Name: evaluating the effectiveness of cancer drug sensitization in vitro and in vivo
Uploaded: 2015-02-06T14:00:00
Description: Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

이 작품은 우수 온타리오 센터와 온타리오 연구 기금 JK 보조금에 의해 가능하게되었다. 우리는 촬영하는 동안 기술 지원을 Siddika Pardhan 박사 피터 퍼거슨 감독에게 감사의 말씀을 전합니다.

참고 : 다음 프로토콜이 부착 세포와 함께 사용하도록 설계되었습니다. 수정은 정지에서 재배 비 부착 세포에 방법을 적용해야합니다. 프로토콜에 설명 된 CAM 실험은 형광 표지 (예를 들면, GFP, RFP 등)를 발현하는 세포와 함께 사용하도록 설계된다. 나인 일된 닭 배아 CAM 실험에 대한 실험 프로토콜의 2 일에 필요합니다. 1. 준비 및 안티센스 올리고 뉴클레오티드와...

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

때문에 임상 시험과 관련된 고유의 비용과 위험에, 더 적절하게 신규 항암 치료법을 평가하기위한 예비 임상 시험 방법론보다 엄격한 개발이 요구된다. 현재 일반적으로 사용되는 기술 덜 효과​​적 일 수있다 모든 전시 잠재적으로 유망한 치료 대상 / 에이전트를 구별하는 능력을 제한 할 수 있습니다 약점, 그리고 그. 우리는 기존 방식의 많은 단점을 해결 새로운 항암 접근법을 평가하는 프로...

세포 독성 암 치료는 치료 실패, 재발로 이어질 수있는 중요한 임상 적 문제가 대상 및 / 또는에 대한 내성을 획득하고, 환자 사망률 1 증가했다. 대부분의 종양에서 이질성의 높은 수준을 고려할 때, 충분히 높은 세포 수의 종양은 그 세포가 생존 2,3- 대해 의존하는 분자 경로를 표적으로 단일 또는 조합 요법에 내성 세포의 서브 세트를 포함 할 것이다 수학적 확실성이다. 종양 세포에 긍정적 재발 선도, 치료 기간 동안 선택 될 수있다. 동시에 전 또는 치료 매개 선택 이후에, 다른 암 세포 생존 메카니즘을 대상 신규 치료법의 개발은, 따라서 임상 적으로 중요한 것이다. 종양에서 게놈의 불안정성 게놈 돌연변이의 높은 수준의 비 종양 (4) 숙주 세포로부터 암세포를 구별 기본적인 특징이다. 따라서, usefu- DNA 손상 화학 요법의 효능을 증가시키는 저항의 발생을 예방하기 위해 L 전략 적극적 종양 세포 5 DNA 복구를 억제하는 것이다. 이것은 예비 임상 탐구되고 조사 및 신규 DNA 복구 다양한 대상의 활성 필드이다. 이들 소분자 또는 안티센스 표적 계 억제제의 수는 개발되어 6-8 테스트 겪고있다. 목적은 임상 시험에서 안전성과 효능을 가장 유망한 전임상 후보를 식별하고 평가하는 것입니다. 임상 시험의 고비용 (차선 전임상 평가를 포함한 여러 이유로) 실패의 위험이 새로운 치료법의 개발에 9 진행 강력한 장애물이다. 적절히 치료 대상 및 새로운 약물 후보를 평가할 수있는 적절하고 엄격한 전임상 모델의 사용은 임상 시험 (10)의 높은 실패율을 감소시킬 수있다 </suP&gt;. 시험 관내 (세포 증식 분석법) 종양 세포의 능력에있어서, b) 치료 - 유도 환원에서 종양 세포의 증식을 감소시키는 능력) 측정 : 일부 공통적으로 사용 전임상 방법은 신규 한 항암 요법의 효과이다을 평가 폼 조직 배양 콜로니 (콜로니 형성 어 세이) 시험 관내 (레 독스 염료 변환) 시험 관내 종양 세포 사멸, d) 요법 - 유도 유도 (세포 사멸, 괴사가 포식이 연관된 종양 세포 대사 활동에있어서, c) 요법 - 유도 환원 생체 내에서 유사 분열 등) (11), 전자)와 함께 인간과 마우스 이종 이식 12-14의 성장 또는 절제의 감소를 치료 유도. 체외 나열된 방법 중 가장 큰 문제점은 이들 중 어느 것도 후보 치료제의 효과를 실시간 평가를 제공하지 않는다는 것이다. 오히려, 그들은 단지 선택된 넓게 분리 된 시점에서 정보를 제공 할치료 과정 동안. 이러한 측정은 정확하게 종양 세포 반응의 강도 및 타이밍을 반영하는 능력을 감소 하였다. 생체 내 마우스 이종 이식 모델은 또한 높은 비용, 완료하는 시간의 길이, 차선 투여 및 치료시기 (스케줄링)의 위험에 의해 제한된다. 또한, 설치류 이종 이식 모델 차 인간 종양 세포의 반응을 시험 관내 평가와 비교하여 인간에서의 임상 효능 한정 예측 및 후보 치료 개입 (15, 16)에 확립 된 인간 종양 세포주가 있다는 증거가있다. 우리는 위에서 설명한보다 일반적인 절차의 단점을 해결하는 방식으로, 예비 임상 신약 조합을 평가하기 위하여 새로운 조합 프로토콜을 고안했다. 증식, 콜로니 형성 또는 산화 환원 염료 변환 분석 대신에, 우리는 실시간으로 세포 부착, 호흡, 산성화를 분석 대사 측정 유닛을 이용전체 치료 기간 동안 17. 동시에, 우리는 닭 배아 침윤 및 전이의 융모 18,19 막 (CAM) 모델을 사용하여 생체 내에서 조합 치료의 효과를 조사 하였다. 우리는 일반적으로 사용되는 화학 요법 약물 시스플라틴의 효과를 강화시키는 데 BRCA2 타겟팅 안티센스 올리고 뉴클레오티드 (ASO)의 능력을 평가하기 위해 다음 방법을 사용 하였다.

<table border="0" cellpadding="0" cellspacing="0" >
	<tbody>
		<tr >
			<td >Name of Material/ Equipment</td>
			<td >Company</td>
			<td >Catalog Number</td>
			<td >Comments/Description</td>
		</tr>
		<tr >
			<td >A549 cells</td>
			<td >ATCC</td>
			<td >CCL-185</td>
			<td>http://www.atcc.org/products/all/CCL-185.aspx</td>
		</tr>
		<tr >
			<td >AeraSeal film&#160;</td>
			<td >Carl Roth GmbH</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >AMEM</td>
			<td >Wisent Bioproducts</td>
			<td >210-011-QK</td>
			<td></td>
		</tr>
		<tr >
			<td >Antisense oligodeoxynucleotides</td>
			<td >Avecia</td>
			<td ></td>
			<td>BRCA2 target sequence: 5&#39; - UAAGGAACGUCAAGAGAUAC - 3&#39; (bases 7241-7259 )</td>
		</tr>
		<tr >
			<td >Axio Zoom V16 Microscope</td>
			<td >Carl Zeiss</td>
			<td ></td>
			<td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td>
		</tr>
		<tr >
			<td >Bionas Biosensor Chips</td>
			<td >Bionas GmbH and Micronas GmbH</td>
			<td >BIS8001D</td>
			<td></td>
		</tr>
		<tr >
			<td >Bionas Discovery 2500 System&#160;</td>
			<td >Bionas GmbH</td>
			<td ></td>
			<td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td>
		</tr>
		<tr >
			<td >Cisplatin</td>
			<td >Sigma Aldrich</td>
			<td >479306</td>
			<td></td>
		</tr>
		<tr >
			<td >Fertilized chicken eggs</td>
			<td >Sourced locally</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Fetal bovine serum&#160;</td>
			<td >Gibco - Life Technologies</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Lipofectamine 2000&#160;</td>
			<td >Invitrogen - Life Technologies&#160;</td>
			<td >12566014</td>
			<td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td>
		</tr>
		<tr >
			<td >PBS</td>
			<td >Wisent Bioproducts</td>
			<td >311-010-CL</td>
			<td></td>
		</tr>
		<tr >
			<td >Trypsin (0.25%)/EDTA</td>
			<td >Wisent Bioproducts</td>
			<td >325-043-CL</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

이질성 때문에 동일한 경로를 대상으로 인간의 암 치료 단독 투여 또는 조합 요법에 내재 돌연변이 하이 레벨로, 실패 할 가능성이있다. 중점 치료에 고유 및 / 또는 적응 저항에 대한 책임이 있습니다 경로의 억제에 배치해야합니다. 조사의 활성 필드는 일반적으로 개발 및 화학 요법과 방사선 요법을 사용의 작용을 촉진하고, 내성을 방지 DNA 수리 억제제의 시험이다. 우리는 DNA 손상 약물 시스플라틴에 종양 세포를 감작하는 수단으로 BRCA2 억제의 효과를 평가하기 위해 신규 한 프로토콜을 사용했다. 종양 세포 대사 (호흡 산성화)는 분 단위로 분에 치료 효과를 묘사하기 위해 72 시간 동안 실시간으로 모니터링 하였다. 조합에서, 우리는 닭 배아 융모 막 (CAM) 혈관 외 유출과 침략의 모델을 이용하여 전이 주파수의 평가를 수행 하였다. 이프로토콜은 새로운 암 치료 요법을 평가하기 위해 생체 외 및 생체 방법에 사용되는 일반적으로의 약점 중 일부를 해결합니다. 이는 이러한 세포 증식 분석, 세포 사멸 분석과 같은 일반적인 방법에 더하여 사용될 수 있으며, 생체 내 뮤린 이종 이식 연구에서 더욱 밀접 후보 타겟 및 에이전트들 사이를 구별하고, 또한 개발을위한 가장 유망한 후보를 선택한다.

결과 및 수치는 출판 일 (22)의 허가 적응. BRCA2 억제 시스플라틴 처리 된 종양 세포 호흡의 감소를 유도 ASO를 BRCA2가 타겟팅 및 시스플라틴 단독 제어 ASO 시스플라틴을받은 세포에 비해 호흡에서 이른 감소 및 비가역을 나타내 처리 인간 A549 폐암 세포; 처리 된 세포를 시스플라틴 치료 24 시간 BRCA2 ASO 제어 ASO 호흡 사이의 차이 후 39 % (...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

암 약물 과민 반응의 효과를 평가<em&gt; 체외</em&gt; 및<em&gt; 생체</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

체외에서</em전이성 종양 성장에 휴면하고 스위치를 연구하기> 시스템

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent ...

연구

의학

Live Imaging of Drug Responses in the Tumor Microenvironment in Mouse Models of Breast Cancer

유방암의 마우스 모델에서 종양 Microenvironment에 약물 응답의 영상을 라​​이브

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional ...

Slow-release Drug Delivery through Elvax 40W to the Rat Retina: Implications for the Treatment of Chronic Conditions

쥐의 망막에 Elvax 40W를 통해 서방 약물 전달 : 만성 질환의 치료를위한 시사점

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these ...

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

마우스의 탁산의 약동학 및 약력 학적 분석을위한 경동맥 팅크

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study ...

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

생체 내 및 생체 외 복막 지방이에 밀키 스팟 구조의 난소 암 전이성 식민지를 연구하는 접근 방식

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

췌장암 새로운 치료 전략을 개발하기위한 전지 특성 줄기 공부

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Depletion of Mouse Cells from Human Tumor Xenografts Significantly Improves Downstream Analysis of Target Cells

인간 종양 이종 이식에서 마우스 세포의 고갈은 크게 대상 세포의 다운 스트림 분석을 향상

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

포스 콜린 유발 장내 Organoids에 붓기 일 :<em&gt; 체외</em&gt; 분석 낭포 성 섬유증 환자의 약물 반응을 평가하기위한

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

의 최적화 분석<em&gt; 생체</em&gt; 및<em&gt; 체외</em&gt; 간 지방증

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

약초의 준비 : Er-Xian의 달임과 Er-Xian 함유 세럼<em&gt; In Vivo</em&gt; 및<em&gt; 체외에서</em&gt; 실험

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the ...