectant CRISPRs dans les cellules d&#39;intérêt NOTE: Ce protocole implique la livraison de CRISPR plasmides / Cas9 par électroporation 27. Ce protocole est décrit en détail pour érythroleucémie murine (MEL), les cellules d&#39;une lignée cellulaire en suspension. Le milieu de culture dans toutes les étapes se compose de DMEM complété avec 2% de pénicilline / streptomycine et 1% de L-glutamine, qui est utilisé pour des cellules MEL. Toutefois, la transfection transitoire de CRISPR / Cas9 plasmides peuvent être adaptées avec succès pour de nombreux types de cellules en utilisant des conditions de culture préférées et des stratégies de transfection pour chaque type de cellule. Alors que les cellules MEL sont des cellules en suspension, des instructions pour les cellules adhérentes have également été inclus. <ol><li> Se assurer qu&#39;il ya 2 x 10 6 cellules par CRISPR paire. Remettre en suspension 2 x 10 6 cellules dans 100 ul de solution d&#39;électroporation et ajouter à cuvette d&#39;électroporation. <ol><li> Ajouter 5 ug de chaque CRISPR / Cas9 construction (10 ug total). Ajouter 0,5 pg de la GFP construction d&#39;expression. </li></ol></li><li> L&#39;électroporation des cellules avec 250 volts pendant 5 ms dans une cuvette de 2 mm en utilisant un système d&#39;électroporation. NOTE: Vous pouvez également utiliser une autre méthode de transfection tels que la transfection cationique à base de liposomes. Optimiser les conditions de transfection pour chaque lignée cellulaire avec une construction rapporteur pour assurer la livraison de plasmide robuste avant d&#39;essayer édition du génome. </li><li> Transférer immédiatement la solution de cuvette dans 1 ml de milieux de culture après l&#39;électroporation. Minimiser le temps entre l&#39;électroporation et transférer la solution dans un milieu pour améliorer la viabilité des cellules. </li><li> Incuber à 30-37 ° C pendant 24 à 72 h. 30 ° C peut améliorer génomel&#39;efficacité du montage, mais 37 ° C est acceptable. </li></ol> 5. cellulaire activé par fluorescence (FACS) de cellules transfectées <ol><li> Préparer les cellules pour FACS en les filtrant à travers un filtre de 50 um dans un tube FACS. </li><li> FACS trier haut ~ 3% des cellules GFP-positives afin d&#39;enrichir les cellules qui ont reçu des niveaux élevés de l&#39;CRISPR / Cas9 construit. </li><li> Plate cellules triées individuellement dans des plaques à fond rond de 96 puits en utilisant trieuse ou en utilisant dilution limite à 30 cellules par 96 puits à fond rond plaque. Optimiser placage du type de cellule utilisée à limiter la dilution avant d&#39;effectuer cette étape pour obtenir de manière fiable environ 30 cellules par plaque de 96 puits. </li><li> Inclure 100 ul par puits de milieu de culture cellulaire. </li><li> Pour les cellules restantes triés (&quot;en vrac&quot;) qui ne sont pas immatriculés, geler la moitié des cellules pour le placage avenir. Plaque l&#39;autre moitié pour le dépistage et la validation amorce (voir l&#39;étape 6). NOTE: Ce protocole est pour les cellules de suspension. Les cellules adhérentes peuvent croître soit comme cellules individuelles en plaque 96 puits à fond plat ou dans une boîte de 10 cm de côté à faible concentration de sorte que seule cellule individuelle clones dérivés peuvent être récupérés et transférés dans une plaque plat de 96 puits fond. </li><li> Laisser les cellules en vrac à incuber à 37 ° C pendant 3-7 jours, les clones permettent à incuber à 37 ° C pendant 7 à 14 jours. Ces temps varient en fonction du temps de doublement de la lignée cellulaire utilisée. NOTE: Ce temps d&#39;incubation permet la prolifération cellulaire suffisante pour le dépistage de l&#39;ADN génomique (ADNg de) la suppression prévue par PCR (voir les étapes 6.1 et 7.1). Les cellules ont suffisamment proliféré en vrac lorsque la concentration dépasse ~ 100 000 cellules / ml ou de cellules adhérentes, les cellules ont atteint ~ 80% de confluence. Les clones ont proliféré suffisamment macroscopiquement visible une fois avec un diamètre de 2 mm ~. </li></ol> 6. Primer Validation et dépistage de CRISPR / Suppression Cas9-Mediated <ol><li> Isoler à partir de l&#39;ADNg des cellules parentales et triés en vrac en remettant en suspension les culots cellulaires parentales et en vrac dans 50 ul de solution d&#39;extraction de l&#39;ADN. NOTE: En général ~ 100 000 cellules sont utilisées pour l&#39;extraction d&#39;ADN, bien qu&#39;une large gamme de nombres de cellules est acceptable. Les cellules triées en vrac sont composés d&#39;une population polyclonale exposé à ARN sg-A et B-ARN sg (voir l&#39;étape 5). Le but de la PCR suivant est de valider amorces et vérifier la présence de suppression génomique destinée. </li><li> Exécutez échantillon dans thermocycleur et exécutez le programme suivant: 65 ° C pendant 6 min, 98 ° C pendant 2 minutes pour extraire ADNg. Mesurer la concentration d&#39;ADN. REMARQUE: Des mesures 6,1 et 6,2 recommandent un procédé efficace pour l&#39;extraction d&#39;ADN, une méthode pour l&#39;isolement d&#39;ADN génomique peut être utilisé pour être en mesure d&#39;effectuer la PCR dans l&#39;étape 6.3. </li><li> Assembler une PCR de 20 ul avec les composants suivants: 10 ul mélange 2x PCR, 0,5 ul amorce avant (10 _6; M), 0,5 ul d&#39;amorce antisens (10 uM), 50 à 100 ng d&#39;ADNg, H 2 O et jusqu&#39;à 20 ul. Utilisez les amorces conçues à l&#39;étape 2 ci-dessus. Mener PCR pour &quot;bande non-suppression» et «bande de suppression&quot; dans des réactions séparées. REMARQUE: De nombreuses polymerases peuvent être utilisées pour l&#39;étape 6.3. <ol><li> Échantillons exécuter dans un thermocycleur en utilisant les paramètres suivants: 95 ° C pendant 15 min, 35 cycles de (95 ° C pendant 30 sec, 60 ° C pendant 1 min, 72 ° C pendant 1 min) et 72 ° C pendant 10 minutes . Optimiser les conditions de PCR pour chaque paire amorce conçue sur la base de tester les cellules en vrac triés. </li></ol></li><li> Exécuter échantillons sur gel d&#39;agarose à 2% à 10 V / cm à l&#39;aide 1x Tris-acétate-EDTA (TAE) tampon. </li><li> Examiner les échantillons pour détecter la présence / l&#39;absence de non-suppression et bandes de suppression (figure 2). Considérons le multiplexage &quot;suppression&quot; et &quot;non-suppression&quot; PCR des paires d&#39;amorces dans une réaction unique. Optimiser multiplexagedans une population polyclonale (c.-à-vrac cellules classée) avant le dépistage des clones individuels. Il est essentiel que la suppression et non-suppression amplicons être facilement résolus sur un gel d&#39;agarose pour le multiplexage. </li></ol> 7. dépistage CRISPR / Cas9 clones pour les suppressions et Clone Sélection <ol><li> Pour les cellules en suspension, l&#39;ensemble de clones d&#39;une plaque à 96 puits unique contenant déjà 50 ul de milieu de culture de cellules par puits pour un volume final de 150 ul. Ceci facilite le dépistage en permettant une pipette à canaux multiples à utiliser pour le reste de la procédure décrite dans l&#39;étape 7. <ol><li> Transférer 50 pl de chaque puits (100 ul laissant dans chaque puits) sur une plaque à 96 puits PCR en utilisant une pipette multicanaux. </li><li> Plaque PCR centrifuger à 400 g pendant 5 min et retirez surnageant en tapotant la plaque PCR dessus d&#39;un évier. Ajouter 50 ul de solution d&#39;extraction d&#39;ADN par puits et remettre en suspension. Passez à l&#39;étape 7.3 pour des cellules en suspension. </li&gt; </ol></li><li> Pour les cellules adhérentes, les médias aspirer. Ajouter 20 pi de 0,05% de trypsine-EDTA à chaque puits avec un clone présent. <ol><li> Resuspendre les cellules dans 200 ul de milieu. Pipette mélanger à détacher les cellules. </li><li> Plaque 100 ul chacune en deux plaques de 96 puits à fond plat distincts. Gardez une plaque pour permettre clones de cultiver et d&#39;utiliser l&#39;autre plaque à l&#39;écran chaque clone pour les suppressions. </li><li> Ajouter 100 ul supplémentaires à chaque puits pour un volume total de 200 ul. Attendre 24 à 72 h pour permettre aux cellules de se développer. </li><li> Aspirer le milieu. Ajouter 50 ul solution d&#39;extraction d&#39;ADN par puits, remettre en suspension et transfert à 96 puits plaque PCR. Passez à l&#39;étape 7.3. </li></ol></li><li> Extraire le gDNA à partir de clones. Exécuter échantillon dans thermocycleur: 65 ° C pendant 6 min et 98 ° C pendant 2 min pour extraire ADNg. </li><li> Écran à chaque clone en utilisant la même amorces de PCR et les conditions réactionnelles optimisées sur les cellules en vrac (voir l&#39;étape 6). </li><li> Sélectionnez le clones iDENtifiés avec la suppression souhaitée et passer à plus grande plaque ou flacon pour la croissance. </li></ol> 8. Validation des clones de suppression bialléliques <ol><li> Afin de caractériser clones obtenus et valider un KO réussie, évaluer clones à l&#39;ADN ainsi que les niveaux d&#39;ARN et / ou de protéines. <ol><li> Pour évaluer l&#39;ADN, amplifier bandes de suppression de clones de deletion bialléliques avec une polymérase de relecture et de cloner les amplicons (par exemple, avec un kit de clonage PCR) dans un vecteur plasmidique. Transformer le plasmide dans DH5a E. coli cellules et plaque sur LB agar plaques avec l&#39;antibiotique concerné. Sélectionnez plusieurs colonies, mini-prep chacun, et soumettre chaque clone au séquençage Sanger pour caractériser chaque suppression allèle 28-30. En répétant le test PCR pour la suppression après l&#39;écran initial garantit que le clone correct a été sélectionné et la reproductibilité des résultats. </li><li> Pour évaluer l&#39;ARN, RT-qPCR effectuer pour gene expression du gène pertinent 30,31. </li><li> Pour évaluer la protéine, effectuer un immunoblot en utilisant un anticorps contre la protéine 33 concernée. </li></ol></li></ol>

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+human+genome+engineering+via+Cas9.">RNA-guided human genome engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li><li>Gaj, T., Gersbach, C. A., Barbas, C. F. Z. F. N., TALEN, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends in Biotechnology. 31 (7), 397-405 (2013).</li><li>Barrangou, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+provides+acquired+resistance+against+viruses+in+prokaryotes.">CRISPR provides acquired resistance against viruses in prokaryotes.</a> Science. 315, 1709-1712 (2007).</li><li>Ding, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+efficiency+of+human+pluripotent+stem+cell+genome+editing+through+replacing+TALENs+with+CRISPRs.">Enhanced efficiency of human pluripotent stem cell genome editing through replacing TALENs with CRISPRs.</a> Cell Stem Cell. 12 (4), 393-394 (2013).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+the+CRISPR-Cas9+system.">Genome engineering using the CRISPR-Cas9 system.</a> Nature Protocols. 8 (11), 2281-2308 (2013).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double+nicking+by+RNA-guided+CRISPR+Cas9+for+enhanced+genome+editing+specificity.">Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity.</a> Cell. 154 (6), 1380-1389 (2013).</li><li>Larson, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+interference+(CRISPRi)+for+sequence-specific+control+of+gene+expression.">CRISPR interference (CRISPRi) for sequence-specific control of gene expression.</a> Nature Protocols. 8 (11), 2180-2196 (2013).</li><li>Yang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+generation+of+mice+carrying+reporter+and+conditional+alleles+by+CRISPR/Cas-mediated+genome+engineering.">One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering.</a> Cell. 154 (6), 1370-1379 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153 (4), 910-918 (2013).</li><li>Canver, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Genomic+Deletion+Efficiency+Mediated+by+CRISPR/Cas9+in+Mammalian+Cells.">Characterization of Genomic Deletion Efficiency Mediated by CRISPR/Cas9 in Mammalian Cells.</a> Journal of Biological Chemistry. 289 (31), 21312-21324 (2014).</li><li>Xiao, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosomal+deletions+and+inversions+mediated+by+TALENs+and+CRISPR/Cas+in+zebrafish.">Chromosomal deletions and inversions mediated by TALENs and CRISPR/Cas in zebrafish.</a> Nucleic Acids Research. 41 (14), e141 (2013).</li><li>Zhou, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+sgRNAs+facilitate+CRISPR/Cas9+mediated+mouse+genome+targeting.">Dual sgRNAs facilitate CRISPR/Cas9 mediated mouse genome targeting.</a> The FEBS Journal. , (2014).</li><li>Wang, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+screens+in+human+cells+using+the+CRISPR-Cas9+system.">Genetic screens in human cells using the CRISPR-Cas9 system.</a> Science. 343 (6166), 80-84 (2014).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Niu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Gene-Modified+Cynomolgus+Monkey+via+Cas9/RNA-Mediated+Gene+Targeting+in+One-Cell+Embryos.">Generation of Gene-Modified Cynomolgus Monkey via Cas9/RNA-Mediated Gene Targeting in One-Cell Embryos.</a> Cell. 156 (4), 836-843 (2014).</li><li>Guo, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+RNA/Cas9-mediated+genome+editing+in+Xenopus+tropicalis.">Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis.</a> Development. 141 (3), 707-714 (2014).</li><li>Xie, K., Yang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+genome+editing+in+plants+using+a+CRISPR-Cas+system.">RNA-guided genome editing in plants using a CRISPR-Cas system.</a> Molecular Plant. 6 (6), 1975-1983 (2013).</li><li>Waaijers, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-targeted+mutagenesis+in+Caenorhabditis+elegans.">CRISPR/Cas9-targeted mutagenesis in Caenorhabditis elegans.</a> Genetics. 195 (3), 1187-1191 (2013).</li><li>Bassett, A. R., Liu, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9+and+Genome+Editing+in+Drosophila.">CRISPR/Cas9 and Genome Editing in Drosophila.</a> Journal of Genetics and Genomics. 41 (1), 7-19 (2014).</li><li>Schwank, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Repair+of+CFTR+by+CRISPR/Cas9+in+Intestinal+Stem+Cell+Organoids+of+Cystic+Fibrosis+Patients.">Functional Repair of CFTR by CRISPR/Cas9 in Intestinal Stem Cell Organoids of Cystic Fibrosis Patients.</a> Cell Stem Cell. 13 (6), 653-658 (2013).</li><li>Wu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correction+of+a+Genetic+Disease+in+Mouse+via+Use+of+CRISPR-Cas9.">Correction of a Genetic Disease in Mouse via Use of CRISPR-Cas9.</a> Cell Stem Cell. 13 (6), 659-662 (2013).</li><li>Lappalainen, T. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+and+genome+sequencing+uncovers+functional+variation+in+humans.">Transcriptome and genome sequencing uncovers functional variation in humans.</a> Nature. 501 (7468), 506-511 (2013).</li><li>Bauer, D. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Erythroid+Enhancer+of+BCL11A+Subject+to+Genetic+Variation+Determines+Fetal+Hemoglobin+Level.">An Erythroid Enhancer of BCL11A Subject to Genetic Variation Determines Fetal Hemoglobin Level.</a> Science. 342 (6155), 253-257 (2013).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method+with+high+throughput+capability.">A one pot, one step, precision cloning method with high throughput capability.</a> PloS One. 3, e3647 (2008).</li><li>Gehl, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation:+theory+and+methods,+perspectives+for+drug+delivery,+gene+therapy+and+research.">Electroporation: theory and methods, perspectives for drug delivery, gene therapy and research.</a> Acta Physiologica Scandinavica. 177, 437-447 (2003).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+Plasmid+DNA+from+Bacterial+Colonies+Using+the+Qiagen+Miniprep+Kit.">Purifying Plasmid DNA from Bacterial Colonies Using the Qiagen Miniprep Kit.</a> J. Vis. Exp. (6), e247 (2007).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Plasmid+DNA+into+E.+coli+Using+the+Heat+Shock+Method.">Transformation of Plasmid DNA into E. coli Using the Heat Shock Method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Finney, M., Nisson, P. E., Rashtchian, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+cloning+of+PCR+products.">Molecular cloning of PCR products.</a> Current Protocols in Molecular Biology. Chapter 15. (Unit 15.4), (2001).</li><li>Gordanpour, A., Nam, R. K., Sugar, L., Bacopulos, S., Seth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+Detection+in+Prostate+Tumors+by+Quantitative+Real-time+PCR+(qPCR).">MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR (qPCR).</a> J. Vis. Exp. (63), e3874 (2012).</li><li>Schularick, N. M., Clark, J. J., Hansen, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+Culture+of+Human+Vestibular+Schwannomas.">Primary Culture of Human Vestibular Schwannomas.</a> J. Vis. Exp. (89), e51093 (2014).</li><li>Eslami, A., Lujan, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Western+Blotting:+Sample+Preparation+to+Detection.">Western Blotting: Sample Preparation to Detection.</a> J. Vis. Exp. (44), e2359 (2010).</li><li>McVey, M., Lee, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MMEJ+repair+of+double-strand+breaks+(director&#8217;s+cut):+deleted+sequences+and+alternative+endings.">MMEJ repair of double-strand breaks (director&#8217;s cut): deleted sequences and alternative endings.</a> Trends in Genetics. 24 (11), 529-538 (2008).</li><li>Symington, L. S., Gautier, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-strand+break+end+resection+and+repair+pathway+choice.">Double-strand break end resection and repair pathway choice.</a> Annual Review of Genetics. 45, 247-271 (2011).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nature Biotechnology. 31 (9), 822-826 (2013).</li><li>Wu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+binding+of+the+CRISPR+endonuclease+Cas9+in+mammalian+cells.">Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells.</a> Nature Biotechnology. , (2014).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nature Biotechnology. 31 (9), 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32, 279-284 (2014).</li><li>Alem&#225;n, L. M., Doench, J., Sharp, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+Comparison+of+siRNA-induced+off-target+RNA+and+protein+effects.">a Comparison of siRNA-induced off-target RNA and protein effects.</a> RNA. 13 (3), 385-395 (2007).</li><li>Anderson, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+validation+of+the+importance+of+seed+complement+frequency+to+siRNA+specificity+Experimental+validation+of+the+importance+of+seed+complement+frequency+to+siRNA+specificity.">Experimental validation of the importance of seed complement frequency to siRNA specificity Experimental validation of the importance of seed complement frequency to siRNA specificity.</a> RNA. 14, 853-861 (2008).</li><li>Marine, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Common+seed+analysis+to+identify+off-target+effects+in+siRNA+screens.">Common seed analysis to identify off-target effects in siRNA screens.</a> Journal of Biomolecular Screening. 17 (3), 370-378 (2012).</li></ol>

We have no conflicts of interest related to this report.

Le système de CRISPR / Cas9 peut être utilisé pour générer des deletions génomiques d&#39;une gamme de tailles. Bien que nous avons observé que la fréquence de suppression varie inversement par rapport à la taille de la suppression prévue, nous avons été en mesure de récupérer les suppressions de jusqu&#39;à 1 Mb et suppressions jusqu&#39;à 100 kb donné régulièrement plusieurs bialléliques supprimé clones. Nous avons observé aucune perte d&#39;efficacité de l&#39;introduction de deletions séquentiellement dans une lignée cellulaire. Cette stratégie peut être utilisée pour la création de suppression combinatoire de nombreux gènes et des éléments. Le processus d&#39;obtention de clones de deletion bialléliques peut être accéléré en estimant le nombre minimum de clones devaient être examiné sur la base de la taille de la deletion d&#39;obtenir le nombre souhaité de clones de deletion 12 biallélique. La capacité d&#39;obtenir la suppression monoallélique à l&#39;absence de suppression lors de la distribution probabiliste biallélique peut indiquer la létalité cellulaire associé à la perte complète de la fonction. Faible frequency ou suppressions absents pourraient refléter un certain nombre de scénarios y compris la mauvaise transfection, sgRNAs inefficaces ou inefficaces amorces PCR de dépistage (en raison du manque d&#39;un contrôle positif pour valider amorces de PCR pour le dépistage de suppression). cellules GFP + peuvent être utilisés comme un substitut pour une efficacité de transfection (voir l&#39;étape 5.2), donc une réduction des cellules GFP + reflète probablement mauvaise transfection et A résultant diminué l&#39;efficacité de suppression. L&#39;utilisation de deux paires différentes de ARNsg avec des amorces de dépistage indépendants peuvent aider à contrôler ARNsg inefficace et dépistage des amorces de PCR et de maximiser les chances d&#39;obtenir des clones de deletion bialléliques. Tri cellulaire pour cellules GFP + enrichit pour les allèles de suppression. Bien que cette étape peut être omise, omission faudra vraisemblablement plusieurs clones de dépistage pour identifier celles présentant des délétions ou monoalléliques bialléliques. Dans la mesure où l&#39;efficacité de transfection peut être optimisée, nous nous attendrions édition du génome des gains d&#39;efficacité. <p class = &quot;jove_content&quot;&gt; Les événements NHEJ qui sous-tendent des deletions et des résultats de réparation locale d&#39;une série d&#39;allèles avec une variété d&#39;indels au niveau des sites cibles. Le résultat est prédominant petits ~ 1-10 pb insertions ou deletions plus communément au niveau du site de clivage ARN sg dirigée (figure 2B). Souvent, ces allèles semblent être le résultat de base microhomology réparation 34,35. Il convient de noter que la stratégie de détection basée sur la PCR, nous décrivons ne identifiera pas plus grandes insertions ou deletions, plus complexes, des inversions, ou des réarrangements. Bien que ces événements sont moins fréquents, nous avons observé clones dans laquelle ni suppression, ni amplicons non-suppression pourraient être détectés, et après enquête, tenir compte de ces résultats plus complexes. Nous avons observé une vaste CRISPR / Cas9-médiation &quot;cicatrices&quot; des allèles non-suppression de monoalléliques et non-suppression clones (voir la figure 2B). Ces «cicatrices» sont constitués deindels petites produites au niveau du site de clivage ARN sg sans la suppression prévue (ce est à dire, la suppression du segment intermédiaire entre sgRNAs A et B). Ces cicatrices interrompent souvent reconnaissance de la cible par le ARNsg. Par conséquent, nous inciter à la prudence dans reciblage allèles dans les cellules préalablement exposés à sgRNAs utilisant les mêmes sgRNAs. Une stratégie de reciblage plus de succès utiliserait ARNsg unique de séquences distinctes de sites de reconnaissance &quot;cicatrices&quot; précédemment. Dans les cas où une paire de sgRNAs reconnaît des séquences exoniques (figure 1B, en bas), les allèles du cadre de lecture peut être produit même en l&#39;absence de suppression. Par conséquent, clones de deletion monoalléliques peuvent être enrichis pour la perte de fonction en raison de la fréquence élevée de mutations de déphasage sur le non-supprimé allèle 12. Une préoccupation avec le système de CRISPR / Cas9 est hors-cible, à savoir les effets, la modification génomique sur les sites involontaires 36-38. Res dernières rapports ont suggéré que plus courts ARN guides avec 17 à 19 nucléotides peuvent réduire la fréquence des CRISPR / Cas9-fondé des effets hors-cible 39. En outre, une stratégie à double entaillage aide de deux guides par site cible avec un nickase peut être utilisé pour créer CDB tout en minimisant les effets hors-cible 7. Alternativement, analogue à des stratégies utilisées pour ARNi, nous suggérons que les différentes paires de sgRNAs avec non-chevauchement des séquences de protospacer être utilisés pour démontrer que le phénotype observé est le résultat de la CRISPR / modification Cas9 sur cible par opposition à un potentiel hors cible effet. Une solution pratique serait de concevoir au moins deux paires de ARNsg adjacentes mais non-chevauchement de sorte qu&#39;un seul ensemble d&#39;amorces de dépistage (voir étape 2) peut être utilisé pour plusieurs paires de ARNsg (figure 1A). Par ailleurs, en complément d&#39;une lignée cellulaire de suppression en réintroduisant la séquence manquante et / ou gène interrompu peut justifier d&#39;un lien de causalité entreune délétion génomique et le phénotype donné. Pour les biologistes qui travaillent avec des systèmes modèles cellulaire, l&#39;ARNi a représenté un outil puissant pour la génomique fonctionnelle. Cependant, les limites de cette approche ont inclus une réduction incomplète des niveaux de transcrits d&#39;ARNm cible, l&#39;hétérogénéité de l&#39;effet des réactifs indépendants ciblant le même gène, et connus des effets hors-cible y compris les effets axées sur les semences et les semences non-40-42. stratégies d&#39;édition du génome promettent de répondre à bon nombre de ces préoccupations et représentent une approche passionnante, complémentaire de perturbation génétique prospective 8,36,37. En outre, l&#39;édition du génome permet pour l&#39;étude des éléments non codants génétiques d&#39;une manière pas possible par ARNi et stimulant par un ciblage approches conventionnelles 25. Nous encourageons génération de suppressions génomiques par CRISPR / Cas9 comme une méthode robuste et spécifique pour produire et caractériser les allèles de perte de fonction.

Recent advances in genome engineering technology have allowed for unprecedented opportunities for site-specific modification of the genome. This technology may be utilized to investigate the function of genes and regulatory elements via prospective genetic perturbation. Zinc finger nucleases (ZFNs), transcription-activator like (TAL) effector nucleases (TALENs), and CRISPR/Cas9 RNA-guided nucleases each leverage customizable DNA specificity to localize a nuclease for the introduction of DSBs1&#8211;3. The resulting DSBs can be repaired by indel-forming NHEJ or by homology-directed repair (HDR) using a donor template4.
The CRISPR/Cas9 nuclease pathway, an adaptive immune system in prokaryotic cells5, has been recently adapted for mammalian genome engineering2,3. This tool has been demonstrated to be an inexpensive, efficient, and reliable genome engineering technique6. Briefly, a complex of Streptococcus pyogenes-derived Cas9 nuclease and a sgRNA achieve target recognition via Watson-Crick base-pairing with cognate genomic DNA sequences. sgRNAs include 20-mer sequences complementary to genomic sequences adjacent to an obligate protospacer adjacent motif (PAM) NGG. Cas9 induces a DSB at a predictable position within the target site. Additionally, variants of Cas9 with single-strand cleavage capacity or catalytic inactivity may be used to facilitate &#8220;nicking&#8221; or transcriptional regulation respectively7&#8211;9. CRISPR/Cas9 has been used for a wide range of applications including both knock-in and knockout10,11, large-scale genomic deletions12&#8211;14, pooled library screening for gene discovery15,16, genetic engineering of numerous model organisms10,11,17&#8211;21, as well as gene therapy22,23.
Here we describe a protocol for efficient deletion of desired genomic regions. The protocol includes CRISPR design, cloning, and delivery, as well as deletion, identification, and characterization. Genomic deletions can be generated by the introduction of two CRISPR sgRNAs with Cas9 to induce repair of the resultant two DSBs by NHEJ with deletion of the intervening segment. This strategy has been used to create deletions ranging from one kilobase to over one megabase12. Deletions can be informative for the study of genes and other genetic elements, either in isolation or in combination. There are several potential advantages of genomic deletions as compared to HDR or single-site small indel production. First, this method capitalizes on the high efficiency of NHEJ in many cellular contexts7. The high frequency of deletion limits the number of clones needed to be screened to identify informative clones. Deletion frequency is inversely related to deletion size. Biallelic deletion clones may be retrieved at frequencies at least as great as of probabilistic expectation12. Second, both monoallelic and biallelic deletions may be easily identified and distinguished by conventional PCR, simplifying the screening process. Strategies relying on small indels or point mutations may require RFLP, allele-specific PCR, T7EN1 cleavage assay, Sanger sequencing, RT-qPCR, or immunoblotting, which may be more laborious. Third, by removing a substantial portion of a gene or element of interest, a reliable loss-of-function allele may be obtained. In contrast, frameshift mutations in protein-coding sequences may not always induce nonsense-mediated decay, may produce a hypomorphic or neomorphic allele, or target an exon excluded from an alternate isoform24. Finally, deletions may be particularly revealing for the study of non-coding DNA such as regulatory elements since frameshift mutations as produced by single-site indels would not be relevant25.

<table border="0" cellpadding="0" cellspacing="0" width="842">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:388px;">Name of Material/ Equipment</td>
			<td style="width:168px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T4 Polynucleotide Kinase</td>
			<td>New England Biolabs</td>
			<td>M0201S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T4 DNA Ligase (with associated ligation buffer)</td>
			<td>New England Biolabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Adenosine 5&#39;-Triphosphate (ATP)</td>
			<td>New England Biolabs</td>
			<td>P0756S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BSA, Molecular Biology Grade</td>
			<td>New England Biolabs</td>
			<td>B9000S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BbsI Restriction Enzyme (with associated NEB Buffer 2.1)</td>
			<td>New England Biolabs</td>
			<td>R0539S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pSpCas9(BB) (pX330)</td>
			<td>Addgene</td>
			<td>42230</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">S.O.C. Medium</td>
			<td>Life Technologies</td>
			<td>15544-034</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BTX ECM 830</td>
			<td>Harvard Apparatus</td>
			<td>45-0052</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BTX Solution and 2mm Cuvettes</td>
			<td>Harvard Apparatus</td>
			<td>45-0803</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pmaxGFP Plasmid</td>
			<td>Lonza</td>
			<td>VPA-1003</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuickExtract DNA Extraction Solution</td>
			<td>Epicentre</td>
			<td>QE09050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HotStarTaq PCR Master Mix Kit</td>
			<td>Qiagen</td>
			<td>203443</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Zero Blunt PCR Cloning Kit</td>
			<td>Life Technologies</td>
			<td>K2700-20</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of genomic deletions in mammalian cell lines via crispr/cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

Le but de cette expérience était la suppression de PIM1 dans des cellules MEL. L&#39;utilisation de plusieurs paires sans chevauchement ARNsg (c.-séquences protospacer indépendants) peut aider à contrôler les effets hors-cible (figure 1A). Un phénotype uniforme serait plus susceptible de causer à un effet sur la cible par opposition à un effet hors cible commune partagée par plusieurs séquences de protospacer indépendants. Chaque paire conduirait à la production d&#39;un point d&#39;arrêt de suppression unique. Si rapprochés (à savoir, moins de n ~ 150 pb), les mêmes amorces de criblage peuvent être utilisés pour détecter des deletions produites par chaque ensemble de sgRNAs. Deletions génomiques peuvent perturber les gènes en utilisant des paires ARN sg en différents endroits par rapport au gène (figure 1B). Par exemple, la paire d&#39;ARN sg peut flanquer un gène de suppression de l&#39;ensemble de corps de gène; la paire pourrait être situé dans les deux exons, avec le potentiel pour créer indels cadre de lecture même si l&#39;un ou les deux alleles ne ont pas été supprimés; ou la paire peut flanquer un exon spécifique pour permettre la perturbation d&#39;une isoforme particulière. La stratégie de suppression utilisé pour PIM1 était de concevoir flanquant sgRNAs de supprimer le corps de l&#39;ensemble de gène, une deletion de 8 kb (figure 2). Cette stratégie a été choisi en partie en raison de la taille relativement petite du gène PIM1. Cet exemple montre une PAM (vert) sur le dessus (Watson) brin et une PAM sur le fond (Crick) brin; Cependant, l&#39;ORD est indépendante de la séquence de localisation PAM au brin haut ou en bas. ARNsg paires peuvent avoir des séquences PAM sur le brin supérieur, à la fois sur le brin inférieur, ou un de chaque. En utilisant le protocole décrit ci-dessus, deux ARN sg ont été conçus, clones dans le vecteur d&#39;expression de pX330, et délivrés à des cellules MEL par électroporation avec un rapporteur GFP (figure 2A). Le top 3% des cellules GFP + ont été triées deux jours post-électroporation et plaqué par clonage en dilution limite. ÉcranING amorces ont été conçues comme décrit dans l&#39;étape 2 et comme le montre la figure 2. conditions de PCR ont été optimisés en utilisant ADNg isolé à partir de cellules de la MEL parentales et de cellules triées &quot;en vrac&quot;. 10 jours après placage, ADNg a été isolé à partir de tous les clones et criblé pour deletion par PCR, qui a identifié de non-effacement, monoallélique et clones de deletion bialléliques selon les modèles de non-suppression (ND) et de suppression (D) amplicons (Figure 3) . Clones non deletion ont été identifiés comme ayant la présence de l&#39;amplicon non-suppression et l&#39;absence de l&#39;amplicon de suppression. Monoallélique clones ont été identifiés comme ayant la présence à la fois le non-retrait et des amplicons de deletion. Bialléliques clones ont été identifiés comme ayant l&#39;absence de l&#39;amplicon non-suppression et la présence de l&#39;amplicon de suppression. Pour cette suppression, 400 clones ont été criblés qui a identifié 126 clones de deletion monoalléliques et 32 ​​delet biallélique<html> clones ions (il est important de noter que la fréquence d&#39;effacement dépend de la taille de suppression 12). Clones de deletion bialléliques ont été sélectionnés et transférés dans des flacons de 8 ml de milieu. Après avoir laissé 5 jours d&#39;expansion, chaque clone a été testé à nouveau par PCR d&#39;ADNg pour confirmer la suppression et la suppression amplicons bialléliques ont été soumis à un séquençage Sanger pour identifier la deletion précise (figure 2B). Hétérogénéité dans les amplicons de suppression reflète imparfaite indel formation NHEJ réparation. Le séquençage de l&#39;allèle non-suppression dans des clones de deletion monoallelelic indels découverts dans la majorité des cas, ce qui démontre que même l&#39;allèle non-supprimée est fréquemment modifié par CRISPR / Cas9, ce qui peut être important pour les applications où les deux clones de deletion monoalléliques et bialléliques sont tenus . L&#39;ARN a été isolé à partir de clones de deletion bialléliques et analysé par RT-PCR quantitative pour confirmer la perte d&#39;expression PIM1 (figure 4). moyens &quot;&gt; <img alt="Figure 1" src="/files/ftp_upload/52118/52118fig1highres.jpg" /> Figure 1. Schéma des stratégies de suppression possibles. (A) Deux exemples Paires ARNsg pour suppressions génomiques (en noir et orange, respectivement). Les flèches bleues indiquent les amorces pour détecter l&#39;amplicon non-suppression et flèches rouges indiquent les amorces pour détecter l&#39;amplicon de suppression. ARNsg positions 17 et 18 sont mis en évidence en rouge et bleu au ARNsg-Sites-A 1 / A 2 et sont mis en évidence en violet et orange au ARNsg-Sites-B 1 / B 2 avec une ligne rouge indiquant le clivage Cas9 prédit entre les positions 17 et 18. (B) clivages CRISPR dirigée sont représentées par des lignes verticales noires. Les flèches bleues indiquent les amorces pour détecter l&#39;amplicon non-suppression et flèches rouges indiquent les amorces pour détecter l&#39;amplicon de suppression. <a href="https://www.jove.com/files/ftp_upload/52118/52118fig1large.jpg" target="_blank">Se il vous plaît cliquer ici pour voir</a>une version plus grande de cette figure. <img alt="Figure 2" src="/files/ftp_upload/52118/52118fig2highres.jpg" /> Figure 2. Stratégie pour produire et détecter la suppression de PIM1, y compris le séquençage suppression et allèles non-suppression. (A) Schéma de la stratégie de dépistage par PCR pour identifier PIM1 clones de deletion. Une paire d&#39;amorces est située à l&#39;intérieur de suppression (flèches bleues) et une paire d&#39;amorces extérieure est localisé à la suppression (flèches rouges). ARNsg séquences (séquences protospacer) sont indiqués en violet. Les lignes verticales rouges indiquent le clivage prédit Cas9 entre les positions 17 et 18 de la séquence ARN sg. (B) un séquençage Sanger révèle la formation d&#39;insertion-délétion au niveau du site de reconnaissance d&#39;ARN sg. ARNsg séquences sont présentés dans les séquences pourpres et PAM en vert. les événements de suppression sont shpropre par un nombre équivalent de marques de bord et insertions sont surlignés en bleu. Lignes rouges verticales indiquent prédit site de clivage, entre les positions 17 et 18 de la ARNsg. <a href="https://www.jove.com/files/ftp_upload/52118/52118fig2large.jpg" target="_blank">Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.</a> <img alt="Figure 3" src="/files/ftp_upload/52118/52118fig3highres.jpg" /> Figure 3. Gel Représentant identification non-suppression, monoallélique, et les clones bialléliques. Pour chaque clone, la voie de gauche représente la non-suppression amplicon (&quot;ND&quot; en bleu) et la voie de droite représente l&#39;amplicon de suppression (&quot;D&quot; en rouge ). Les clones individuels sont séparés par des lignes en pointillés. Les trois clones de deletion monoalléliques sont clones 5, 6 et 2. Les trois clones de deletion bialléliques sont des clones 15, 17 et 13. Comme on le voit dans les données de séquençage, la bande de suppression pour c<html> seul 13 a une taille plus petite en raison de grandes deletions à la jonction de deletion. <img alt="Figure 4" src="/files/ftp_upload/52118/52118fig4highres.jpg" /> Figure 4. Perte d&#39;expression PIM1 en clones de deletion bialléliques. PIM1 d&#39;expression a été calculé pour deux clones de deletion bialléliques par RT-qPCR. Les données ont été normalisé à l&#39;aide de la Gapdh 2 - Méthode ACt. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> Protospacer Séquence </td></tr><tr><td> ARN sg-A </td><td> TAGGAAAATGACTCGTCACT 5&#39;-3 &#39; </td></tr><tr><td> ARNsg-B </td><td> GTCTATCCTATCTCGATAAA 5&#39;-3 &#39; </td></tr></tbody></table> Tableau 1. 20-mer séquences protospacer pour deux ARNsg la suppression de PIM1. 543 &quot;&gt; <tbody><tr height="23"><td height="23" style="height:23px;width:101px;"></td><td style="width:443px;"> Complément inverse de Protospacer Séquence </td></tr><tr height="23"><td height="23" style="height:23px;"> ARNsg-A-rc </td><td> AGTGACGAGTCATTTTCCTA 5&#39;-3 &#39; </td></tr><tr height="23"><td height="23" style="height:23px;"> ARNsg-B-rc </td><td> TTTATCGAGATAGGATAGAC 5&#39;-3 &#39; </td></tr></tbody></table> Tableau 2. complément inverse des séquences d&#39;protospacer pour les deux ARN sg dans le tableau 1. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> Séquences </td></tr><tr><td> ARN sg-A </td><td> CACCTAGGAAAATGACTCGTCACT 5&#39;-3 &#39; </td></tr><tr><td> ARNsg-A-rc </td><td> AAACAGTGACGAGTCATTTTCCTA 5&#39;-3 &#39; </td></tr><tr><td> ARNsg-B </td><td> CACCGTCTATCCTATCTCGATAAA 5&#39;-3 &#39; </td></tr><tr><td> sgRNA-B-rc </td><td> AAACTTTATCGAGATAGGATAGAC 5&#39;-3 &#39; </td></tr></tbody></table> Tableau 3. séquences Protospacer et leur complément inverse avec &quot;CACC» et «AAAC» ajoutés pour le clonage dans le vecteur pX330 en utilisant l&#39;enzyme de restriction Bbsl. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> Séquences </td></tr><tr><td> ARN sg-A </td><td> CACCGTAGGAAAATGACTCGTCACT 5&#39;-3 &#39; </td></tr><tr><td> ARNsg-A-rc </td><td> AAACAGTGACGAGTCATTTTCCTAC 5&#39;-3 &#39; </td></tr><tr><td> ARNsg-B </td><td> CACCGTCTATCCTATCTCGATAAA 5&#39;-3 &#39; </td></tr><tr><td> ARNsg-B-rc </td><td> AAACTTTATCGAGATAGGATAGAC 5&#39;-3 &#39; </td></tr></tbody></table> Tableau 4. ARN sg expression à partir du promoteur U6 du vecteur pX330 est améliorée par l&#39;addition d&#39;un nucléotide G après la séquence CACC et avant le20-mer. L&#39;addition d&#39;un nucléotide G supplémentaire nécessite l&#39;addition d&#39;un nucléotide C à l&#39;extrémité 3 &#39;du complément d&#39;oligo inverse (par exemple, ARN sg-A). Cependant, si la première position de la 20-mer (séquence d&#39;protospacer) est déjà un nucleotide G, il ne est pas nécessaire d&#39;ajouter un autre G (par exemple, ARN sg-B) et pas besoin d&#39;ajouter C vers la position finale du complément inverse oligo.

Watch this Scientific Journal Video about Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9 at JoVE.com

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

Génération de suppressions génomiques dans des lignées cellulaires de mammifères via CRISPR / Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

generation-of-genomic-deletions-in-mammalian-cell-lines-via-crisprcas9

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 2

Analyzing Gene Expression and Function

SCIENTISTS IN ACTION

MISSION esiRNA for RNAi Screening in Mammalian Cells

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as small interfering RNAs (siRNAs). The short double-stranded RNAs originate from longer double stranded precursors by the activity of Dicer, a protein of the RNase III family of endonucleases. The resulting fragments are components of the RNA-induced silencing complex (RISC), directing it to the cognate target mRNA. RISC cleaves the target mRNA thereby reducing the expression of the encoded protein1,2,3. RNAi has become a powerful and widely used experimental method for loss of gene function studies in mammalian cells utilizing small interfering RNAs.
Currently two main methods are available for the production of small interfering RNAs. One method involves chemical synthesis, whereas an alternative method employs endonucleolytic cleavage of target specific long double-stranded RNAs by RNase III in vitro. Thereby, a diverse pool of siRNA-like oligonucleotides is produced which is also known as endoribonuclease-prepared siRNA or esiRNA. A comparison of efficacy of chemically derived siRNAs and esiRNAs shows that both triggers are potent in target-gene silencing. Differences can, however, be seen when comparing specificity. Many single chemically synthesized siRNAs produce prominent off-target effects, whereas the complex mixture inherent in esiRNAs leads to a more specific knockdown10.
In this study, we present the design of genome-scale MISSION esiRNA libraries and its utilization for RNAi screening exemplified by a DNA-content screen for the identification of genes involved in cell cycle progression. We show how to optimize the transfection protocol and the assay for screening in high throughput. We also demonstrate how large data-sets can be evaluated statistically and present methods to validate primary hits. Finally, we give potential starting points for further functional characterizations of validated hits.

Here we use a human esiRNA library in a high-throughput screen for genes involved in cell division. We demonstrate how to set up and conduct an esiRNA screens, as well as how to analyze and validate the results.

EsiRNA MISSION pour le dépistage de l&#39;ARNi dans les cellules de mammifères

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as ...

Recherche

Biologie

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be produced to contain any desired DNA or RNA sequence and can be prepared to include a wide variety of base and sugar modifications. Moreover, oligos can be designed to mimic specific nucleic acid alterations and thus, can serve as important tools to investigate effects of DNA damage and mechanisms of repair. We found that Thermo Scientific Dharmacon RNA-containing oligos with a length between 50 and 80 nucleotides can be particularly suitable to study, in vivo, functions and consequences of chromosomal RNA/DNA hybrids and of ribonucleotides embedded into DNA. RNA/DNA hybrids can readily form during DNA replication, repair and transcription, however, very little is known about the stability of RNA/DNA hybrids in cells and to which extent these hybrids can affect the genetic integrity of cells. RNA-containing oligos, therefore, represent a perfect vector to introduce ribonucleotides into chromosomal DNA and generate RNA/DNA hybrids of chosen length and base composition. Here we present the protocol for the incorporation of ribonucleotides into the genome of the eukaryotic model system yeast /Saccharomyces cerevisiae/. Yet, our lab has utilized Thermo Scientific Dharmacon RNA-containing oligos to generate RNA/DNA hybrids at the chromosomal level in different cell systems, from bacteria to human cells.

This work shows how to form an RNA/DNA hybrid at the chromosomal level and reveal transfer of genetic information from RNA to genomic DNA in yeast cells.

Génération d&#39;ADN / ARN hybrides d&#39;ADN génomique par la transformation en utilisant l&#39;ARN contenant Oligonucléotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

Le processus de monstre vert pour la génération de souches de levure portant la délétion de gènes multiples

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Generation of Stable Human Cell Lines with Tetracycline-inducible (Tet-on) shRNA or cDNA Expression

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon1, to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells2,3. In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here.
Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells4, vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs5-11. However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.12 modified the shRNA expression vector pSUPER5 by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest.
Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome13,14 and apoptosis signaling15,16. In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

Generation of Stable Human Cell Lines with Tetracycline-inducible Tet-on shRNA or cDNA Expression

A rapid and simple way to generate human cell lines with inducible and reversible cDNA overexpression or shRNA-mediated knock-down of the gene of interest. This method enables researchers to reliably and highly reproducibly manipulate cell lines that are difficult to alter by transient transfection methods or conventional knockdown/knockout strategies.

Génération de lignées stables de cellules humaines avec inductible par la tétracycline (Tet-on) shRNA ou expression d&#39;ADNc

A major approach in  the field of mammalian cell biology is the manipulation of the expression of  genes of interest in selected cell lines, with the aim ...

Anaerobic Growth and Maintenance of Mammalian Cell Lines

Most mucosal surfaces along with the midpoints in tumors and stem cell niches are geographic areas of the body that are anoxic. Previous studies show that the incubation in normoxic (5% CO2 in air) or hypoxic (low oxygen levels) conditions followed by an anoxic incubation (an absence of free oxygen) results in limited viability (2&#8211;3 days). A novel methodology was developed that enables an anoxic cell cultivation (for at least 17 days; the maximum time tested). The most critical aspect of this methodology is to ensure that no oxygen is introduced into the system. This is obtained by the degassing of media, and by flushing tubes, dishes, flasks, and pipettes with an anaerobic gas mixture (H2, CO2, N2) followed by permitting the materials to equilibrate to the anoxic (non-oxygen) environment prior to usage.&#160;Additional care must be exercised when acquiring photomicrographs to ensure that the micrographs obtained do not contain artifacts. In the absence of oxygen, cell morphology is significantly altered. Two distinct morphotypes are noted for all anaerobically-grown cells. The ability to grow and maintain mammalian cells in the absence of oxygen can be applied to the analysis of cell physiology, polymicrobial interactions, and the characterization of biosynthetic pathways for novel cancer drug development.

Here, we describe a new method that enables the anaerobic long-term cultivation of established cell lines. The maximum survival time that was tested is 17 days. This method is suitable for the testing of cytotoxic agents and exploring the physiology of anoxically replicating cells.

La croissance anaérobie et l’entretien de lignées cellulaires de mammifères

Most mucosal surfaces along with the midpoints in tumors and stem cell niches are geographic areas of the body that are anoxic. Previous studies show that ...

Silencing the Spark: CRISPR/Cas9 Genome Editing in Weakly Electric Fish

Electroreception and electrogenesis have changed in the evolutionary history of vertebrates. There is a striking degree of convergence in these independently derived phenotypes, which share a common genetic architecture. This is perhaps best exemplified by the numerous convergent features of gymnotiforms and mormyrids, two species-rich teleost clades that produce and detect weak electric fields and are called weakly electric fish. In the 50 years since the discovery that weakly electric fish use electricity to sense their surroundings and communicate, a growing community of scientists has gained tremendous insights into evolution of development, systems and circuits neuroscience, cellular physiology, ecology, evolutionary biology, and behavior. More recently, there has been a proliferation of genomic resources for electric fish. Use of these resources has already facilitated important insights with regards to the connection between genotype and phenotype in these species. A major obstacle to integrating genomics data with phenotypic data of weakly electric fish is a present lack of functional genomics tools. We report here a full protocol for performing CRISPR/Cas9 mutagenesis that utilizes endogenous DNA repair mechanisms in weakly electric fish. We demonstrate that this protocol is equally effective in both the mormyrid species Brienomyrus brachyistius and the gymnotiform Brachyhypopomus gauderio by using CRISPR/Cas9 to target indels and point mutations in the first exon of the sodium channel gene scn4aa. Using this protocol, embryos from both species were obtained and genotyped to confirm that the predicted mutations in the first exon of the sodium channel scn4aa were present. The knock-out success phenotype was confirmed with recordings showing reduced electric organ discharge amplitudes when compared to uninjected size-matched controls.

Here, a protocol is presented to produce and rear CRISPR/Cas9 genome knockout electric fish. Outlined in detail are the required molecular biology, breeding, and husbandry requirements for both a gymnotiform and a mormyrid, and injection techniques to produce Cas9-induced indel F0 larvae.

Electroreception and electrogenesis have changed in the evolutionary history of vertebrates. There is a striking degree of convergence in these ...

Genome Engineering of Primary Human B Cells Using CRISPR/Cas9

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make attractive candidates for cell-based therapies because of their ease of isolation from peripheral blood, their ability to expand in vitro, and their longevity in vivo. Additionally, their normal biological function&#8212;to produce large amounts of antibodies&#8212;can be utilized to express very large amounts of a therapeutic protein, such as a recombinant antibody to fight infection, or an enzyme for the treatment of enzymopathies. Here, we provide detailed methods for isolating primary human B cells from peripheral blood mononuclear cells (PBMCs) and activating/expanding isolated B cells in vitro. We then demonstrate the steps involved in using the CRISPR/Cas9 system for site-specific KO of endogenous genes in B cells. This method allows for efficient KO of various genes, which can be used to study the biological functions of genes of interest. We then demonstrate the steps for using the CRISPR/Cas9 system together with a recombinant, adeno-associated, viral (rAAV) vector for efficient site-specific integration of a transgene expression cassette in B cells. Together, this protocol provides a step-by-step engineering platform that can be used in primary human B cells to study biological functions of genes as well as for the development of B-cell therapeutics.

Here we provide a detailed, step-by-step protocol for CRISPR/Cas9-based genome engineering of primary human B cells for gene knockout (KO) and knock-in (KI) to study biological functions of genes in B cells and the development of B-cell therapeutics.

Ingénierie génomique des cellules B humaines primaires à l’aide de CRISPR/Cas9

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make ...

TGF-&#946;-mediated Endothelial to Mesenchymal Transition (EndMT) and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing

In response to specific external cues and the activation of certain transcription factors, endothelial cells can differentiate into a mesenchymal-like phenotype, a process that is termed endothelial to mesenchymal transition (EndMT). Emerging results have suggested that EndMT is causally linked to multiple human diseases, such as fibrosis and cancer. In addition, endothelial-derived mesenchymal cells may be applied in tissue regeneration procedures, as they can be further differentiated into various cell types (e.g., osteoblasts and chondrocytes). Thus, the selective manipulation of EndMT may have clinical potential. Like epithelial-mesenchymal transition (EMT), EndMT can be strongly induced by the secreted cytokine transforming growth factor-beta (TGF-&#946;), which stimulates the expression of so-called EndMT transcription factors (EndMT-TFs), including Snail and Slug. These EndMT-TFs then up- and downregulate the levels of mesenchymal and endothelial proteins, respectively. Here, we describe methods to investigate TGF-&#946;-induced EndMT in vitro, including a protocol to study the role of particular TFs in TGF-&#946;-induced EndMT. Using these techniques, we provide evidence that TGF-&#946;2 stimulates EndMT in murine pancreatic microvascular endothelial cells (MS-1 cells), and that the genetic depletion of Snail using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9)-mediated gene editing, abrogates this phenomenon. This approach may serve as a model to interrogate potential modulators of endothelial biology, and can be used to perform genetic or pharmacological screens in order to identify novel regulators of EndMT, with potential application in human disease.

TGF-&amp;#946;-mediated Endothelial to Mesenchymal Transition EndMT and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing

We describe methods to investigate TGF-&#946;2-induced EndMT in endothelial cells by observing cell morphology changes and examining the expression EndMT-related marker changes using immunofluorescence staining. CRISPR/Cas9 gene editing was described and used to deplete the gene encoding Snail to investigate its role in TGF-&#946;2-induced EndMT.

Transition endothéliale à mésenchymateuse médiée par TGF-β (EndMT) et évaluation fonctionnelle des effecteurs EndMT à l’aide de l’édition du gène CRISPR/Cas9

In response to specific external cues and the activation of certain transcription factors, endothelial cells can differentiate into a mesenchymal-like ...

Construction of Homozygous Mutants of Migratory Locust Using CRISPR/Cas9 Technology

The migratory locust, Locusta migratoria, is not only one of the worldwide plague locusts that caused huge economic losses to human beings but also an important research model for insect metamorphosis. The CRISPR/Cas9 system can accurately locate at a specific DNA locus and cleave within the target site, efficiently introducing double-strand breaks to induce target gene knockout or integrate new gene fragments into the specific locus. CRISPR/Cas9-mediated genome editing is a powerful tool for addressing questions encountered in locust research as well as a promising technology for locust control. This study provides a systematic protocol for CRISPR/Cas9-mediated gene knockout with the complex of Cas9 protein and single guide RNAs (sgRNAs) in migratory locusts. The selection of target sites and design of sgRNA are described in detail, followed by in vitro synthesis and verification of the sgRNAs. Subsequent procedures include egg raft collection and tanned-egg separation to achieve successful microinjection with low mortality rate, egg culture,&#160;preliminary estimation of the mutation rate, locust breeding as well as detection, preservation, and passage of the mutants to ensure population stability of the edited locusts. This method can be used as a reference for CRISPR/Cas9 based gene editing applications in migratory locusts as well as in other insects.

This study provides a systematically optimized procedure of CRISPR/Cas9 ribonuclease-based construction of homozygous locust mutants as well as a detailed method for cryopreservation and resuscitation of the locust eggs.

Construction de mutants homozygotes du criquet migrateur à l’aide de la technologie CRISPR/Cas9

The migratory locust, Locusta migratoria, is not only one of the worldwide plague locusts that caused huge economic losses to human beings but also an ...

CRISPR/Cas9 Gene Editing of Hematopoietic Stem and Progenitor Cells for Gene Therapy Applications

CRISPR/Cas9 is a highly versatile and efficient gene-editing tool adopted widely to correct various genetic mutations. The feasibility of gene manipulation of hematopoietic stem and progenitor cells (HSPCs) in vitro makes HSPCs an ideal target cell for gene therapy. However, HSPCs moderately lose their engraftment and multilineage repopulation potential in ex vivo culture. In the present study, ideal culture conditions are described that improves HSPC engraftment and generate an increased number of gene-modified cells in vivo. The current report displays optimized in vitro culture conditions, including the type of culture media, unique small molecule cocktail supplementation, cytokine concentration, cell culture plates, and culture density. In addition to that, an optimized HSPC gene-editing procedure, along with the validation of the gene-editing events, are provided. For in vivo validation, the gene-edited HSPCs infusion and post-engraftment analysis in mouse recipients are displayed. The results demonstrated that the culture system increased the frequency of functional HSCs in vitro, resulting in robust engraftment of gene-edited cells in vivo.

The present protocol describes an optimized hematopoietic stem and progenitor cell (HSPC) culture procedure for the robust engraftment of gene-edited cells in vivo.