Name: generation of genomic deletions in mammalian cell lines via crispr/cas9
Uploaded: 2015-01-03T14:00:00
Duration: 9 min 40 s
Description: Watch this Scientific Journal Video about Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9 at JoVE.com

Thanks to Jason Wright for suggesting the Golden Gate Assembly cloning strategy and Katherine Helming and members of Orkin lab, particularly Jian Xu, Guoji Guo, Elenoe Smith, and Partha Das for helpful discussions. This work was supported by NIH R01HL032259 and P30DK049216 (Center of Excellence in Molecular Hematology) to S.H.O. and NIDDK K08DK093705 to D.E.B.

1. Projeto CRISPR <ol><li> Projeto sgRNAs manualmente ou através de ferramentas on-line disponíveis gratuitamente 7. Use essas ferramentas para ajudar a identificar as sequências de guia que minimizem partidas genômicas idênticas ou quase partidas para reduzir o risco de clivagem longe de sites de destino (efeitos fora do alvo). Certifique-se de que as sequências de guia consistem de um 20-mer (&quot;sequência protospacer&quot;) a montante de um &quot;NGG&quot; sequência (&quot;protospacer motivo adjacente&quot; ou PAM), no sítio de reconhecimento genómico. NOTA: A Figura 1 descreve as possíveis estratégias de exclusão para genes e elementos não-codificantes. Para a criação de um nocaute gene, duas sgRNA localizados dentro exons irá enriquecer clones de deleção mesmo monoalélicos para perda de função. Isto é devido à alta freqüência de indels formados em alelos que não são apagados 12, que são susceptíveis de causar mutações que levam ao quadro de leitura mediada por nonsense decadência do mRNA (Figura 1B). </li><li> Use aexemplo orienta para a supressão pretendida do Pim1 no rato (Mus musculus; Tabela 1, Figura 2A). NOTA: Neste exemplo, de sgRNA-A seqüência protospacer e PAM acontecer cair na cadeia de baixo (Crick), enquanto seqüência protospacer de sgRNA-B e PAM cair no topo (Watson) cadeia (Figura 2A). No entanto, a DSB ocorrerá independentemente da orientação da sequência protospacer / PAM em relação à cadeia de topo ou de fundo. </li><li> Determine o complemento reverso (rc) de cada seqüência de guia. Exemplo sequências do complemento reverso do Pim1 sgRNA a partir da Tabela 1 encontram-se na Tabela 2. </li><li> Obter 24 ou 25-mer oligos para cada guia e seu complemento inverso associado incluindo nucleotídeos adicionais para fins de clonagem e expressão. NOTA: Aqui vamos discutir o uso do pSpCas9 (BB) plasmídeo (pX330) (Addgene plasmídeo ID 42230). Este plasmídeo permite a simultâneaexpressão de sgRNA e SpCas9, mas não contém marcadores para seleção 7. Outras construções podem ser utilizadas, tais como pX458 (Addgene plasmídeo ID 48138) ou pX459 (Addgene plasmídeo ID 48139), que incluem GFP e puromicina como marcadores seleccionáveis, respectivamente, ou construções, nas quais múltiplos sgRNAs podem ser expressas a partir de um único plasmídeo. <ol><li> Adicionar &quot;CACC&quot; antes da sequência guia de 20-mer e &quot;AAAC&quot; antes complemento inverso da guia para clonagem no vector utilizando enzimas de restrição pX330 Bbsl (Tabela 3). </li><li> Adicionar um nucleótido G após a sequência CACC e antes do 20-mer se a primeira posição do 20-mer é não G. sgRNA expressão a partir do promotor U6 do vector pX330 é aumentada pela inclusão de um nucleótido G após a sequência CACC . Adicionar um C na extremidade do oligo complemento inverso 3 &#39;(por exemplo, sgRNA-A na Tabela 4). Os oligos resultantes seriam os oligos 25-mer. </li><li> Comocada vez, se a primeira posição do 20-mer (sequência protospacer) é G, não se adicionar outro G (por exemplo, sgRNA-B na Tabela 4) e não acrescentam C para a posição final do oligo complemento inverso. Neste caso, os oligonucleótidos resultantes seriam os oligos 24-mer (Tabela 4). </li></ol></li></ol> 2. Projeto de Exclusão Primers de Triagem <ol><li> Projeto um conjunto de primers internos para a sequência a ser excluído (&quot;não-eliminação band&quot;) e outro conjunto de primers a montante ea jusante dos locais sgRNA de clivagem (&quot;supressão da banda&quot;; Figuras 1-2). Na ausência de uma eliminação, a &quot;eliminação da banda&quot; é muitas vezes demasiado grandes para amplificar eficientemente. Normalmente, utilizam primers pelo menos 100 pb a partir do local de clivagem previsto para garantir a detecção não seria impactado por uma pequena indel no site de destino do sgRNA. <ol><li> Projete primers adicionais para analisar de cicatrizes (pequenas indels produzidos na sgRNA cleavage local sem a exclusão intencional). Use um par de primers para a frente e de acompanhamento de cada site de destino sgRNA (dentro de 150-350 bp) reverter para amplificar o site de destino sgRNA para examinar para cicatrizes. Isto pode ser útil para caracterizar os alelo não suprimido em clones de deleção monoalélicos. </li></ol></li><li> Para pequenas deleções (como a &quot;eliminação da banda&quot; ainda pode amplificar), resolver amplicões sobre um gel de agarose para determinar se o tamanho é consistente com a presença ou ausência da eliminação. Para esta abordagem, os iniciadores internos descritos no passo 2.1 pode ser omitido. </li></ol> 3. CRISPR Clonagem <ol><li> Anele e phosphorylate oligos. <ol><li> Oligos Ressuspender a uma concentração de 100 uM em ddH 2 O. </li><li> Prepare uma mistura de 10 mL de reação para cada guia e seu complemento inverso: 1,0 ul sgRNA de 24 ou 25 oligo-mer (100 M; veja o passo 1.4), 1,0 ul sgRNA de 24 ou 25-mer reverter complementaçãot oligo (100 uM; ver passo 1.4), 1,0 ul de 10x tampão de T4 Ligadura, 6,5 ul ddH2O, e 0,5 jil de quinase de polinucleótidos de T4 (PNK) (10.000 U / ml). NOTA: fosforilada oligos podem ser encomendados em seu lugar. Por esta abordagem, a utilização de T4 PNK é omitido. </li><li> Hibridar num termociclador utilizando os seguintes parâmetros: 37 ° C durante 30 min; 95 ° C durante 5 min e, em seguida, rampa até 25 ° C a 5 ° C / min. </li><li> Diluir 1:10 em oligos ddH2O (por exemplo, 1,0 ul recozido oligos + 9,0 ul ddH2O para obter uma concentração de 1 | iM). </li></ol></li><li> Oligos recozidos ligar para pX330 usando uma estratégia de clonagem montagem Golden Gate 26. <ol><li> Prepara-se uma mistura reaccional de 50 ul: 100 ng de vector circular pX330, 1,0 ul oligos hibridados (1 uM; ver passo 3.1.4), tampão de enzima de restrição de 5,0? L (10x), 4,0 mL (20 L) da enzima de restrição Bbsl (5,000 L / ml), 5,0 μl de ATP (10 mM), 0,25 ul (5 ug) de BSA (20 mg / ml), 0,375 ul (750 U) de ligase de ADN de T4 (2.000.000 U / ml), e H 2 O para um volume final de 50 ul. Esta reacção pode ser reduzida para um volume final menor, se necessário. </li><li> Amostras em um termociclador utilizando os seguintes parâmetros: Ciclos 1-20 (37 ° C durante 5 min, 20 ° C por 5 min); Ciclo 21 (80 ° C durante 20 min). Estas condições de ciclismo permitir que para a digestão e ligação de ocorrer em uma reacção (ver passo 3.2). </li><li> Transformar 10 ul de DH5a de E. células de E. coli com 1 ul de reacção (a partir de 3.2.1 - 3.2.2). </li><li> Placa para um caldo de lisogenia (LB) placa de agar com 100 ug / ml de ampicilina e incubar O / N a 37 ° C. </li></ol></li><li> Escolha 2-3 colônias e inocular em uma cultura mini-prep. <ol><li> Executar mini-prep para cada amostra e sequenciar cada colônia usando um U6 promotor primer forward: CGTAACTTGAAAGTATTTCGATTTCTTGGC. Este ar éiniciador de sequenciação epresentative; Podem ser utilizados outros iniciadores de f lanqueamento. </li></ol></li><li> Escolha uma colônia verificou-sequência e inocular em uma cultura maxi-prep. Prep tamanho pode ser dimensionado com base no rendimento de DNA necessária. </li><li> Execute maxi-prep para cada CRISPR / Cas9 construto. </li></ol> 4. CRISPR transfecção em células de interesse NOTA: Este protocolo envolve a entrega de CRISPR plasmídeos / Cas9 por eletroporação 27. Este protocolo é descrito em detalhe por células de eritroleucemia murina (MEL), uma linha de células em suspensão. O meio de cultura consiste em todas as etapas de DMEM suplementado com 2% de penicilina / estreptomicina e 1% de L-glutamina, que é usado para células MEL. No entanto, a transfecção transiente de CRISPR / Cas9 plasmídeos podem ser adaptadas com sucesso para vários tipos de células usando as condições de cultura preferidas e estratégias de transfecção para cada tipo de célula. Enquanto as células são células MEL suspensão, instruções para células aderentes hav também foram incluídos. <ol><li> Certifique-se de há 2 x 10 6 células por par CRISPR. Ressuspender 2 x 10 6 células em 100 ul de solução de electroporação e adicionar à cuvete de electroporação. <ol><li> Adicionam-se 5 ug de cada CRISPR / Cas9 construção (10 mg no total). Adicionar 0,5 ug de construção de expressão da GFP. </li></ol></li><li> Células electroporate com 250 volts para 5 ms em uma tina 2 milímetros utilizando um sistema de eletroporação. NOTA: Como alternativa, use outro método de transfecção como catiônica transfecção à base de lipossomas. Optimizar as condições de transfecção para cada linha de células com uma construção repórter para garantir a entrega plasmídeo robusto antes de tentar edição genoma. </li><li> Transfira imediatamente solução da tina em 1 ml de meio de cultura após a eletroporação. Minimizar o tempo entre a electroporação e a transferência da solução para os meios para melhorar a viabilidade celular. </li><li> Incubar a 30-37 ° C durante 24-72 horas. 30 ° C podem melhorar genomaedição eficiência, mas a 37 ° C é aceitável. </li></ol> 5. A fluorescência celular Activado Sorting (FACS) de células transfectadas <ol><li> Preparar células para FACS, filtrando-os através de um filtro de 50 um para um tubo de FACS. </li><li> FACS classificar o topo ~ 3% de células positivas para GFP, a fim de enriquecer em células que receberam níveis elevados de CRISPR / Cas9 constrói. </li><li> Placa células separadas individualmente em placas de fundo redondo de 96 poços, utilizando classificador ou por diluição limitante, utilizando a 30 células por 96 poços de fundo redondo de placa. Optimizar chapeamento do tipo de célula utilizada a diluição limitante, antes de realizar este passo de forma fiável para obter cerca de 30 células por placa de 96 poços. </li><li> Incluir 100 ul por poço de meio de cultura celular. </li><li> Para os restantes células classificadas (&quot;a granel&quot;) que não foram banhados, congelar metade das células para a futura chapeamento. Placa a outra metade para a seleção e validação de primer (veja o passo 6). NOTA: Este protocolo é para as células em suspensão. As células aderentes podem crescer como células individuais na placa de 96 poços de fundo plano ou em uma placa de 10 cm em baixa concentração de modo a que os clones derivados de uma única célula individual pode ser colhidos e transferido para um fundo de placa de 96 poços plana. </li><li> Permitir que as células a granel a incubar a 37 ° C durante 3-7 dias, e permitir que os clones a incubar a 37 ° C durante 7 - 14 dias. Estes tempos variar dependendo do tempo de duplicação da linhagem celular utilizada. NOTA: O tempo de incubação permite a proliferação de células suficientes para o rastreio de ADN genómico (ADNg) para a supressão pretendida por PCR (ver passos 6.1 e 7.1). As células têm a granel suficientemente proliferaram quando a concentração excede ~ 100.000 células / ml ou de células aderentes, as células chegaram a ~ 80% de confluência. Os clones foram suficientemente proliferaram uma vez macroscopicamente visível com ~ 2 mm de diâmetro. </li></ol> 6. Primer Validação e Triagem para CRISPR / Exclusão Cas9-Mediated <ol><li> Isolar gDNA de células classificadas parentais ea granel por ressuspensão pelotas de células progenitoras e granel, em 50 ml de solução de extração de DNA. NOTA: Geralmente ~ 100000 células são utilizadas para a extracção do ADN, embora uma grande variedade de números de células é aceitável. As células são classificadas em massa composta de uma população policlonal expostos a sgRNA-A e sgRNA-B (ver passo 5). O objectivo da seguinte PCR é validar iniciadores e verificar a presença de deleção genómica pretendido. </li><li> Execute amostra em termociclador e executar o seguinte programa: 65 ° C durante 6 min, 98 ° C por 2 min para extrair gDNA. Medir a concentração de ADN. NOTA: Enquanto os passos 6.1 e 6.2 recomendar um método eficiente para a extracção do ADN, qualquer método para o isolamento de DNA genómico pode ser utilizado para ser capaz de realizar PCR no passo 6.3. </li><li> Montar um 20 ul de PCR com os seguintes componentes: 10 ul de mistura de PCR, 2x 0,5 ul iniciador directo (10 _6; M), 0,5 ul de iniciador reverso (10 pM), 50-100 ng de gDNA, e H2O até 20 mL. Use os primers desenhados no passo 2 acima. Realizar PCR para &quot;não-eliminação band&quot; e &quot;eliminação band&quot; em reações distintas. NOTA: Numerosos polimerases podem ser utilizados no passo 6.3. <ol><li> As amostras são executados em um termociclador utilizando os seguintes parâmetros: 95 ° C durante 15 min, 35 ciclos de (95 ° C durante 30 seg, 60 ° C durante 1 min, 72 ° C durante 1 min), e 72 ° C durante 10 min . Otimizar as condições de PCR para cada par de primers desenhados com base em testes as células granel ordenados. </li></ol></li><li> Processar as amostras em gel de agarose a 2% a 10 V / cm, usando 1x Tris-acetato-EDTA-tampão (TAE). </li><li> Examinar amostras para detectar a presença / ausência de não-supressão e bandas de deleção (Figura 2). Considere multiplexing o &quot;apagamento&quot; e &quot;não-eliminação&quot; pares de primers de PCR em uma única reação. Otimizar multiplexingem uma população policlonal (isto é, grandes quantidades classificado células) antes do rastreio de clones individuais. É fundamental que a exclusão e não de exclusão amplicons ser facilmente resolvida com um gel de agarose para a multiplexação. </li></ol> 7. Screening CRISPR / Cas9 Clones para supressões e Clone Seleção <ol><li> No caso de células em suspensão, para transferir todos os clones de uma única placa de 96 poços que já contém 50 ul meios de cultura de células por poço, para um volume final de 150 ul. Isto facilita o rastreio, permitindo uma pipeta de canais múltiplos para ser usado para o restante das etapas no passo 7. <ol><li> Transferir 50 uL de cada poço (100 ul deixando em cada poço) para uma placa de 96 poços de PCR utilizando uma pipeta multicanal. </li><li> Centrífuga placa de PCR em 400 g durante 5 minutos e remover o sobrenadante sacudindo a placa PCR sobre uma pia. Adicionar 50 ml de solução de extração de DNA por poço e ressuspender. Continue até a etapa 7.3 para células em suspensão. </li&gt; </ol></li><li> Para as células aderentes, mídia aspirado. Adicionar 20 ul de 0,05% de tripsina-EDTA a cada poço com um clone presente. <ol><li> Ressuspender as células em 200 ul de meio. Pipeta misturar para separar células. </li><li> Placa de 100 ul cada um em duas placas de 96 poços de fundo plano separadas. Manter uma placa para permitir a crescer clones e utilizar a outra placa para cada clone para pesquisar deleções. </li><li> Adicionar um adicional de 100 ul a cada poço para um volume total de 200 ul. Espera 24-72 h, para permitir que as células cresçam. </li><li> Media aspirar. Adicionar 50 ul solução de extracção de ADN por poço, e ressuspender transferência para placa de 96 poços de PCR. Continue até a etapa 7.3. </li></ol></li><li> Extrai-se a partir de clones de ADNg. Executar amostra em termociclador: 65 ° C durante 6 minutos e 98 ° C durante 2 minutos para extrair ADNg. </li><li> Tela de cada clone utilizando os iniciadores de PCR e as condições de reacção optimizadas nas células granel mesma (ver passo 6). </li><li> Selecione a iden clonescadas com a eliminação desejado e passar para maior placa ou frasco para o crescimento. </li></ol> 8. Validação de Bialélicos Exclusão Clones <ol><li> A fim de caracterizar clones obtidos e validar um nocaute bem sucedido, avaliar clones no DNA, bem como os níveis de RNA e / ou proteína. <ol><li> Para avaliar o ADN, amplificam bandas supressão dos clones de deleção bialélicos com uma polimerase prova de leitura e clonar os produtos de amplificação (por exemplo, com um kit de clonagem de PCR) num vector de plasmídeo. Transformar o plasmídeo em DH5a de E. coli e células placa sobre placas de LB-agar com o antibiótico correspondente. Selecione várias colônias, mini-prep cada um, e submeter cada clone de sequenciamento Sanger para caracterizar cada eliminação alelo 28-30. A repetição do teste de PCR para a eliminação após a tela inicial garante que o clone correcto foi seleccionado e reprodutibilidade dos resultados. </li><li> Para avaliar o RNA, RT-qPCR realizar para gene a expressão do gene relevante 30,31. </li><li> Para avaliar a proteína, efectuar uma imunotransf erência usando um anticorpo contra a proteína relevante 33. </li></ol></li></ol>

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+human+genome+engineering+via+Cas9.">RNA-guided human genome engineering via Cas9.</a> Science. 339 (6121), 823-826 (2013).</li><li>Gaj, T., Gersbach, C. A., Barbas, C. F. Z. F. N., TALEN, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends in Biotechnology. 31 (7), 397-405 (2013).</li><li>Barrangou, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+provides+acquired+resistance+against+viruses+in+prokaryotes.">CRISPR provides acquired resistance against viruses in prokaryotes.</a> Science. 315, 1709-1712 (2007).</li><li>Ding, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+efficiency+of+human+pluripotent+stem+cell+genome+editing+through+replacing+TALENs+with+CRISPRs.">Enhanced efficiency of human pluripotent stem cell genome editing through replacing TALENs with CRISPRs.</a> Cell Stem Cell. 12 (4), 393-394 (2013).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+the+CRISPR-Cas9+system.">Genome engineering using the CRISPR-Cas9 system.</a> Nature Protocols. 8 (11), 2281-2308 (2013).</li><li>Ran, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double+nicking+by+RNA-guided+CRISPR+Cas9+for+enhanced+genome+editing+specificity.">Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity.</a> Cell. 154 (6), 1380-1389 (2013).</li><li>Larson, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+interference+(CRISPRi)+for+sequence-specific+control+of+gene+expression.">CRISPR interference (CRISPRi) for sequence-specific control of gene expression.</a> Nature Protocols. 8 (11), 2180-2196 (2013).</li><li>Yang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+generation+of+mice+carrying+reporter+and+conditional+alleles+by+CRISPR/Cas-mediated+genome+engineering.">One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering.</a> Cell. 154 (6), 1370-1379 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153 (4), 910-918 (2013).</li><li>Canver, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Genomic+Deletion+Efficiency+Mediated+by+CRISPR/Cas9+in+Mammalian+Cells.">Characterization of Genomic Deletion Efficiency Mediated by CRISPR/Cas9 in Mammalian Cells.</a> Journal of Biological Chemistry. 289 (31), 21312-21324 (2014).</li><li>Xiao, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosomal+deletions+and+inversions+mediated+by+TALENs+and+CRISPR/Cas+in+zebrafish.">Chromosomal deletions and inversions mediated by TALENs and CRISPR/Cas in zebrafish.</a> Nucleic Acids Research. 41 (14), e141 (2013).</li><li>Zhou, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+sgRNAs+facilitate+CRISPR/Cas9+mediated+mouse+genome+targeting.">Dual sgRNAs facilitate CRISPR/Cas9 mediated mouse genome targeting.</a> The FEBS Journal. , (2014).</li><li>Wang, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+screens+in+human+cells+using+the+CRISPR-Cas9+system.">Genetic screens in human cells using the CRISPR-Cas9 system.</a> Science. 343 (6166), 80-84 (2014).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Niu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Gene-Modified+Cynomolgus+Monkey+via+Cas9/RNA-Mediated+Gene+Targeting+in+One-Cell+Embryos.">Generation of Gene-Modified Cynomolgus Monkey via Cas9/RNA-Mediated Gene Targeting in One-Cell Embryos.</a> Cell. 156 (4), 836-843 (2014).</li><li>Guo, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+RNA/Cas9-mediated+genome+editing+in+Xenopus+tropicalis.">Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis.</a> Development. 141 (3), 707-714 (2014).</li><li>Xie, K., Yang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+genome+editing+in+plants+using+a+CRISPR-Cas+system.">RNA-guided genome editing in plants using a CRISPR-Cas system.</a> Molecular Plant. 6 (6), 1975-1983 (2013).</li><li>Waaijers, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9-targeted+mutagenesis+in+Caenorhabditis+elegans.">CRISPR/Cas9-targeted mutagenesis in Caenorhabditis elegans.</a> Genetics. 195 (3), 1187-1191 (2013).</li><li>Bassett, A. R., Liu, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9+and+Genome+Editing+in+Drosophila.">CRISPR/Cas9 and Genome Editing in Drosophila.</a> Journal of Genetics and Genomics. 41 (1), 7-19 (2014).</li><li>Schwank, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Repair+of+CFTR+by+CRISPR/Cas9+in+Intestinal+Stem+Cell+Organoids+of+Cystic+Fibrosis+Patients.">Functional Repair of CFTR by CRISPR/Cas9 in Intestinal Stem Cell Organoids of Cystic Fibrosis Patients.</a> Cell Stem Cell. 13 (6), 653-658 (2013).</li><li>Wu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correction+of+a+Genetic+Disease+in+Mouse+via+Use+of+CRISPR-Cas9.">Correction of a Genetic Disease in Mouse via Use of CRISPR-Cas9.</a> Cell Stem Cell. 13 (6), 659-662 (2013).</li><li>Lappalainen, T. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+and+genome+sequencing+uncovers+functional+variation+in+humans.">Transcriptome and genome sequencing uncovers functional variation in humans.</a> Nature. 501 (7468), 506-511 (2013).</li><li>Bauer, D. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Erythroid+Enhancer+of+BCL11A+Subject+to+Genetic+Variation+Determines+Fetal+Hemoglobin+Level.">An Erythroid Enhancer of BCL11A Subject to Genetic Variation Determines Fetal Hemoglobin Level.</a> Science. 342 (6155), 253-257 (2013).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method+with+high+throughput+capability.">A one pot, one step, precision cloning method with high throughput capability.</a> PloS One. 3, e3647 (2008).</li><li>Gehl, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation:+theory+and+methods,+perspectives+for+drug+delivery,+gene+therapy+and+research.">Electroporation: theory and methods, perspectives for drug delivery, gene therapy and research.</a> Acta Physiologica Scandinavica. 177, 437-447 (2003).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+Plasmid+DNA+from+Bacterial+Colonies+Using+the+Qiagen+Miniprep+Kit.">Purifying Plasmid DNA from Bacterial Colonies Using the Qiagen Miniprep Kit.</a> J. Vis. Exp. (6), e247 (2007).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Plasmid+DNA+into+E.+coli+Using+the+Heat+Shock+Method.">Transformation of Plasmid DNA into E. coli Using the Heat Shock Method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Finney, M., Nisson, P. E., Rashtchian, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+cloning+of+PCR+products.">Molecular cloning of PCR products.</a> Current Protocols in Molecular Biology. Chapter 15. (Unit 15.4), (2001).</li><li>Gordanpour, A., Nam, R. K., Sugar, L., Bacopulos, S., Seth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+Detection+in+Prostate+Tumors+by+Quantitative+Real-time+PCR+(qPCR).">MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR (qPCR).</a> J. Vis. Exp. (63), e3874 (2012).</li><li>Schularick, N. M., Clark, J. J., Hansen, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+Culture+of+Human+Vestibular+Schwannomas.">Primary Culture of Human Vestibular Schwannomas.</a> J. Vis. Exp. (89), e51093 (2014).</li><li>Eslami, A., Lujan, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Western+Blotting:+Sample+Preparation+to+Detection.">Western Blotting: Sample Preparation to Detection.</a> J. Vis. Exp. (44), e2359 (2010).</li><li>McVey, M., Lee, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MMEJ+repair+of+double-strand+breaks+(director&#8217;s+cut):+deleted+sequences+and+alternative+endings.">MMEJ repair of double-strand breaks (director&#8217;s cut): deleted sequences and alternative endings.</a> Trends in Genetics. 24 (11), 529-538 (2008).</li><li>Symington, L. S., Gautier, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-strand+break+end+resection+and+repair+pathway+choice.">Double-strand break end resection and repair pathway choice.</a> Annual Review of Genetics. 45, 247-271 (2011).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nature Biotechnology. 31 (9), 822-826 (2013).</li><li>Wu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+binding+of+the+CRISPR+endonuclease+Cas9+in+mammalian+cells.">Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells.</a> Nature Biotechnology. , (2014).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nature Biotechnology. 31 (9), 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32, 279-284 (2014).</li><li>Alem&#225;n, L. M., Doench, J., Sharp, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+Comparison+of+siRNA-induced+off-target+RNA+and+protein+effects.">a Comparison of siRNA-induced off-target RNA and protein effects.</a> RNA. 13 (3), 385-395 (2007).</li><li>Anderson, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+validation+of+the+importance+of+seed+complement+frequency+to+siRNA+specificity+Experimental+validation+of+the+importance+of+seed+complement+frequency+to+siRNA+specificity.">Experimental validation of the importance of seed complement frequency to siRNA specificity Experimental validation of the importance of seed complement frequency to siRNA specificity.</a> RNA. 14, 853-861 (2008).</li><li>Marine, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Common+seed+analysis+to+identify+off-target+effects+in+siRNA+screens.">Common seed analysis to identify off-target effects in siRNA screens.</a> Journal of Biomolecular Screening. 17 (3), 370-378 (2012).</li></ol>

We have no conflicts of interest related to this report.

O sistema CRISPR / Cas9 pode ser utilizada para gerar deleções genómicas de uma gama de tamanhos. Embora tenhamos observado que a freqüência de eliminação varia inversamente com respeito ao tamanho supressão pretendida, temos sido capazes de recuperar as supressões de até 1 Mb e exclusões de até 100 kb rotineiramente produzir vários clones bialï¿½icos excluído. Temos observado nenhuma perda na eficiência de introdução de eliminações sequencialmente numa linha de células. Esta estratégia pode ser usada para a criação de eliminação combinatória de numerosos genes e elementos. O processo de obtenção de clones de deleção bialélicos pode ser acelerada através da estimativa do número mínimo de clones necessário para ser rastreados com base no tamanho de exclusão para obter o número desejado de clones com deleção bialélico 12. A capacidade de obter supressão monoalélicos com a ausência de supressão bialélico na distribuição probabilística poderia indicar letalidade celular associada com a perda completa de função. Low frequency ou supressões ausentes poderia refletir uma série de cenários, incluindo pobre transfecção, sgRNAs ineficientes ou ineficientes primers de rastreio de PCR (devido à falta de um controle positivo para validar iniciadores de PCR para triagem de supressão). GFP + células pode ser utilizado como um substituto para a eficiência da transfecção (ver passo 5.2), de modo que uma redução nas células GFP + provavelmente reflecte pobre transfecção e uma resultante diminuição da eficácia de eliminação. Usando dois pares sgRNA diferentes com primers de triagem independentes podem ajudar a controlar para sgRNA ineficiente e triagem iniciadores de PCR e maximizar as chances de obtenção de clones de deleção bialï¿½icos. Celular de classificação para as células GFP + enriquece para alelos de eliminação. Embora este passo pode ser omitido, omissão, provavelmente, tornem indispensável a triagem mais clones para identificar aqueles com deleções monoalélicos ou bialï¿½icos. Na medida em que a eficiência de transfecção pode ser otimizado, esperaríamos eficiência edição genoma de ser reforçada. <p class = &quot;jove_content&quot;&gt; Os eventos NHEJ que fundamentam deleções e reparo local em resultado de uma série de alelos com uma variedade de indels nos locais alvo. O resultado é predominante pequenos ~ 1-10 pb inserções ou deleções mais comumente no local de clivagem sgRNA-dirigida (Figura 2B). Muitas vezes, estes alelos parecem ser o resultado de reparação à base de microhomology 34,35. Deve notar-se que a estratégia de detecção com base em PCR que descrevem não identificará inserções maiores ou mais complicados, deleções, inversões, ou rearranjos. Embora esses eventos são menos comuns, temos observado clones em que possam ser detectados nem supressão nem amplicons não-eliminação, e investigações mais refletem esses resultados mais complexos. Temos observado grande CRISPR / Cas9 mediada &quot;cicatrizes&quot; de alelos não-supressão de monoalélicos e não clones de deleção (ver Figura 2B). Estes &quot;cicatrizes&quot; consistemindels pequenas produzidas no local de clivagem sgRNA sem a supressão pretendida (isto é, eliminação do segmento interveniente entre sgRNAs A e B). Estas cicatrizes frequentemente interromper reconhecimento do alvo pelo sgRNA. Por isso, gostaria de instar precaução em redirecionamento alelos em células previamente expostas a sgRNAs usando os mesmos sgRNAs. A estratégia de redirecionamento mais bem-sucedida utilizaria sgRNA única seqüências diferentes locais de reconhecimento anteriormente &quot;cicatrizes&quot;. Nos casos em que um par de sgRNAs reconhece sequências exônicos (Figura 1B, em baixo), do quadro de leitura alelos podem ser produzidos mesmo na ausência de supressão. Portanto, clones de deleção monoalélicos pode ser enriquecido para a perda de função, devido à alta freqüência de mutações de enquadramento sobre a não-excluído alelo 12. Uma preocupação com o sistema CRISPR / Cas9 é fora do alvo efeitos, ou seja, a modificação genómica em locais não intencionais 36-38. Rrelatórios ecente sugeriram que mais curtos RNAs guia com 17-19 nucleotídeos pode reduzir a freqüência de CRISPR / Cas9 baseado no off-alvo efeitos 39. Além disso, uma estratégia dupla nicking utilizando duas guias por local de destino com uma nickase pode ser usado para criar LAP enquanto minimiza os efeitos fora do alvo 7. Alternativamente, análogos de estratégias utilizadas para RNAi, sugerimos que diferentes pares de sequências com sgRNAs protospacer não sobrepostos ser usado para demonstrar que o fenótipo observado é o resultado da CRISPR / alteração no alvo Cas9 em oposição a um potencial fora do alvo efeito. Uma abordagem seria conveniente para conceber, pelo menos, dois pares sgRNA adjacentes mas que não se sobrepõem de modo a que um único conjunto de iniciadores de rastreio (ver passo 2) pode ser usado para múltiplos pares sgRNA (Figura 1A). Além disso, complementando a linha de células de eliminação, reintroduzindo a sequência de falta e / ou gene interrompido pode fundamentar uma relação causal entreuma determinada deleção genómica e fenótipo. Para os biólogos que trabalham com sistemas de modelos celulares, RNAi tem representado uma ferramenta poderosa para a genómica funcional. No entanto, as limitações dessa abordagem incluem redução incompleta nos níveis de mRNA-alvo, a heterogeneidade do efeito de reagentes independentes visando o mesmo gene, e apresentou efeitos fora do alvo, incluindo efeitos baseados em sementes e não sementes 40-42. Estratégias de edição Genome prometem resolver muitos desses problemas e representam uma abordagem interessante, complementar para prospectivo perturbação genética 8,36,37. Além disso, a edição do genoma permite o estudo de não codificação elementos genéticos de uma forma não é possível por RNAi e desafio por direccionamento convencional aproxima-se de 25. Nós encorajamos geração de deleções genômicas por CRISPR / Cas9 como um método robusto e específico para produzir e caracterizar os alelos de perda de função.

Recent advances in genome engineering technology have allowed for unprecedented opportunities for site-specific modification of the genome. This technology may be utilized to investigate the function of genes and regulatory elements via prospective genetic perturbation. Zinc finger nucleases (ZFNs), transcription-activator like (TAL) effector nucleases (TALENs), and CRISPR/Cas9 RNA-guided nucleases each leverage customizable DNA specificity to localize a nuclease for the introduction of DSBs1&#8211;3. The resulting DSBs can be repaired by indel-forming NHEJ or by homology-directed repair (HDR) using a donor template4.
The CRISPR/Cas9 nuclease pathway, an adaptive immune system in prokaryotic cells5, has been recently adapted for mammalian genome engineering2,3. This tool has been demonstrated to be an inexpensive, efficient, and reliable genome engineering technique6. Briefly, a complex of Streptococcus pyogenes-derived Cas9 nuclease and a sgRNA achieve target recognition via Watson-Crick base-pairing with cognate genomic DNA sequences. sgRNAs include 20-mer sequences complementary to genomic sequences adjacent to an obligate protospacer adjacent motif (PAM) NGG. Cas9 induces a DSB at a predictable position within the target site. Additionally, variants of Cas9 with single-strand cleavage capacity or catalytic inactivity may be used to facilitate &#8220;nicking&#8221; or transcriptional regulation respectively7&#8211;9. CRISPR/Cas9 has been used for a wide range of applications including both knock-in and knockout10,11, large-scale genomic deletions12&#8211;14, pooled library screening for gene discovery15,16, genetic engineering of numerous model organisms10,11,17&#8211;21, as well as gene therapy22,23.
Here we describe a protocol for efficient deletion of desired genomic regions. The protocol includes CRISPR design, cloning, and delivery, as well as deletion, identification, and characterization. Genomic deletions can be generated by the introduction of two CRISPR sgRNAs with Cas9 to induce repair of the resultant two DSBs by NHEJ with deletion of the intervening segment. This strategy has been used to create deletions ranging from one kilobase to over one megabase12. Deletions can be informative for the study of genes and other genetic elements, either in isolation or in combination. There are several potential advantages of genomic deletions as compared to HDR or single-site small indel production. First, this method capitalizes on the high efficiency of NHEJ in many cellular contexts7. The high frequency of deletion limits the number of clones needed to be screened to identify informative clones. Deletion frequency is inversely related to deletion size. Biallelic deletion clones may be retrieved at frequencies at least as great as of probabilistic expectation12. Second, both monoallelic and biallelic deletions may be easily identified and distinguished by conventional PCR, simplifying the screening process. Strategies relying on small indels or point mutations may require RFLP, allele-specific PCR, T7EN1 cleavage assay, Sanger sequencing, RT-qPCR, or immunoblotting, which may be more laborious. Third, by removing a substantial portion of a gene or element of interest, a reliable loss-of-function allele may be obtained. In contrast, frameshift mutations in protein-coding sequences may not always induce nonsense-mediated decay, may produce a hypomorphic or neomorphic allele, or target an exon excluded from an alternate isoform24. Finally, deletions may be particularly revealing for the study of non-coding DNA such as regulatory elements since frameshift mutations as produced by single-site indels would not be relevant25.

<table border="0" cellpadding="0" cellspacing="0" width="842">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:388px;">Name of Material/ Equipment</td>
			<td style="width:168px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T4 Polynucleotide Kinase</td>
			<td>New England Biolabs</td>
			<td>M0201S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T4 DNA Ligase (with associated ligation buffer)</td>
			<td>New England Biolabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Adenosine 5&#39;-Triphosphate (ATP)</td>
			<td>New England Biolabs</td>
			<td>P0756S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BSA, Molecular Biology Grade</td>
			<td>New England Biolabs</td>
			<td>B9000S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BbsI Restriction Enzyme (with associated NEB Buffer 2.1)</td>
			<td>New England Biolabs</td>
			<td>R0539S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pSpCas9(BB) (pX330)</td>
			<td>Addgene</td>
			<td>42230</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">S.O.C. Medium</td>
			<td>Life Technologies</td>
			<td>15544-034</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BTX ECM 830</td>
			<td>Harvard Apparatus</td>
			<td>45-0052</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BTX Solution and 2mm Cuvettes</td>
			<td>Harvard Apparatus</td>
			<td>45-0803</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pmaxGFP Plasmid</td>
			<td>Lonza</td>
			<td>VPA-1003</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuickExtract DNA Extraction Solution</td>
			<td>Epicentre</td>
			<td>QE09050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HotStarTaq PCR Master Mix Kit</td>
			<td>Qiagen</td>
			<td>203443</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Zero Blunt PCR Cloning Kit</td>
			<td>Life Technologies</td>
			<td>K2700-20</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of genomic deletions in mammalian cell lines via crispr/cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific eukaryotic genome engineering. CRISPR/Cas9 is an inexpensive, facile, and efficient genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions. In addition, we describe techniques for deletion, identification, and characterization. This strategy relies on cellular delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a locus in order to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair. Deletions have potential advantages as compared to single-site small indels given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function, and utility for the study of non-coding elements. This approach can be used for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines.

O objetivo deste experimento foi a supressão do Pim1 em células MEL. A utilização de pares múltiplos sgRNA não sobreponíveis (ou seja, sequências protospacer independentes) pode ajudar a controlar os efeitos fora do alvo (Figura 1A). Um fenótipo consistente seria mais provável de resultar de um efeito sobre o alvo, em oposição a um efeito fora do alvo comum partilhada por múltiplas sequências protospacer independentes. Cada par levaria a produção de um breakpoint eliminação única. Se perto em conjunto (isto é, n inferior a ~ 150 pb), os mesmos iniciadores de rastreio pode ser utilizado para detectar deleções produzidas por cada conjunto de sgRNAs. Deleções genómicas podem perturbar genes por meio de pares sgRNA em várias posições em relação ao gene (Figura 1B). Por exemplo, o par pode sgRNA flanqueiam um gene para a eliminação do gene corpo inteiro; o par pode estar localizado dentro de dois exões, com o potencial para criar indels frameshift mesmo se uma ou ambas aleloes não foram excluídos; ou podem flanquear o par de um exão específico para permitir a interrupção de uma isoforma particular. A estratégia utilizada para Pim1 deleção era conceber flanqueando sgRNAs para excluir o corpo inteiro do gene, uma deleção de 8 kb (Figura 2). Esta estratégia foi escolhido, em parte devido ao tamanho relativamente pequeno do gene Pim1. Este exemplo mostra um PAM (verde) na parte superior (Watson) e uma vertente PAM no fundo (Crick) vertente; no entanto, a DSB é independente da sequência de PAM de localização para a cadeia superior ou inferior. pares sgRNA pode ter ambas as sequências PAM na cadeia de cima, tanto na cadeia inferior, ou um de cada. Usando o protocolo acima descrito, foram concebidos dois sgRNA, clonado no vector de expressão pX330, e entregue a células MEL por electroporação, juntamente com um repórter GFP (Figura 2A). O top 3% das células GFP + foram ordenados dois dias pós-eletroporação e banhado por clonagem a diluição limitante. Telaing iniciadores foram concebidos como descrito no passo 2 e, como mostrado na Figura 2. As condições de PCR foram optimizados usando ADNg isoladas a partir de células de ELM parentais e de &quot;a granel&quot; células separadas. 10 dias após o plaqueamento, ADNg foi isolado a partir de todos os clones e rastreados para eliminação através de PCR, que não identificaram-supressão, monoalélicos e clones de deleção bialélicos de acordo com os padrões de não-supressão (ND) e deleção (D) produtos de amplificação (Figura 3) . Os clones de deleção não foram identificados como tendo a presença do produto de amplificação não-eliminação e a ausência de produto de amplificação eliminação. Monoalélicos clones foram identificados como tendo a presença de ambos, o apagamento e não amplicões de deleção. Bialélicos clones foram identificados como tendo a ausência de produto de amplificação não-supressão e a presença do fragmento amplificado eliminação. Por esta eliminação, 400 clones foram selecionados, que identificou 126 clones de deleção monoalélicos e 32 delet bialï¿½ico<html> Os clones de iões (isto é importante notar que a frequência varia com a deleção deleção tamanho 12). Clones de deleção Bialélicos foram selecionados e mudou-se para frascos com 8 ml de mídia. Depois de 5 dias para permitir a expansão, cada um dos clones foi re-testada por PCR de ADNg para confirmar bialélicos de deleção e de deleção amplicões foram submetidos a sequenciação de Sanger para identificar a exacta eliminação (Figura 2B). A heterogeneidade dentro dos amplicons supressão reflete imperfeito formação de indel NHEJ reparo. A sequenciação do alelo não-supressão em clones de deleção monoallelelic indels descoberto na maior parte dos casos, demonstrando que o mesmo alelo não é frequentemente suprimida editado por CRISPR / Cas9, o que pode ser importante para aplicações em que são necessários ambos os clones de deleção monoalélicos e bialélicos . O ARN foi isolado a partir dos clones de deleção bialélicos e analisado por RT-qPCR para confirmar a perda da expressão Pim1 (Figura 4). maneiras &quot;&gt; <img alt="Figura 1" src="/files/ftp_upload/52118/52118fig1highres.jpg" /> Figura 1. Esquema de possíveis estratégias de eliminação. (A) Dois exemplos de pares sgRNA para deleções genômicas (mostradas em preto e laranja, respectivamente). As setas azuis indicam primers para detectar o amplicon não-exclusão e setas vermelhas indicam primers para detectar o amplicon eliminação. sgRNA posições 17 e 18 são destacadas em vermelho e azul na sgRNA-Sites-A 1 / A 2 e são destacadas em roxo e laranja no-sgRNA-Sites B 1 / B 2 com uma linha vermelha que indica a clivagem Cas9 previsto entre as posições 17 e 18. (B) clivagens dirigida-CRISPR são mostrados como linhas pretas verticais. As setas azuis indicam primers para detectar o amplicon não-exclusão e setas vermelhas indicam primers para detectar o amplicon eliminação. <a href="https://www.jove.com/files/ftp_upload/52118/52118fig1large.jpg" target="_blank">Por favor, clique aqui para ver</a>uma versão maior desta figura. <img alt="Figura 2" src="/files/ftp_upload/52118/52118fig2highres.jpg" /> Figura 2. Estratégia para produzir e detectar deleção de Pim1, inclusive exclusão sequenciamento e alelos não-eliminação. (A) esquemático da estratégia de rastreamento baseado em PCR para identificar clones de deleção Pim1. Um par de iniciadores situa-se à deleção interna (setas azuis) e um par de iniciadores está localizada externo para a supressão (setas vermelhas). sequências sgRNA (sequências protospacer) são mostrados em roxo. As linhas vermelhas verticais indicam a clivagem Cas9 previsto entre as posições 17 e 18 da sequência sgRNA. (B) sequenciamento Sanger revela formação indel no local do reconhecimento sgRNA. sequências sgRNA são mostrados em sequências roxas e PAM em verde. Eventos de deleção são shpróprio por um número equivalente de marcas de traço e inserções são destacadas em azul. Linhas vermelhas verticais indicam previu local de clivagem, entre as posições 17 e 18 do sgRNA. <a href="https://www.jove.com/files/ftp_upload/52118/52118fig2large.jpg" target="_blank">Por favor, clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 3" src="/files/ftp_upload/52118/52118fig3highres.jpg" /> Figura 3. Gel Representante identificação não exclusão, monoalélicos, e clones bialï¿½icos. Para cada clone, a faixa da esquerda representa o amplicon não-exclusão (&quot;ND&quot; em azul) e na faixa da direita representa o amplicon eliminação (&quot;D&quot; no vermelho ). Os clones individuais que são separadas por linhas tracejadas. Os três clones de deleção monoalélicos são clones 5, 6 e 2. Os três clones de deleção bialï¿½icos são clones 15, 17 e 13. Como visto nos dados de sequenciamento, a banda de eliminação para c<html> solitário 13 tem um tamanho menor, devido a delecções maiores da junção da deleção. <img alt="Figura 4" src="/files/ftp_upload/52118/52118fig4highres.jpg" /> Figura 4. A perda da expressão em clones de deleção Pim1 bialélicos. Pim1 expressão foi calculada para dois clones de deleção bialélicos por RT-qPCR. Os dados foram normalizados para GAPDH utilizando o 2 - Método ΔCt. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> Protospacer Sequence </td></tr><tr><td> sgRNA-A </td><td> 5&#39;-TAGGAAAATGACTCGTCACT-3 &#39; </td></tr><tr><td> sgRNA-B </td><td> 5&#39;-GTCTATCCTATCTCGATAAA-3 &#39; </td></tr></tbody></table> Tabela 1. sequências protospacer 20-mer para dois sgRNA a supressão do Pim1. 543 &quot;&gt; <tbody><tr height="23"><td height="23" style="height:23px;width:101px;"></td><td style="width:443px;"> Complemento reverso de Protospacer Sequence </td></tr><tr height="23"><td height="23" style="height:23px;"> sgRNA-A-rc </td><td> 5&#39;-AGTGACGAGTCATTTTCCTA-3 &#39; </td></tr><tr height="23"><td height="23" style="height:23px;"> sgRNA-B-rc </td><td> 5&#39;-TTTATCGAGATAGGATAGAC-3 &#39; </td></tr></tbody></table> Tabela 2. complemento reverso das sequências protospacer para os dois sgRNA a partir da Tabela 1. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> Sequências </td></tr><tr><td> sgRNA-A </td><td> 5&#39;-CACCTAGGAAAATGACTCGTCACT-3 &#39; </td></tr><tr><td> sgRNA-A-rc </td><td> 5&#39;-AAACAGTGACGAGTCATTTTCCTA-3 &#39; </td></tr><tr><td> sgRNA-B </td><td> 5&#39;-CACCGTCTATCCTATCTCGATAAA-3 &#39; </td></tr><tr><td> sgRNA-B-rc </td><td> 5&#39;-AAACTTTATCGAGATAGGATAGAC-3 &#39; </td></tr></tbody></table> Tabela 3. sequências Protospacer e os seus complementos reversa com &quot;CACC&quot; e &quot;AAAC&quot; adicionado para clonagem no vector utilizando enzimas de restrição pX330 Bbsl. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> Sequências </td></tr><tr><td> sgRNA-A </td><td> CACCGTAGGAAAATGACTCGTCACT 5&#39;-3 &#39; </td></tr><tr><td> sgRNA-A-rc </td><td> AAACAGTGACGAGTCATTTTCCTAC 5&#39;-3 &#39; </td></tr><tr><td> sgRNA-B </td><td> CACCGTCTATCCTATCTCGATAAA 5&#39;-3 &#39; </td></tr><tr><td> sgRNA-B-rc </td><td> AAACTTTATCGAGATAGGATAGAC 5&#39;-3 &#39; </td></tr></tbody></table> Tabela 4. sgRNA expressão a partir do promotor U6 do vector pX330 é aumentada pela adição de um nucleótido G após a sequência CACC e antes da20-mer. A adição de um nucleótido G adicional requer a adição de um nucleótido C na extremidade 3 &#39;do oligo complemento reverso (por exemplo, sgRNA-A). No entanto, se a primeira posição do 20-mer (sequência protospacer) já é um nucleótido G, não há necessidade de adicionar outro G (por exemplo, sgRNA-B) e não há necessidade de adicionar C para a posição final do complemento reverso oligo.

Watch this Scientific Journal Video about Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9 at JoVE.com

Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9

CRISPR/Cas9 is a robust system to produce disruption of genes and genetic elements. Here we describe a protocol for the efficient creation of genomic deletions in mammalian cell lines using CRISPR/Cas9.

Geração de Genomic Eliminações em linhas celulares de mamíferos através CRISPR / Cas9

The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be re-purposed for site-specific ...

generation-of-genomic-deletions-in-mammalian-cell-lines-via-crisprcas9

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 2

Analyzing Gene Expression and Function

SCIENTISTS IN ACTION

MISSION esiRNA for RNAi Screening in Mammalian Cells

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as small interfering RNAs (siRNAs). The short double-stranded RNAs originate from longer double stranded precursors by the activity of Dicer, a protein of the RNase III family of endonucleases. The resulting fragments are components of the RNA-induced silencing complex (RISC), directing it to the cognate target mRNA. RISC cleaves the target mRNA thereby reducing the expression of the encoded protein1,2,3. RNAi has become a powerful and widely used experimental method for loss of gene function studies in mammalian cells utilizing small interfering RNAs.
Currently two main methods are available for the production of small interfering RNAs. One method involves chemical synthesis, whereas an alternative method employs endonucleolytic cleavage of target specific long double-stranded RNAs by RNase III in vitro. Thereby, a diverse pool of siRNA-like oligonucleotides is produced which is also known as endoribonuclease-prepared siRNA or esiRNA. A comparison of efficacy of chemically derived siRNAs and esiRNAs shows that both triggers are potent in target-gene silencing. Differences can, however, be seen when comparing specificity. Many single chemically synthesized siRNAs produce prominent off-target effects, whereas the complex mixture inherent in esiRNAs leads to a more specific knockdown10.
In this study, we present the design of genome-scale MISSION esiRNA libraries and its utilization for RNAi screening exemplified by a DNA-content screen for the identification of genes involved in cell cycle progression. We show how to optimize the transfection protocol and the assay for screening in high throughput. We also demonstrate how large data-sets can be evaluated statistically and present methods to validate primary hits. Finally, we give potential starting points for further functional characterizations of validated hits.

Here we use a human esiRNA library in a high-throughput screen for genes involved in cell division. We demonstrate how to set up and conduct an esiRNA screens, as well as how to analyze and validate the results.

EsiRNA MISSÃO para a seleção RNAi em células de mamíferos

RNA interference (RNAi) is a basic cellular mechanism for the control of gene expression. RNAi is induced by short double-stranded RNAs also known as ...

Biologia

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be produced to contain any desired DNA or RNA sequence and can be prepared to include a wide variety of base and sugar modifications. Moreover, oligos can be designed to mimic specific nucleic acid alterations and thus, can serve as important tools to investigate effects of DNA damage and mechanisms of repair. We found that Thermo Scientific Dharmacon RNA-containing oligos with a length between 50 and 80 nucleotides can be particularly suitable to study, in vivo, functions and consequences of chromosomal RNA/DNA hybrids and of ribonucleotides embedded into DNA. RNA/DNA hybrids can readily form during DNA replication, repair and transcription, however, very little is known about the stability of RNA/DNA hybrids in cells and to which extent these hybrids can affect the genetic integrity of cells. RNA-containing oligos, therefore, represent a perfect vector to introduce ribonucleotides into chromosomal DNA and generate RNA/DNA hybrids of chosen length and base composition. Here we present the protocol for the incorporation of ribonucleotides into the genome of the eukaryotic model system yeast /Saccharomyces cerevisiae/. Yet, our lab has utilized Thermo Scientific Dharmacon RNA-containing oligos to generate RNA/DNA hybrids at the chromosomal level in different cell systems, from bacteria to human cells.

This work shows how to form an RNA/DNA hybrid at the chromosomal level and reveal transfer of genetic information from RNA to genomic DNA in yeast cells.

Geração de RNA / DNA híbrido em DNA genômico por transformação por meio de RNA contendo Oligonucleotídeos

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

O Processo de monstro verde para a Geração de linhagens de levedura de transporte deleções de genes múltiplos

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Generation of Stable Human Cell Lines with Tetracycline-inducible (Tet-on) shRNA or cDNA Expression

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon1, to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells2,3. In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here.
Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells4, vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs5-11. However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.12 modified the shRNA expression vector pSUPER5 by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest.
Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome13,14 and apoptosis signaling15,16. In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

Generation of Stable Human Cell Lines with Tetracycline-inducible Tet-on shRNA or cDNA Expression

A rapid and simple way to generate human cell lines with inducible and reversible cDNA overexpression or shRNA-mediated knock-down of the gene of interest. This method enables researchers to reliably and highly reproducibly manipulate cell lines that are difficult to alter by transient transfection methods or conventional knockdown/knockout strategies.

A geração de linhas de células humanas estáveis ​​com tetraciclina induzível (Tet-on) ou shRNA Expression cDNA

A major approach in  the field of mammalian cell biology is the manipulation of the expression of  genes of interest in selected cell lines, with the aim ...

Anaerobic Growth and Maintenance of Mammalian Cell Lines

Most mucosal surfaces along with the midpoints in tumors and stem cell niches are geographic areas of the body that are anoxic. Previous studies show that the incubation in normoxic (5% CO2 in air) or hypoxic (low oxygen levels) conditions followed by an anoxic incubation (an absence of free oxygen) results in limited viability (2&#8211;3 days). A novel methodology was developed that enables an anoxic cell cultivation (for at least 17 days; the maximum time tested). The most critical aspect of this methodology is to ensure that no oxygen is introduced into the system. This is obtained by the degassing of media, and by flushing tubes, dishes, flasks, and pipettes with an anaerobic gas mixture (H2, CO2, N2) followed by permitting the materials to equilibrate to the anoxic (non-oxygen) environment prior to usage.&#160;Additional care must be exercised when acquiring photomicrographs to ensure that the micrographs obtained do not contain artifacts. In the absence of oxygen, cell morphology is significantly altered. Two distinct morphotypes are noted for all anaerobically-grown cells. The ability to grow and maintain mammalian cells in the absence of oxygen can be applied to the analysis of cell physiology, polymicrobial interactions, and the characterization of biosynthetic pathways for novel cancer drug development.

Here, we describe a new method that enables the anaerobic long-term cultivation of established cell lines. The maximum survival time that was tested is 17 days. This method is suitable for the testing of cytotoxic agents and exploring the physiology of anoxically replicating cells.

Crescimento anaeróbico e manutenção de linhas de células de mamíferos

Most mucosal surfaces along with the midpoints in tumors and stem cell niches are geographic areas of the body that are anoxic. Previous studies show that ...

Silencing the Spark: CRISPR/Cas9 Genome Editing in Weakly Electric Fish

Electroreception and electrogenesis have changed in the evolutionary history of vertebrates. There is a striking degree of convergence in these independently derived phenotypes, which share a common genetic architecture. This is perhaps best exemplified by the numerous convergent features of gymnotiforms and mormyrids, two species-rich teleost clades that produce and detect weak electric fields and are called weakly electric fish. In the 50 years since the discovery that weakly electric fish use electricity to sense their surroundings and communicate, a growing community of scientists has gained tremendous insights into evolution of development, systems and circuits neuroscience, cellular physiology, ecology, evolutionary biology, and behavior. More recently, there has been a proliferation of genomic resources for electric fish. Use of these resources has already facilitated important insights with regards to the connection between genotype and phenotype in these species. A major obstacle to integrating genomics data with phenotypic data of weakly electric fish is a present lack of functional genomics tools. We report here a full protocol for performing CRISPR/Cas9 mutagenesis that utilizes endogenous DNA repair mechanisms in weakly electric fish. We demonstrate that this protocol is equally effective in both the mormyrid species Brienomyrus brachyistius and the gymnotiform Brachyhypopomus gauderio by using CRISPR/Cas9 to target indels and point mutations in the first exon of the sodium channel gene scn4aa. Using this protocol, embryos from both species were obtained and genotyped to confirm that the predicted mutations in the first exon of the sodium channel scn4aa were present. The knock-out success phenotype was confirmed with recordings showing reduced electric organ discharge amplitudes when compared to uninjected size-matched controls.

Here, a protocol is presented to produce and rear CRISPR/Cas9 genome knockout electric fish. Outlined in detail are the required molecular biology, breeding, and husbandry requirements for both a gymnotiform and a mormyrid, and injection techniques to produce Cas9-induced indel F0 larvae.

Silenciando a faísca: Edição do genoma CRISPR/Cas9 em peixes fraca elétricos

Electroreception and electrogenesis have changed in the evolutionary history of vertebrates. There is a striking degree of convergence in these ...

Genome Engineering of Primary Human B Cells Using CRISPR/Cas9

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make attractive candidates for cell-based therapies because of their ease of isolation from peripheral blood, their ability to expand in vitro, and their longevity in vivo. Additionally, their normal biological function&#8212;to produce large amounts of antibodies&#8212;can be utilized to express very large amounts of a therapeutic protein, such as a recombinant antibody to fight infection, or an enzyme for the treatment of enzymopathies. Here, we provide detailed methods for isolating primary human B cells from peripheral blood mononuclear cells (PBMCs) and activating/expanding isolated B cells in vitro. We then demonstrate the steps involved in using the CRISPR/Cas9 system for site-specific KO of endogenous genes in B cells. This method allows for efficient KO of various genes, which can be used to study the biological functions of genes of interest. We then demonstrate the steps for using the CRISPR/Cas9 system together with a recombinant, adeno-associated, viral (rAAV) vector for efficient site-specific integration of a transgene expression cassette in B cells. Together, this protocol provides a step-by-step engineering platform that can be used in primary human B cells to study biological functions of genes as well as for the development of B-cell therapeutics.

Here we provide a detailed, step-by-step protocol for CRISPR/Cas9-based genome engineering of primary human B cells for gene knockout (KO) and knock-in (KI) to study biological functions of genes in B cells and the development of B-cell therapeutics.

Engenharia de Genoma de Células B Humanas Primárias Usando CRISPR/Cas9

B cells are lymphocytes derived from hematopoietic stem cells and are a key component of the humoral arm of the adaptive immune system. They make ...

TGF-&#946;-mediated Endothelial to Mesenchymal Transition (EndMT) and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing

In response to specific external cues and the activation of certain transcription factors, endothelial cells can differentiate into a mesenchymal-like phenotype, a process that is termed endothelial to mesenchymal transition (EndMT). Emerging results have suggested that EndMT is causally linked to multiple human diseases, such as fibrosis and cancer. In addition, endothelial-derived mesenchymal cells may be applied in tissue regeneration procedures, as they can be further differentiated into various cell types (e.g., osteoblasts and chondrocytes). Thus, the selective manipulation of EndMT may have clinical potential. Like epithelial-mesenchymal transition (EMT), EndMT can be strongly induced by the secreted cytokine transforming growth factor-beta (TGF-&#946;), which stimulates the expression of so-called EndMT transcription factors (EndMT-TFs), including Snail and Slug. These EndMT-TFs then up- and downregulate the levels of mesenchymal and endothelial proteins, respectively. Here, we describe methods to investigate TGF-&#946;-induced EndMT in vitro, including a protocol to study the role of particular TFs in TGF-&#946;-induced EndMT. Using these techniques, we provide evidence that TGF-&#946;2 stimulates EndMT in murine pancreatic microvascular endothelial cells (MS-1 cells), and that the genetic depletion of Snail using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9)-mediated gene editing, abrogates this phenomenon. This approach may serve as a model to interrogate potential modulators of endothelial biology, and can be used to perform genetic or pharmacological screens in order to identify novel regulators of EndMT, with potential application in human disease.

TGF-&amp;#946;-mediated Endothelial to Mesenchymal Transition EndMT and the Functional Assessment of EndMT Effectors using CRISPR/Cas9 Gene Editing

We describe methods to investigate TGF-&#946;2-induced EndMT in endothelial cells by observing cell morphology changes and examining the expression EndMT-related marker changes using immunofluorescence staining. CRISPR/Cas9 gene editing was described and used to deplete the gene encoding Snail to investigate its role in TGF-&#946;2-induced EndMT.

Endotelial mediado por TGF-β para transição mesenquimal (EndMT) e a avaliação funcional dos efeitos endMT usando edição de genes CRISPR/Cas9

In response to specific external cues and the activation of certain transcription factors, endothelial cells can differentiate into a mesenchymal-like ...

Construction of Homozygous Mutants of Migratory Locust Using CRISPR/Cas9 Technology

The migratory locust, Locusta migratoria, is not only one of the worldwide plague locusts that caused huge economic losses to human beings but also an important research model for insect metamorphosis. The CRISPR/Cas9 system can accurately locate at a specific DNA locus and cleave within the target site, efficiently introducing double-strand breaks to induce target gene knockout or integrate new gene fragments into the specific locus. CRISPR/Cas9-mediated genome editing is a powerful tool for addressing questions encountered in locust research as well as a promising technology for locust control. This study provides a systematic protocol for CRISPR/Cas9-mediated gene knockout with the complex of Cas9 protein and single guide RNAs (sgRNAs) in migratory locusts. The selection of target sites and design of sgRNA are described in detail, followed by in vitro synthesis and verification of the sgRNAs. Subsequent procedures include egg raft collection and tanned-egg separation to achieve successful microinjection with low mortality rate, egg culture,&#160;preliminary estimation of the mutation rate, locust breeding as well as detection, preservation, and passage of the mutants to ensure population stability of the edited locusts. This method can be used as a reference for CRISPR/Cas9 based gene editing applications in migratory locusts as well as in other insects.

This study provides a systematically optimized procedure of CRISPR/Cas9 ribonuclease-based construction of homozygous locust mutants as well as a detailed method for cryopreservation and resuscitation of the locust eggs.

Construção de mutantes homozigotos de gafanhotos migratórios utilizando tecnologia CRISPR/Cas9

The migratory locust, Locusta migratoria, is not only one of the worldwide plague locusts that caused huge economic losses to human beings but also an ...

CRISPR/Cas9 Gene Editing of Hematopoietic Stem and Progenitor Cells for Gene Therapy Applications

CRISPR/Cas9 is a highly versatile and efficient gene-editing tool adopted widely to correct various genetic mutations. The feasibility of gene manipulation of hematopoietic stem and progenitor cells (HSPCs) in vitro makes HSPCs an ideal target cell for gene therapy. However, HSPCs moderately lose their engraftment and multilineage repopulation potential in ex vivo culture. In the present study, ideal culture conditions are described that improves HSPC engraftment and generate an increased number of gene-modified cells in vivo. The current report displays optimized in vitro culture conditions, including the type of culture media, unique small molecule cocktail supplementation, cytokine concentration, cell culture plates, and culture density. In addition to that, an optimized HSPC gene-editing procedure, along with the validation of the gene-editing events, are provided. For in vivo validation, the gene-edited HSPCs infusion and post-engraftment analysis in mouse recipients are displayed. The results demonstrated that the culture system increased the frequency of functional HSCs in vitro, resulting in robust engraftment of gene-edited cells in vivo.

The present protocol describes an optimized hematopoietic stem and progenitor cell (HSPC) culture procedure for the robust engraftment of gene-edited cells in vivo.